Multiple sequence alignment - TraesCS7D01G465200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G465200 chr7D 100.000 2819 0 0 1 2819 579341572 579344390 0.000000e+00 5206
1 TraesCS7D01G465200 chr7D 96.955 2529 70 5 295 2819 78630540 78633065 0.000000e+00 4237
2 TraesCS7D01G465200 chr7D 95.595 227 10 0 39 265 78630317 78630543 5.740000e-97 364
3 TraesCS7D01G465200 chr1D 97.447 2820 53 11 1 2819 413810013 413807212 0.000000e+00 4791


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G465200 chr7D 579341572 579344390 2818 False 5206.0 5206 100.000 1 2819 1 chr7D.!!$F1 2818
1 TraesCS7D01G465200 chr7D 78630317 78633065 2748 False 2300.5 4237 96.275 39 2819 2 chr7D.!!$F2 2780
2 TraesCS7D01G465200 chr1D 413807212 413810013 2801 True 4791.0 4791 97.447 1 2819 1 chr1D.!!$R1 2818

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
510 511 2.047443 AGCGACCGGGAAGACTCTC 61.047 63.158 6.32 0.0 0.0 3.20 F
958 962 2.287009 GGACTGAGTTTCCTTTTGCACG 60.287 50.000 0.00 0.0 0.0 5.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1599 1603 1.140852 CCCCAGAAATCGATAGTGGCA 59.859 52.381 12.93 0.0 37.40 4.92 R
2174 2178 1.168714 GGCTGCATCGGAGAAAAAGT 58.831 50.000 0.50 0.0 43.58 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
288 289 5.174579 GTGTCGTCTATATTTTAAGCGGGAC 59.825 44.000 0.00 0.00 0.00 4.46
510 511 2.047443 AGCGACCGGGAAGACTCTC 61.047 63.158 6.32 0.00 0.00 3.20
711 714 3.008330 TCGTAAGGTCAGCTGACTAGAC 58.992 50.000 38.17 30.04 44.20 2.59
958 962 2.287009 GGACTGAGTTTCCTTTTGCACG 60.287 50.000 0.00 0.00 0.00 5.34
1016 1020 4.074259 ACAAACATGTCAGATGCAGCTAA 58.926 39.130 3.06 0.00 0.00 3.09
1599 1603 3.378112 CACCGACCACAAAGCATGATTAT 59.622 43.478 0.00 0.00 0.00 1.28
1946 1950 5.934781 AGGAGTTTGATCAAAAGTCAGTCT 58.065 37.500 22.07 12.88 46.18 3.24
2018 2022 3.199290 AGCGCTATGGTGAGTCTCT 57.801 52.632 8.99 0.00 0.00 3.10
2117 2121 0.169672 GCTACGCGACCACTCAACTA 59.830 55.000 15.93 0.00 0.00 2.24
2174 2178 3.119459 GCTGTCAGAGTCCAGAAATACGA 60.119 47.826 3.32 0.00 0.00 3.43
2326 2330 2.022722 AGGGCCCATGGATTTCTCAAAT 60.023 45.455 27.56 0.00 0.00 2.32
2334 2338 6.833416 CCCATGGATTTCTCAAATTACCTACA 59.167 38.462 15.22 0.00 0.00 2.74
2409 2413 1.814394 GTTCCTGCTCACATGCATCAA 59.186 47.619 0.00 0.00 42.48 2.57
2684 2689 3.511146 TCCTTCAGCACATCCATTTTTCC 59.489 43.478 0.00 0.00 0.00 3.13
2713 2718 9.850628 TCTCCATGTATGTACTATAATTTACGC 57.149 33.333 0.00 0.00 0.00 4.42
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 269 5.333111 GCTTGTCCCGCTTAAAATATAGACG 60.333 44.000 0.00 0.00 0.00 4.18
711 714 4.861102 ATGGACAAAGCAGAGGAAAAAG 57.139 40.909 0.00 0.00 0.00 2.27
823 827 9.809395 AGCCAGTACACTAATAGATCTGTATTA 57.191 33.333 5.18 1.65 0.00 0.98
939 943 1.676006 CCGTGCAAAAGGAAACTCAGT 59.324 47.619 0.00 0.00 42.68 3.41
958 962 9.899661 ATTAACCTAAAAATTAAAATGGGAGCC 57.100 29.630 0.00 0.00 0.00 4.70
1005 1009 1.590932 CTCCGCAATTAGCTGCATCT 58.409 50.000 1.02 0.00 42.77 2.90
1044 1048 3.767309 AAGTCTGGAGGGATCTGTAGT 57.233 47.619 0.00 0.00 0.00 2.73
1097 1101 0.248565 TGCTGCTGGACATGACTCTC 59.751 55.000 0.00 0.00 0.00 3.20
1500 1504 5.926663 TCTAGCTTGCTTGATGATTCAGAT 58.073 37.500 0.00 0.00 32.27 2.90
1599 1603 1.140852 CCCCAGAAATCGATAGTGGCA 59.859 52.381 12.93 0.00 37.40 4.92
1946 1950 5.759763 CAGTAGCCTGTGTTATCATATTGCA 59.240 40.000 0.00 0.00 33.80 4.08
2081 2085 2.592102 AGCTTCAGAAAAGCCATGGA 57.408 45.000 18.40 0.00 44.01 3.41
2117 2121 3.585862 ACTTTGATCGCTCGTAACACAT 58.414 40.909 0.00 0.00 0.00 3.21
2174 2178 1.168714 GGCTGCATCGGAGAAAAAGT 58.831 50.000 0.50 0.00 43.58 2.66
2326 2330 3.225104 CGGGTACTGCCTATGTAGGTAA 58.775 50.000 7.84 0.00 45.42 2.85
2409 2413 6.329496 CAACAACAAACCTTGTGACTAATGT 58.671 36.000 0.00 0.00 44.59 2.71
2713 2718 1.856539 AACTGCTGGTGATGAGGGGG 61.857 60.000 0.00 0.00 0.00 5.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.