Multiple sequence alignment - TraesCS6B01G002500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G002500 chr6B 100.000 4349 0 0 1 4349 1962516 1966864 0.000000e+00 8032.0
1 TraesCS6B01G002500 chr6B 100.000 4097 0 0 4864 8960 1967379 1971475 0.000000e+00 7566.0
2 TraesCS6B01G002500 chr2D 93.597 531 28 6 1366 1892 35217543 35217015 0.000000e+00 787.0
3 TraesCS6B01G002500 chr2D 93.333 495 32 1 2408 2901 35211687 35211193 0.000000e+00 730.0
4 TraesCS6B01G002500 chr2D 87.143 70 7 2 8575 8643 1660659 1660727 2.680000e-10 78.7
5 TraesCS6B01G002500 chr2D 75.122 205 30 17 8457 8643 21068857 21069058 9.650000e-10 76.8
6 TraesCS6B01G002500 chr2D 85.507 69 10 0 8575 8643 21061556 21061624 1.250000e-08 73.1
7 TraesCS6B01G002500 chr3A 93.964 497 28 2 2408 2903 700383025 700382530 0.000000e+00 750.0
8 TraesCS6B01G002500 chr3A 93.952 496 27 3 2408 2901 730306783 730306289 0.000000e+00 747.0
9 TraesCS6B01G002500 chr3A 89.689 514 32 11 1918 2410 581554251 581554764 3.530000e-178 636.0
10 TraesCS6B01G002500 chr3A 89.940 497 39 6 1920 2410 47079426 47079917 1.640000e-176 630.0
11 TraesCS6B01G002500 chr3A 92.188 384 29 1 2408 2790 724161601 724161984 7.910000e-150 542.0
12 TraesCS6B01G002500 chr3A 86.968 376 48 1 2529 2903 686995157 686994782 1.080000e-113 422.0
13 TraesCS6B01G002500 chr3A 76.555 209 28 18 8456 8646 742891566 742891771 2.660000e-15 95.3
14 TraesCS6B01G002500 chr4D 94.118 493 26 3 1919 2410 442885943 442885453 0.000000e+00 747.0
15 TraesCS6B01G002500 chr4D 93.673 490 28 3 1919 2407 442875840 442876327 0.000000e+00 730.0
16 TraesCS6B01G002500 chr4D 93.333 45 3 0 8575 8619 73238390 73238346 5.810000e-07 67.6
17 TraesCS6B01G002500 chr7A 93.173 498 26 5 1921 2414 735115944 735115451 0.000000e+00 725.0
18 TraesCS6B01G002500 chr7A 75.490 204 33 15 8457 8646 10532666 10532866 5.760000e-12 84.2
19 TraesCS6B01G002500 chr7A 74.884 215 35 16 8446 8643 17395384 17395596 7.460000e-11 80.5
20 TraesCS6B01G002500 chr2B 89.127 561 49 10 1366 1921 46327637 46328190 0.000000e+00 688.0
21 TraesCS6B01G002500 chr2B 97.078 308 9 0 4041 4348 94218344 94218651 3.710000e-143 520.0
22 TraesCS6B01G002500 chr2A 92.585 472 32 3 1926 2394 95895197 95894726 0.000000e+00 675.0
23 TraesCS6B01G002500 chr2A 86.635 419 55 1 2492 2909 765667939 765667521 6.340000e-126 462.0
24 TraesCS6B01G002500 chr3B 88.434 562 55 9 1365 1921 801114921 801115477 0.000000e+00 669.0
25 TraesCS6B01G002500 chr3B 97.087 309 9 0 4041 4349 393298917 393298609 1.030000e-143 521.0
26 TraesCS6B01G002500 chr3B 80.143 559 89 10 487 1028 809483630 809483077 1.810000e-106 398.0
27 TraesCS6B01G002500 chr3B 89.634 164 10 4 1918 2081 49370870 49371026 1.530000e-47 202.0
28 TraesCS6B01G002500 chr7D 88.710 496 48 7 1918 2410 12432337 12431847 4.630000e-167 599.0
29 TraesCS6B01G002500 chr7D 76.959 217 28 18 8447 8645 515995234 515995022 4.430000e-18 104.0
30 TraesCS6B01G002500 chr3D 87.730 489 52 6 1920 2407 254927463 254927944 1.690000e-156 564.0
31 TraesCS6B01G002500 chr3D 75.943 212 31 18 8452 8646 459080025 459079817 3.450000e-14 91.6
32 TraesCS6B01G002500 chr3D 76.056 213 29 17 8448 8643 486913962 486913755 3.450000e-14 91.6
33 TraesCS6B01G002500 chr5D 87.143 490 59 4 1920 2407 439419057 439419544 3.660000e-153 553.0
34 TraesCS6B01G002500 chr5D 75.576 217 32 17 8444 8643 330892288 330892500 4.460000e-13 87.9
35 TraesCS6B01G002500 chr1B 98.382 309 5 0 4041 4349 522434732 522434424 2.200000e-150 544.0
36 TraesCS6B01G002500 chr1B 97.735 309 7 0 4041 4349 371358526 371358834 4.760000e-147 532.0
37 TraesCS6B01G002500 chr1B 82.112 464 66 15 2447 2902 8849327 8849781 1.830000e-101 381.0
