Multiple sequence alignment - TraesCS7A01G440600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G440600 chr7A 100.000 2434 0 0 1 2434 634975600 634978033 0.000000e+00 4495
1 TraesCS7A01G440600 chr1A 97.384 2217 26 7 249 2434 572884274 572882059 0.000000e+00 3744
2 TraesCS7A01G440600 chr1A 97.581 248 6 0 1 248 572884560 572884313 2.240000e-115 425
3 TraesCS7A01G440600 chr1A 91.188 261 21 2 260 519 519472755 519472496 1.070000e-93 353
4 TraesCS7A01G440600 chr2B 92.449 2185 129 14 252 2426 632520592 632518434 0.000000e+00 3088
5 TraesCS7A01G440600 chr2B 79.628 1075 120 42 717 1713 381234073 381235126 0.000000e+00 680
6 TraesCS7A01G440600 chr2B 88.189 254 18 4 7 248 632520953 632520700 2.370000e-75 292
7 TraesCS7A01G440600 chr7D 96.172 627 23 1 1809 2434 70226532 70227158 0.000000e+00 1024
8 TraesCS7A01G440600 chr7D 95.906 635 16 7 249 876 70225855 70226486 0.000000e+00 1020
9 TraesCS7A01G440600 chr7D 87.460 311 34 5 2128 2434 590187409 590187100 1.070000e-93 353
10 TraesCS7A01G440600 chr7D 91.154 260 11 1 1 248 70225557 70225816 2.320000e-90 342
11 TraesCS7A01G440600 chr2D 79.541 1002 106 54 770 1713 313462850 313463810 7.390000e-175 623
12 TraesCS7A01G440600 chr2D 83.648 159 21 2 1888 2041 313464089 313464247 7.010000e-31 145
13 TraesCS7A01G440600 chr2A 82.087 642 72 24 1118 1733 423754826 423754202 2.160000e-140 508
14 TraesCS7A01G440600 chr2A 77.887 407 58 11 735 1124 423755239 423754848 8.760000e-55 224
15 TraesCS7A01G440600 chr2A 83.019 159 22 2 1888 2041 423753953 423753795 3.260000e-29 139
16 TraesCS7A01G440600 chr5A 88.856 341 36 1 252 592 544448391 544448053 3.740000e-113 418
17 TraesCS7A01G440600 chr5A 84.985 333 28 15 2048 2379 544446696 544446385 3.910000e-83 318
18 TraesCS7A01G440600 chr5B 88.439 346 39 1 248 592 679964338 679964683 1.350000e-112 416
19 TraesCS7A01G440600 chr4D 85.176 398 44 4 2041 2424 367800305 367799909 6.310000e-106 394
20 TraesCS7A01G440600 chr4D 78.472 288 44 7 2149 2431 400238350 400238624 3.220000e-39 172
21 TraesCS7A01G440600 chr3A 87.307 323 33 5 252 569 290419251 290418932 1.780000e-96 363
22 TraesCS7A01G440600 chr3A 84.940 332 27 12 2049 2379 290417596 290417287 5.050000e-82 315
23 TraesCS7A01G440600 chr4A 90.805 261 22 2 260 519 714208773 714208514 4.980000e-92 348
24 TraesCS7A01G440600 chr3D 89.963 269 24 3 252 519 55113178 55112912 6.440000e-91 344
25 TraesCS7A01G440600 chr3D 83.432 169 14 8 2277 2431 175253312 175253480 7.010000e-31 145
26 TraesCS7A01G440600 chr4B 87.692 195 23 1 2240 2434 663766826 663767019 2.440000e-55 226
27 TraesCS7A01G440600 chr4B 97.059 102 3 0 2319 2420 445247797 445247696 3.220000e-39 172
28 TraesCS7A01G440600 chr6B 87.363 182 19 3 2240 2417 45265709 45265890 3.170000e-49 206