38 TraesCS6B01G002500 chr1B 80.378 423 65 16 1362 1774 8844315 8844729 1.130000e-78 305.0
39 TraesCS6B01G002500 chr1B 75.355 211 34 15 8452 8646 45165012 45164804 1.600000e-12 86.1
40 TraesCS6B01G002500 chr1B 75.576 217 29 19 8445 8643 671967466 671967676 1.600000e-12 86.1
41 TraesCS6B01G002500 chr7B 97.411 309 7 1 4041 4349 632816194 632815887 7.970000e-145 525.0
42 TraesCS6B01G002500 chr7B 96.764 309 10 0 4041 4349 714750954 714751262 4.800000e-142 516.0
43 TraesCS6B01G002500 chr7B 87.433 374 46 1 2529 2901 707275398 707275771 6.430000e-116 429.0
44 TraesCS6B01G002500 chr7B 82.581 465 62 16 2447 2901 712624919 712624464 8.430000e-105 392.0
45 TraesCS6B01G002500 chr5B 96.764 309 9 1 4041 4349 385665705 385666012 1.730000e-141 514.0
46 TraesCS6B01G002500 chr5B 96.370 303 11 0 4047 4349 291761532 291761834 4.830000e-137 499.0
47 TraesCS6B01G002500 chrUn 96.117 309 12 0 4041 4349 53749066 53749374 1.040000e-138 505.0
48 TraesCS6B01G002500 chrUn 76.599 688 130 22 292 962 51389039 51389712 5.150000e-92 350.0
49 TraesCS6B01G002500 chrUn 81.190 420 60 16 1365 1774 225680005 225680415 4.040000e-83 320.0
50 TraesCS6B01G002500 chrUn 80.383 418 66 14 1365 1774 287108723 287109132 4.060000e-78 303.0
51 TraesCS6B01G002500 chrUn 80.193 414 74 8 1365 1774 301338768 301339177 4.060000e-78 303.0
52 TraesCS6B01G002500 chrUn 80.383 418 66 14 1365 1774 347578814 347579223 4.060000e-78 303.0
53 TraesCS6B01G002500 chrUn 80.144 418 67 14 1365 1774 269607281 269607690 1.890000e-76 298.0
54 TraesCS6B01G002500 chr4A 79.786 747 109 23 295 1014 744382839 744382108 1.040000e-138 505.0
55 TraesCS6B01G002500 chr4A 77.041 784 135 26 267 1028 744414647 744415407 8.370000e-110 409.0
56 TraesCS6B01G002500 chr4A 77.855 578 103 16 356 921 743671071 743671635 1.440000e-87 335.0
57 TraesCS6B01G002500 chr4B 76.585 205 32 11 8457 8646 636168103 636167900 2.060000e-16 99.0
58 TraesCS6B01G002500 chr6D 76.056 213 30 17 8448 8643 135554919 135555127 3.450000e-14 91.6
59 TraesCS6B01G002500 chr5A 75.000 208 35 13 8452 8643 547167856 547167650 7.460000e-11 80.5
60 TraesCS6B01G002500 chr5A 86.441 59 8 0 8575 8633 3303267 3303209 2.090000e-06 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G002500 chr6B 1962516 1971475 8959 False 7799 8032 100.000 1 8960 2 chr6B.!!$F1 8959
1 TraesCS6B01G002500 chr2D 35217015 35217543 528 True 787 787 93.597 1366 1892 1 chr2D.!!$R2 526
2 TraesCS6B01G002500 chr3A 581554251 581554764 513 False 636 636 89.689 1918 2410 1 chr3A.!!$F2 492
3 TraesCS6B01G002500 chr2B 46327637 46328190 553 False 688 688 89.127 1366 1921 1 chr2B.!!$F1 555
4 TraesCS6B01G002500 chr3B 801114921 801115477 556 False 669 669 88.434 1365 1921 1 chr3B.!!$F2 556
5 TraesCS6B01G002500 chr3B 809483077 809483630 553 True 398 398 80.143 487 1028 1 chr3B.!!$R2 541
6 TraesCS6B01G002500 chrUn 51389039 51389712 673 False 350 350 76.599 292 962 1 chrUn.!!$F1 670
7 TraesCS6B01G002500 chr4A 744382108 744382839 731 True 505 505 79.786 295 1014 1 chr4A.!!$R1 719
8 TraesCS6B01G002500 chr4A 744414647 744415407 760 False 409 409 77.041 267 1028 1 chr4A.!!$F2 761
9 TraesCS6B01G002500 chr4A 743671071 743671635 564 False 335 335 77.855 356 921 1 chr4A.!!$F1 565


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
168 169 0.038166 TTGCTTCGCTTCCCTTCCAT 59.962 50.0 0.00 0.0 0.00 3.41 F
175 176 0.106469 GCTTCCCTTCCATCCCCTTC 60.106 60.0 0.00 0.0 0.00 3.46 F
1265 1302 0.030638 CCACACAAGCAAACGGAAGG 59.969 55.0 0.00 0.0 0.00 3.46 F
2631 2693 0.035439 AACCGTGTGGCTCCATTAGG 60.035 55.0 0.00 0.0 39.70 2.69 F
2810 2872 0.033504 AGCCGTGTCATATAAGCCGG 59.966 55.0 0.00 0.0 38.45 6.13 F
3066 3128 0.033504 ATATAGCGGGCAACGGACAG 59.966 55.0 2.23 0.0 44.51 3.51 F
3081 3143 0.040958 GACAGCGCACAAAAGTCCAG 60.041 55.0 11.47 0.0 0.00 3.86 F
3119 3181 0.244994 AAGCGCCACAACAACAAACA 59.755 45.0 2.29 0.0 0.00 2.83 F
3120 3182 0.244994 AGCGCCACAACAACAAACAA 59.755 45.0 2.29 0.0 0.00 2.83 F
5024 5086 0.319900 CCACGTTGAGAGTGAGTGGG 60.320 60.0 5.12 0.0 46.15 4.61 F
5859 5921 0.036732 GATCAGGACACCTTGTGGCA 59.963 55.0 2.04 0.0 44.59 4.92 F
7663 7725 0.031314 CCTCATCGAGATGGTCCGTG 59.969 60.0 12.54 0.0 39.24 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1246 1283 0.030638 CCTTCCGTTTGCTTGTGTGG 59.969 55.000 0.0 0.0 0.00 4.17 R
2150 2211 0.040692 CACGGTTCGTCGACTCTCAA 60.041 55.000 14.7 0.0 38.32 3.02 R
2791 2853 0.033504 CCGGCTTATATGACACGGCT 59.966 55.000 0.0 0.0 34.54 5.52 R
3723 3785 0.248215 GGCGACGCCTGATTGATTTG 60.248 55.000 31.3 0.0 46.69 2.32 R
5005 5067 0.319900 CCCACTCACTCTCAACGTGG 60.320 60.000 0.0 0.0 43.58 4.94 R
5006 5068 0.673985 TCCCACTCACTCTCAACGTG 59.326 55.000 0.0 0.0 0.00 4.49 R
5008 5070 0.673985 TGTCCCACTCACTCTCAACG 59.326 55.000 0.0 0.0 0.00 4.10 R
5013 5075 3.110705 AGCATTATGTCCCACTCACTCT 58.889 45.455 0.0 0.0 0.00 3.24 R
5095 5157 3.393089 AGTGTTGTCGATGCTCTTTCT 57.607 42.857 0.0 0.0 0.00 2.52 R
6840 6902 0.032540 CAAAAGCACCCTGTCCAAGC 59.967 55.000 0.0 0.0 0.00 4.01 R
7795 7857 0.030908 CGATCCCTCACTCTTACGGC 59.969 60.000 0.0 0.0 0.00 5.68 R
8626 8688 0.036164 CGATCCACCACCACTTTGGA 59.964 55.000 0.0 0.0 40.96 3.53 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 4.855105 GGCCGTGCATGATGTAGA 57.145 55.556 7.72 0.00 0.00 2.59
18 19 3.312404 GGCCGTGCATGATGTAGAT 57.688 52.632 7.72 0.00 0.00 1.98
19 20 0.870393 GGCCGTGCATGATGTAGATG 59.130 55.000 7.72 0.00 0.00 2.90
20 21 1.586422 GCCGTGCATGATGTAGATGT 58.414 50.000 7.72 0.00 0.00 3.06
21 22 1.262417 GCCGTGCATGATGTAGATGTG 59.738 52.381 7.72 0.00 0.00 3.21
22 23 1.262417 CCGTGCATGATGTAGATGTGC 59.738 52.381 7.72 1.16 36.39 4.57
23 24 1.935199 CGTGCATGATGTAGATGTGCA 59.065 47.619 0.00 5.67 42.86 4.57
24 25 2.352342 CGTGCATGATGTAGATGTGCAA 59.648 45.455 0.00 0.00 46.04 4.08
25 26 3.688272 GTGCATGATGTAGATGTGCAAC 58.312 45.455 10.07 3.70 46.04 4.17
26 27 3.376234 GTGCATGATGTAGATGTGCAACT 59.624 43.478 10.07 0.00 46.04 3.16
27 28 4.571984 GTGCATGATGTAGATGTGCAACTA 59.428 41.667 10.07 0.00 46.04 2.24
28 29 5.065090 GTGCATGATGTAGATGTGCAACTAA 59.935 40.000 10.07 0.00 46.04 2.24
29 30 5.824097 TGCATGATGTAGATGTGCAACTAAT 59.176 36.000 0.00 0.00 42.22 1.73
30 31 6.991531 TGCATGATGTAGATGTGCAACTAATA 59.008 34.615 0.00 0.00 42.22 0.98
31 32 7.498570 TGCATGATGTAGATGTGCAACTAATAA 59.501 33.333 0.00 0.00 42.22 1.40
32 33 7.800380 GCATGATGTAGATGTGCAACTAATAAC 59.200 37.037 0.00 0.00 38.04 1.89
33 34 9.049523 CATGATGTAGATGTGCAACTAATAACT 57.950 33.333 0.00 0.00 38.04 2.24
38 39 9.582431 TGTAGATGTGCAACTAATAACTAACTC 57.418 33.333 0.00 0.00 38.04 3.01
39 40 9.804758 GTAGATGTGCAACTAATAACTAACTCT 57.195 33.333 0.00 0.00 38.04 3.24
65 66 8.833231 AAAAAGATAAGTTCGAATCAGAGTCA 57.167 30.769 0.00 0.00 0.00 3.41
66 67 9.442047 AAAAAGATAAGTTCGAATCAGAGTCAT 57.558 29.630 0.00 0.00 0.00 3.06
67 68 8.641499 AAAGATAAGTTCGAATCAGAGTCATC 57.359 34.615 0.00 0.00 0.00 2.92
68 69 6.434596 AGATAAGTTCGAATCAGAGTCATCG 58.565 40.000 0.00 0.00 36.67 3.84
69 70 2.803451 AGTTCGAATCAGAGTCATCGC 58.197 47.619 0.00 0.00 35.39 4.58
70 71 2.164422 AGTTCGAATCAGAGTCATCGCA 59.836 45.455 0.00 0.00 35.39 5.10
71 72 2.481903 TCGAATCAGAGTCATCGCAG 57.518 50.000 0.00 0.00 35.39 5.18
72 73 1.745653 TCGAATCAGAGTCATCGCAGT 59.254 47.619 0.00 0.00 35.39 4.40
73 74 2.115595 CGAATCAGAGTCATCGCAGTC 58.884 52.381 0.00 0.00 0.00 3.51