29 TraesCS7A01G440600 chr7B 80.412 291 38 8 2149 2434 583165400 583165124 1.140000e-48 204


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G440600 chr7A 634975600 634978033 2433 False 4495.000000 4495 100.000000 1 2434 1 chr7A.!!$F1 2433
1 TraesCS7A01G440600 chr1A 572882059 572884560 2501 True 2084.500000 3744 97.482500 1 2434 2 chr1A.!!$R2 2433
2 TraesCS7A01G440600 chr2B 632518434 632520953 2519 True 1690.000000 3088 90.319000 7 2426 2 chr2B.!!$R1 2419
3 TraesCS7A01G440600 chr2B 381234073 381235126 1053 False 680.000000 680 79.628000 717 1713 1 chr2B.!!$F1 996
4 TraesCS7A01G440600 chr7D 70225557 70227158 1601 False 795.333333 1024 94.410667 1 2434 3 chr7D.!!$F1 2433
5 TraesCS7A01G440600 chr2D 313462850 313464247 1397 False 384.000000 623 81.594500 770 2041 2 chr2D.!!$F1 1271
6 TraesCS7A01G440600 chr2A 423753795 423755239 1444 True 290.333333 508 80.997667 735 2041 3 chr2A.!!$R1 1306
7 TraesCS7A01G440600 chr5A 544446385 544448391 2006 True 368.000000 418 86.920500 252 2379 2 chr5A.!!$R1 2127
8 TraesCS7A01G440600 chr3A 290417287 290419251 1964 True 339.000000 363 86.123500 252 2379 2 chr3A.!!$R1 2127

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
768 1588 1.302192 CCCCGCTTCGTTCCTTGAA 60.302 57.895 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1924 3126 2.295349 TCTTTCGACAGTCGCCTTTACT 59.705 45.455 18.62 0.0 40.21 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 215 6.712095 AGAAGATGTGTTCATTGCTGAAACTA 59.288 34.615 0.00 0.0 42.85 2.24
209 222 7.607607 TGTGTTCATTGCTGAAACTAGATACAT 59.392 33.333 0.00 0.0 42.85 2.29
768 1588 1.302192 CCCCGCTTCGTTCCTTGAA 60.302 57.895 0.00 0.0 0.00 2.69
850 1672 3.501828 CACTGCACCAGCTAAATTGTACA 59.498 43.478 0.00 0.0 42.74 2.90
1828 2922 2.093075 CACACTGGAGCTGGAGATCAAT 60.093 50.000 0.00 0.0 30.87 2.57
1924 3126 1.673920 GTGCTCGAGGAAACACCAAAA 59.326 47.619 15.58 0.0 42.04 2.44
1926 3128 1.947456 GCTCGAGGAAACACCAAAAGT 59.053 47.619 15.58 0.0 42.04 2.66
2272 3497 3.053395 AGTGACATGGTGCCCAGATATTT 60.053 43.478 0.00 0.0 36.75 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 215 3.118531 AGAAGGAAGCACCCATGTATCT 58.881 45.455 0.00 0.0 40.05 1.98
209 222 0.850100 TTGGAAGAAGGAAGCACCCA 59.150 50.000 0.00 0.0 40.05 4.51
768 1588 4.410555 AGTGGAAGAAAGAGAGTTGAAGGT 59.589 41.667 0.00 0.0 0.00 3.50
1167 2047 4.989279 AAATCGCTGCCATTACTCAAAT 57.011 36.364 0.00 0.0 0.00 2.32
1551 2592 6.241882 TCGTCATCCCATTAGACCAAAATA 57.758 37.500 0.00 0.0 0.00 1.40
1828 2922 5.198965 GTTATGAGGTACTACTCCAGGTGA 58.801 45.833 0.00 0.0 41.55 4.02
1924 3126 2.295349 TCTTTCGACAGTCGCCTTTACT 59.705 45.455 18.62 0.0 40.21 2.24
1926 3128 2.352421 CCTCTTTCGACAGTCGCCTTTA 60.352 50.000 18.62 0.0 40.21 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.