74 75 2.478539 CGAATCAGAGTCATCGCAGTCA 60.479 50.000 0.00 0.00 0.00 3.41
75 76 3.515630 GAATCAGAGTCATCGCAGTCAA 58.484 45.455 0.00 0.00 0.00 3.18
76 77 3.599730 ATCAGAGTCATCGCAGTCAAA 57.400 42.857 0.00 0.00 0.00 2.69
77 78 2.951726 TCAGAGTCATCGCAGTCAAAG 58.048 47.619 0.00 0.00 0.00 2.77
78 79 1.998315 CAGAGTCATCGCAGTCAAAGG 59.002 52.381 0.00 0.00 0.00 3.11
79 80 1.620819 AGAGTCATCGCAGTCAAAGGT 59.379 47.619 0.00 0.00 0.00 3.50
80 81 1.728971 GAGTCATCGCAGTCAAAGGTG 59.271 52.381 0.00 0.00 0.00 4.00
81 82 1.344438 AGTCATCGCAGTCAAAGGTGA 59.656 47.619 0.00 0.00 0.00 4.02
100 101 4.502645 GGTGACATACCGCAAATTTTATGC 59.497 41.667 7.29 0.00 40.26 3.14
101 102 5.098893 GTGACATACCGCAAATTTTATGCA 58.901 37.500 7.29 0.00 44.01 3.96
102 103 5.748152 GTGACATACCGCAAATTTTATGCAT 59.252 36.000 3.79 3.79 44.01 3.96
103 104 5.747675 TGACATACCGCAAATTTTATGCATG 59.252 36.000 10.16 0.00 44.01 4.06
104 105 4.507388 ACATACCGCAAATTTTATGCATGC 59.493 37.500 11.82 11.82 44.01 4.06
105 106 2.969990 ACCGCAAATTTTATGCATGCA 58.030 38.095 25.04 25.04 44.01 3.96
106 107 3.533547 ACCGCAAATTTTATGCATGCAT 58.466 36.364 33.92 33.92 44.01 3.96
107 108 3.310227 ACCGCAAATTTTATGCATGCATG 59.690 39.130 37.43 23.88 44.01 4.06
108 109 3.303461 CCGCAAATTTTATGCATGCATGG 60.303 43.478 37.43 24.23 44.01 3.66
109 110 3.623863 GCAAATTTTATGCATGCATGGC 58.376 40.909 37.43 24.33 43.29 4.40
110 111 3.549221 GCAAATTTTATGCATGCATGGCC 60.549 43.478 37.43 15.93 43.29 5.36
111 112 2.554370 ATTTTATGCATGCATGGCCC 57.446 45.000 37.43 11.97 37.82 5.80
112 113 1.201424 TTTTATGCATGCATGGCCCA 58.799 45.000 37.43 18.69 37.82 5.36
113 114 0.464870 TTTATGCATGCATGGCCCAC 59.535 50.000 37.43 11.23 37.82 4.61
114 115 1.736365 TTATGCATGCATGGCCCACG 61.736 55.000 37.43 0.91 37.82 4.94
115 116 2.621517 TATGCATGCATGGCCCACGA 62.622 55.000 37.43 16.51 37.82 4.35
116 117 3.221389 GCATGCATGGCCCACGAT 61.221 61.111 27.34 0.00 0.00 3.73
117 118 2.725641 CATGCATGGCCCACGATG 59.274 61.111 19.40 0.00 0.00 3.84
118 119 1.824760 CATGCATGGCCCACGATGA 60.825 57.895 19.40 0.00 0.00 2.92
119 120 1.152138 ATGCATGGCCCACGATGAT 59.848 52.632 0.00 0.00 0.00 2.45
120 121 1.176619 ATGCATGGCCCACGATGATG 61.177 55.000 0.00 0.00 0.00 3.07
121 122 3.036577 CATGGCCCACGATGATGC 58.963 61.111 0.00 0.00 0.00 3.91
122 123 2.592574 ATGGCCCACGATGATGCG 60.593 61.111 0.00 0.00 37.29 4.73
123 124 3.105686 ATGGCCCACGATGATGCGA 62.106 57.895 0.00 0.00 34.83 5.10
124 125 2.281070 GGCCCACGATGATGCGAT 60.281 61.111 0.00 0.00 34.83 4.58
125 126 2.610694 GGCCCACGATGATGCGATG 61.611 63.158 0.00 0.00 34.83 3.84
126 127 2.941333 CCCACGATGATGCGATGC 59.059 61.111 0.00 0.00 34.83 3.91
127 128 2.547798 CCACGATGATGCGATGCG 59.452 61.111 0.00 0.00 34.83 4.73
128 129 2.239812 CCACGATGATGCGATGCGT 61.240 57.895 0.00 0.00 35.33 5.24
129 130 0.939106 CCACGATGATGCGATGCGTA 60.939 55.000 0.00 0.00 33.45 4.42
130 131 1.063031 CACGATGATGCGATGCGTAT 58.937 50.000 0.00 0.00 34.49 3.06
131 132 1.063031 ACGATGATGCGATGCGTATG 58.937 50.000 0.00 0.00 31.55 2.39
132 133 0.367887 CGATGATGCGATGCGTATGG 59.632 55.000 0.00 0.00 31.55 2.74
133 134 1.432514 GATGATGCGATGCGTATGGT 58.567 50.000 0.00 0.00 31.55 3.55
134 135 2.606108 GATGATGCGATGCGTATGGTA 58.394 47.619 0.00 0.00 31.55 3.25
135 136 2.064573 TGATGCGATGCGTATGGTAG 57.935 50.000 0.00 0.00 31.55 3.18
136 137 0.716108 GATGCGATGCGTATGGTAGC 59.284 55.000 0.00 0.00 31.55 3.58
141 142 4.833811 TGCGTATGGTAGCAGCAG 57.166 55.556 0.00 0.00 38.59 4.24
142 143 1.521457 TGCGTATGGTAGCAGCAGC 60.521 57.895 0.00 6.08 38.59 5.25
153 154 2.360100 CAGCAGCTGCCTCTTGCT 60.360 61.111 34.39 12.11 43.38 3.91
154 155 1.972223 CAGCAGCTGCCTCTTGCTT 60.972 57.895 34.39 11.28 43.38 3.91
155 156 1.674980 AGCAGCTGCCTCTTGCTTC 60.675 57.895 34.39 3.66 43.38 3.86
156 157 3.036783 GCAGCTGCCTCTTGCTTCG 62.037 63.158 28.76 0.00 42.00 3.79
157 158 2.745492 AGCTGCCTCTTGCTTCGC 60.745 61.111 0.00 0.00 42.00 4.70
158 159 2.745492 GCTGCCTCTTGCTTCGCT 60.745 61.111 0.00 0.00 42.00 4.93
159 160 2.331132 GCTGCCTCTTGCTTCGCTT 61.331 57.895 0.00 0.00 42.00 4.68
160 161 1.792941 CTGCCTCTTGCTTCGCTTC 59.207 57.895 0.00 0.00 42.00 3.86
161 162 1.642952 CTGCCTCTTGCTTCGCTTCC 61.643 60.000 0.00 0.00 42.00 3.46
162 163 2.402572 GCCTCTTGCTTCGCTTCCC 61.403 63.158 0.00 0.00 36.87 3.97
163 164 1.298014 CCTCTTGCTTCGCTTCCCT 59.702 57.895 0.00 0.00 0.00 4.20
164 165 0.322008 CCTCTTGCTTCGCTTCCCTT 60.322 55.000 0.00 0.00 0.00 3.95
165 166 1.082690 CTCTTGCTTCGCTTCCCTTC 58.917 55.000 0.00 0.00 0.00 3.46
166 167 0.321653 TCTTGCTTCGCTTCCCTTCC 60.322 55.000 0.00 0.00 0.00 3.46
167 168 0.606401 CTTGCTTCGCTTCCCTTCCA 60.606 55.000 0.00 0.00 0.00 3.53
168 169 0.038166 TTGCTTCGCTTCCCTTCCAT 59.962 50.000 0.00 0.00 0.00 3.41
169 170 0.392998 TGCTTCGCTTCCCTTCCATC 60.393 55.000 0.00 0.00 0.00 3.51
170 171 1.098129 GCTTCGCTTCCCTTCCATCC 61.098 60.000 0.00 0.00 0.00 3.51
171 172 0.464554 CTTCGCTTCCCTTCCATCCC 60.465 60.000 0.00 0.00 0.00 3.85
172 173 1.921869 TTCGCTTCCCTTCCATCCCC 61.922 60.000 0.00 0.00 0.00 4.81
173 174 2.378634 CGCTTCCCTTCCATCCCCT 61.379 63.158 0.00 0.00 0.00 4.79
174 175 1.926426 CGCTTCCCTTCCATCCCCTT 61.926 60.000 0.00 0.00 0.00 3.95
175 176 0.106469 GCTTCCCTTCCATCCCCTTC 60.106 60.000 0.00 0.00 0.00 3.46
176 177 0.553333 CTTCCCTTCCATCCCCTTCC 59.447 60.000 0.00 0.00 0.00 3.46
177 178 0.924226 TTCCCTTCCATCCCCTTCCC 60.924 60.000 0.00 0.00 0.00 3.97
178 179 1.309102 CCCTTCCATCCCCTTCCCT 60.309 63.158 0.00 0.00 0.00 4.20
179 180 0.926220 CCCTTCCATCCCCTTCCCTT 60.926 60.000 0.00 0.00 0.00 3.95
180 181 0.553333 CCTTCCATCCCCTTCCCTTC 59.447 60.000 0.00 0.00 0.00 3.46
181 182 1.601248 CTTCCATCCCCTTCCCTTCT 58.399 55.000 0.00 0.00 0.00 2.85
182 183 1.925959 CTTCCATCCCCTTCCCTTCTT 59.074 52.381 0.00 0.00 0.00 2.52
183 184 2.982842 TCCATCCCCTTCCCTTCTTA 57.017 50.000 0.00 0.00 0.00 2.10
184 185 3.455085 TCCATCCCCTTCCCTTCTTAT 57.545 47.619 0.00 0.00 0.00 1.73
185 186 4.586675 TCCATCCCCTTCCCTTCTTATA 57.413 45.455 0.00 0.00 0.00 0.98
186 187 4.240323 TCCATCCCCTTCCCTTCTTATAC 58.760 47.826 0.00 0.00 0.00 1.47
187 188 3.008049 CCATCCCCTTCCCTTCTTATACG 59.992 52.174 0.00 0.00 0.00 3.06
188 189 2.044758 TCCCCTTCCCTTCTTATACGC 58.955 52.381 0.00 0.00 0.00 4.42
189 190 1.766496 CCCCTTCCCTTCTTATACGCA 59.234 52.381 0.00 0.00 0.00 5.24
190 191 2.372172 CCCCTTCCCTTCTTATACGCAT 59.628 50.000 0.00 0.00 0.00 4.73
191 192 3.403038 CCCTTCCCTTCTTATACGCATG 58.597 50.000 0.00 0.00 0.00 4.06
192 193 3.403038 CCTTCCCTTCTTATACGCATGG 58.597 50.000 0.00 0.00 0.00 3.66
193 194 3.071023 CCTTCCCTTCTTATACGCATGGA 59.929 47.826 0.00 0.00 0.00 3.41
194 195 4.310769 CTTCCCTTCTTATACGCATGGAG 58.689 47.826 0.00 0.00 0.00 3.86
195 196 3.572642 TCCCTTCTTATACGCATGGAGA 58.427 45.455 0.00 0.00 0.00 3.71
196 197 3.964688 TCCCTTCTTATACGCATGGAGAA 59.035 43.478 0.00 0.00 0.00 2.87
197 198 4.039245 TCCCTTCTTATACGCATGGAGAAG 59.961 45.833 12.95 12.95 41.71 2.85
198 199 4.202264 CCCTTCTTATACGCATGGAGAAGT 60.202 45.833 16.22 0.00 40.91 3.01
199 200 5.010719 CCCTTCTTATACGCATGGAGAAGTA 59.989 44.000 16.22 0.00 40.91 2.24
200 201 6.153067 CCTTCTTATACGCATGGAGAAGTAG 58.847 44.000 16.22 5.09 40.91 2.57
201 202 6.016192 CCTTCTTATACGCATGGAGAAGTAGA 60.016 42.308 16.22 0.00 40.91 2.59
202 203 6.561737 TCTTATACGCATGGAGAAGTAGAG 57.438 41.667 0.00 0.00 0.00 2.43
203 204 6.062749 TCTTATACGCATGGAGAAGTAGAGT 58.937 40.000 0.00 0.00 0.00 3.24
204 205 7.222161 TCTTATACGCATGGAGAAGTAGAGTA 58.778 38.462 0.00 0.00 0.00 2.59
205 206 7.883833 TCTTATACGCATGGAGAAGTAGAGTAT 59.116 37.037 0.00 0.00 0.00 2.12
206 207 4.576216 ACGCATGGAGAAGTAGAGTATG 57.424 45.455 0.00 0.00 0.00 2.39
207 208 3.954904 ACGCATGGAGAAGTAGAGTATGT 59.045 43.478 0.00 0.00 0.00 2.29
208 209 4.202060 ACGCATGGAGAAGTAGAGTATGTG 60.202 45.833 0.00 0.00 0.00 3.21
209 210 4.626042 GCATGGAGAAGTAGAGTATGTGG 58.374 47.826 0.00 0.00 0.00 4.17
210 211 4.100189 GCATGGAGAAGTAGAGTATGTGGT 59.900 45.833 0.00 0.00 0.00 4.16
211 212 5.302059 GCATGGAGAAGTAGAGTATGTGGTA 59.698 44.000 0.00 0.00 0.00 3.25
212 213 6.736243 GCATGGAGAAGTAGAGTATGTGGTAC 60.736 46.154 0.00 0.00 0.00 3.34
213 214 6.075949 TGGAGAAGTAGAGTATGTGGTACT 57.924 41.667 0.00 0.00 46.27 2.73
214 215 7.204243 TGGAGAAGTAGAGTATGTGGTACTA 57.796 40.000 0.00 0.00 43.66 1.82
215 216 7.281098 TGGAGAAGTAGAGTATGTGGTACTAG 58.719 42.308 0.00 0.00 43.66 2.57
216 217 6.711645 GGAGAAGTAGAGTATGTGGTACTAGG 59.288 46.154 0.00 0.00 43.66 3.02
217 218 6.603224 AGAAGTAGAGTATGTGGTACTAGGG 58.397 44.000 0.00 0.00 43.66 3.53
218 219 5.321934 AGTAGAGTATGTGGTACTAGGGG 57.678 47.826 0.00 0.00 43.66 4.79
219 220 4.730904 AGTAGAGTATGTGGTACTAGGGGT 59.269 45.833 0.00 0.00 43.66 4.95
220 221 4.181799 AGAGTATGTGGTACTAGGGGTC 57.818 50.000 0.00 0.00 43.66 4.46
221 222 3.117208 AGAGTATGTGGTACTAGGGGTCC 60.117 52.174 0.00 0.00 43.66 4.46
222 223 2.588720 AGTATGTGGTACTAGGGGTCCA 59.411 50.000 0.00 0.00 41.84 4.02
223 224 2.653543 ATGTGGTACTAGGGGTCCAA 57.346 50.000 0.00 0.00 30.88 3.53
224 225 1.648116 TGTGGTACTAGGGGTCCAAC 58.352 55.000 0.00 0.00 30.88 3.77
225 226 1.150560 TGTGGTACTAGGGGTCCAACT 59.849 52.381 0.00 0.00 30.88 3.16
226 227 2.263545 GTGGTACTAGGGGTCCAACTT 58.736 52.381 0.00 0.00 30.88 2.66
227 228 2.027469 GTGGTACTAGGGGTCCAACTTG 60.027 54.545 0.00 0.00 30.88 3.16
228 229 2.158127 TGGTACTAGGGGTCCAACTTGA 60.158 50.000 0.00 0.00 0.00 3.02
229 230 3.113043 GGTACTAGGGGTCCAACTTGAT 58.887 50.000 0.00 0.00 0.00 2.57
230 231 3.522343 GGTACTAGGGGTCCAACTTGATT 59.478 47.826 0.00 0.00 0.00 2.57
231 232 3.721087 ACTAGGGGTCCAACTTGATTG 57.279 47.619 0.00 0.00 38.12 2.67
232 233 2.290960 ACTAGGGGTCCAACTTGATTGC 60.291 50.000 0.00 0.00 36.93 3.56
233 234 0.779997 AGGGGTCCAACTTGATTGCT 59.220 50.000 0.00 0.00 36.93 3.91
234 235 1.147817 AGGGGTCCAACTTGATTGCTT 59.852 47.619 0.00 0.00 36.93 3.91
235 236 1.546029 GGGGTCCAACTTGATTGCTTC 59.454 52.381 0.00 0.00 36.93 3.86
236 237 2.519013 GGGTCCAACTTGATTGCTTCT 58.481 47.619 0.00 0.00 36.93 2.85
237 238 2.893489 GGGTCCAACTTGATTGCTTCTT 59.107 45.455 0.00 0.00 36.93 2.52
238 239 3.057245 GGGTCCAACTTGATTGCTTCTTC 60.057 47.826 0.00 0.00 36.93 2.87
239 240 3.057245 GGTCCAACTTGATTGCTTCTTCC 60.057 47.826 0.00 0.00 36.93 3.46
240 241 3.823304 GTCCAACTTGATTGCTTCTTCCT 59.177 43.478 0.00 0.00 36.93 3.36
241 242 5.003804 GTCCAACTTGATTGCTTCTTCCTA 58.996 41.667 0.00 0.00 36.93 2.94
242 243 5.123027 GTCCAACTTGATTGCTTCTTCCTAG 59.877 44.000 0.00 0.00 36.93 3.02
243 244 4.142513 CCAACTTGATTGCTTCTTCCTAGC 60.143 45.833 0.00 0.00 36.93 3.42
244 245 4.566426 ACTTGATTGCTTCTTCCTAGCT 57.434 40.909 0.00 0.00 39.38 3.32
245 246 4.512484 ACTTGATTGCTTCTTCCTAGCTC 58.488 43.478 0.00 0.00 39.38 4.09
246 247 3.550437 TGATTGCTTCTTCCTAGCTCC 57.450 47.619 0.00 0.00 39.38 4.70
247 248 3.110705 TGATTGCTTCTTCCTAGCTCCT 58.889 45.455 0.00 0.00 39.38 3.69
248 249 4.290093 TGATTGCTTCTTCCTAGCTCCTA 58.710 43.478 0.00 0.00 39.38 2.94
249 250 4.904251 TGATTGCTTCTTCCTAGCTCCTAT 59.096 41.667 0.00 0.00 39.38 2.57
250 251 4.946478 TTGCTTCTTCCTAGCTCCTATC 57.054 45.455 0.00 0.00 39.38 2.08
251 252 4.191804 TGCTTCTTCCTAGCTCCTATCT 57.808 45.455 0.00 0.00 39.38 1.98
252 253 4.551671 TGCTTCTTCCTAGCTCCTATCTT 58.448 43.478 0.00 0.00 39.38 2.40
253 254 4.586841 TGCTTCTTCCTAGCTCCTATCTTC 59.413 45.833 0.00 0.00 39.38 2.87
254 255 4.586841 GCTTCTTCCTAGCTCCTATCTTCA 59.413 45.833 0.00 0.00 35.74 3.02
255 256 5.278957 GCTTCTTCCTAGCTCCTATCTTCAG 60.279 48.000 0.00 0.00 35.74 3.02
256 257 4.148838 TCTTCCTAGCTCCTATCTTCAGC 58.851 47.826 0.00 0.00 0.00 4.26
257 258 3.893753 TCCTAGCTCCTATCTTCAGCT 57.106 47.619 0.00 0.00 45.59 4.24
258 259 4.191804 TCCTAGCTCCTATCTTCAGCTT 57.808 45.455 0.00 0.00 40.77 3.74
259 260 4.551671 TCCTAGCTCCTATCTTCAGCTTT 58.448 43.478 0.00 0.00 40.77 3.51
260 261 4.586841 TCCTAGCTCCTATCTTCAGCTTTC 59.413 45.833 0.00 0.00 40.77 2.62
261 262 4.343526 CCTAGCTCCTATCTTCAGCTTTCA 59.656 45.833 0.00 0.00 40.77 2.69
262 263 4.135747 AGCTCCTATCTTCAGCTTTCAC 57.864 45.455 0.00 0.00 40.77 3.18
263 264 2.863137 GCTCCTATCTTCAGCTTTCACG 59.137 50.000 0.00 0.00 0.00 4.35
264 265 3.429547 GCTCCTATCTTCAGCTTTCACGA 60.430 47.826 0.00 0.00 0.00 4.35
265 266 4.109050 CTCCTATCTTCAGCTTTCACGAC 58.891 47.826 0.00 0.00 0.00 4.34
275 276 3.545124 TTTCACGACCGCCATGCCT 62.545 57.895 0.00 0.00 0.00 4.75
293 294 2.336809 GGCGGCTACTCCTCGATG 59.663 66.667 0.00 0.00 0.00 3.84
301 302 2.033550 GCTACTCCTCGATGATTCACGT 59.966 50.000 7.98 0.00 0.00 4.49
308 309 4.082190 TCCTCGATGATTCACGTTCTTCTT 60.082 41.667 0.00 0.00 0.00 2.52
314 315 5.215252 TGATTCACGTTCTTCTTCTCCTT 57.785 39.130 0.00 0.00 0.00 3.36
321 322 4.021016 ACGTTCTTCTTCTCCTTGCACTAT 60.021 41.667 0.00 0.00 0.00 2.12
326 333 4.908601 TCTTCTCCTTGCACTATTTCCA 57.091 40.909 0.00 0.00 0.00 3.53
332 339 2.350522 CTTGCACTATTTCCACTCGCT 58.649 47.619 0.00 0.00 0.00 4.93
338 345 0.744414 TATTTCCACTCGCTGCAGCC 60.744 55.000 32.07 15.05 37.91 4.85
381 391 2.656069 GGCCAAGGCACCTACTCGA 61.656 63.158 13.87 0.00 44.11 4.04
396 406 0.807667 CTCGACAGGCAGCACATACC 60.808 60.000 0.00 0.00 0.00 2.73
409 419 2.346803 CACATACCAGACCAACCTTCG 58.653 52.381 0.00 0.00 0.00 3.79
412 422 2.825861 TACCAGACCAACCTTCGAAC 57.174 50.000 0.00 0.00 0.00 3.95
413 423 0.834612 ACCAGACCAACCTTCGAACA 59.165 50.000 0.00 0.00 0.00 3.18
461 474 3.343788 CTCCTCGCCGTCTCGCTTT 62.344 63.158 0.00 0.00 0.00 3.51
485 498 4.397832 GGCAACTTCGGGGCCGTA 62.398 66.667 0.00 0.00 38.04 4.02
518 531 2.125350 GCTCTGGTTCTCTGCCGG 60.125 66.667 0.00 0.00 0.00 6.13
544 557 2.159819 ATCAGCGTCACCGACTGCTT 62.160 55.000 9.61 0.00 39.12 3.91
567 580 4.367023 GCGTCACCACGGCCAGTA 62.367 66.667 2.24 0.00 46.80 2.74
578 591 4.208686 GCCAGTAGGGACGCGGAG 62.209 72.222 12.47 0.00 40.01 4.63
580 593 2.482333 CCAGTAGGGACGCGGAGAG 61.482 68.421 12.47 0.00 40.01 3.20
613 626 3.322466 CAGGGACGTGGGCCTCTT 61.322 66.667 4.53 0.00 0.00 2.85
621 634 0.736325 CGTGGGCCTCTTCTACAACG 60.736 60.000 4.53 0.00 0.00 4.10
626 639 1.544691 GGCCTCTTCTACAACGAGTGA 59.455 52.381 0.00 0.00 0.00 3.41
638 651 1.298413 CGAGTGATACGTCCGCCTG 60.298 63.158 0.00 0.00 0.00 4.85
690 711 3.072468 CCGGCGAGGTCCCTGTTA 61.072 66.667 9.30 0.00 34.51 2.41
709 730 0.108329 AGCGACGGTCCCAACATAAG 60.108 55.000 1.91 0.00 0.00 1.73
716 737 1.892474 GGTCCCAACATAAGCAGCAAA 59.108 47.619 0.00 0.00 0.00 3.68
719 740 3.255642 GTCCCAACATAAGCAGCAAAGAA 59.744 43.478 0.00 0.00 0.00 2.52
782 812 2.741092 GCGGTGGACAACTCCTCA 59.259 61.111 0.00 0.00 37.48 3.86
788 818 1.623811 GTGGACAACTCCTCAAGGCTA 59.376 52.381 0.00 0.00 37.48 3.93
789 819 1.902508 TGGACAACTCCTCAAGGCTAG 59.097 52.381 0.00 0.00 37.48 3.42
983 1020 3.000819 TGCACCCTACGGTCCCAG 61.001 66.667 0.00 0.00 42.04 4.45
984 1021 4.468689 GCACCCTACGGTCCCAGC 62.469 72.222 0.00 0.00 42.04 4.85
1028 1065 2.034066 ATGGTCCTGTTGCCCACG 59.966 61.111 0.00 0.00 0.00 4.94
1029 1066 2.525124 ATGGTCCTGTTGCCCACGA 61.525 57.895 0.00 0.00 0.00 4.35
1030 1067 2.668550 GGTCCTGTTGCCCACGAC 60.669 66.667 0.00 0.00 0.00 4.34
1031 1068 3.041940 GTCCTGTTGCCCACGACG 61.042 66.667 0.00 0.00 32.23 5.12
1032 1069 4.308458 TCCTGTTGCCCACGACGG 62.308 66.667 0.00 0.00 36.44 4.79
1048 1085 4.645921 GGCACCAACGGCTGCAAC 62.646 66.667 0.50 0.00 33.61 4.17
1049 1086 4.645921 GCACCAACGGCTGCAACC 62.646 66.667 0.50 0.00 32.73 3.77
1050 1087 3.215568 CACCAACGGCTGCAACCA 61.216 61.111 6.99 0.00 0.00 3.67
1051 1088 2.906897 ACCAACGGCTGCAACCAG 60.907 61.111 6.99 1.79 42.13 4.00
1052 1089 2.594303 CCAACGGCTGCAACCAGA 60.594 61.111 6.99 0.00 41.77 3.86
1053 1090 2.620112 CCAACGGCTGCAACCAGAG 61.620 63.158 6.99 0.00 41.77 3.35
1054 1091 2.281761 AACGGCTGCAACCAGAGG 60.282 61.111 6.99 0.00 41.77 3.69
1055 1092 3.120086 AACGGCTGCAACCAGAGGT 62.120 57.895 6.99 0.00 41.77 3.85
1056 1093 2.743928 CGGCTGCAACCAGAGGTC 60.744 66.667 6.99 0.00 41.77 3.85
1057 1094 2.431683 GGCTGCAACCAGAGGTCA 59.568 61.111 0.00 0.00 41.77 4.02
1058 1095 1.673665 GGCTGCAACCAGAGGTCAG 60.674 63.158 0.00 1.65 41.77 3.51
1059 1096 1.072159 GCTGCAACCAGAGGTCAGT 59.928 57.895 0.00 0.00 41.77 3.41
1060 1097 0.536006 GCTGCAACCAGAGGTCAGTT 60.536 55.000 0.00 0.00 41.77 3.16
1061 1098 1.972872 CTGCAACCAGAGGTCAGTTT 58.027 50.000 0.00 0.00 41.77 2.66
1062 1099 2.301346 CTGCAACCAGAGGTCAGTTTT 58.699 47.619 0.00 0.00 41.77 2.43
1063 1100 2.689983 CTGCAACCAGAGGTCAGTTTTT 59.310 45.455 0.00 0.00 41.77 1.94
1064 1101 2.426738 TGCAACCAGAGGTCAGTTTTTG 59.573 45.455 0.00 0.00 33.12 2.44
1065 1102 2.427095 GCAACCAGAGGTCAGTTTTTGT 59.573 45.455 0.00 0.00 33.12 2.83
1066 1103 3.119137 GCAACCAGAGGTCAGTTTTTGTT 60.119 43.478 0.00 0.00 33.12 2.83
1067 1104 4.620567 GCAACCAGAGGTCAGTTTTTGTTT 60.621 41.667 0.00 0.00 33.12 2.83
1068 1105 5.478407 CAACCAGAGGTCAGTTTTTGTTTT 58.522 37.500 0.00 0.00 33.12 2.43
1069 1106 5.738619 ACCAGAGGTCAGTTTTTGTTTTT 57.261 34.783 0.00 0.00 0.00 1.94
1070 1107 5.478407 ACCAGAGGTCAGTTTTTGTTTTTG 58.522 37.500 0.00 0.00 0.00 2.44
1071 1108 5.011635 ACCAGAGGTCAGTTTTTGTTTTTGT 59.988 36.000 0.00 0.00 0.00 2.83
1072 1109 5.931724 CCAGAGGTCAGTTTTTGTTTTTGTT 59.068 36.000 0.00 0.00 0.00 2.83
1073 1110 6.426633 CCAGAGGTCAGTTTTTGTTTTTGTTT 59.573 34.615 0.00 0.00 0.00 2.83
1074 1111 7.041440 CCAGAGGTCAGTTTTTGTTTTTGTTTT 60.041 33.333 0.00 0.00 0.00 2.43
1075 1112 8.341903 CAGAGGTCAGTTTTTGTTTTTGTTTTT 58.658 29.630 0.00 0.00 0.00 1.94
1076 1113 8.341903 AGAGGTCAGTTTTTGTTTTTGTTTTTG 58.658 29.630 0.00 0.00 0.00 2.44
1077 1114 7.990917 AGGTCAGTTTTTGTTTTTGTTTTTGT 58.009 26.923 0.00 0.00 0.00 2.83
1078 1115 8.462811 AGGTCAGTTTTTGTTTTTGTTTTTGTT 58.537 25.926 0.00 0.00 0.00 2.83
1079 1116 9.077674 GGTCAGTTTTTGTTTTTGTTTTTGTTT 57.922 25.926 0.00 0.00 0.00 2.83
1109 1146 4.733077 TTTGGGAAATAACCAGAGGTCA 57.267 40.909 0.00 0.00 39.57 4.02
1110 1147 4.301072 TTGGGAAATAACCAGAGGTCAG 57.699 45.455 0.00 0.00 39.57 3.51
1111 1148 3.256704 TGGGAAATAACCAGAGGTCAGT 58.743 45.455 0.00 0.00 33.12 3.41
1112 1149 3.655777 TGGGAAATAACCAGAGGTCAGTT 59.344 43.478 0.00 0.00 33.12 3.16
1113 1150 4.010349 GGGAAATAACCAGAGGTCAGTTG 58.990 47.826 0.00 0.00 33.12 3.16
1114 1151 3.440522 GGAAATAACCAGAGGTCAGTTGC 59.559 47.826 0.00 0.00 33.12 4.17
1115 1152 4.327680 GAAATAACCAGAGGTCAGTTGCT 58.672 43.478 0.00 0.00 33.12 3.91
1116 1153 4.373156 AATAACCAGAGGTCAGTTGCTT 57.627 40.909 0.00 0.00 33.12 3.91
1117 1154 5.499004 AATAACCAGAGGTCAGTTGCTTA 57.501 39.130 0.00 0.00 33.12 3.09
1118 1155 2.841442 ACCAGAGGTCAGTTGCTTAC 57.159 50.000 0.00 0.00 0.00 2.34
1119 1156 1.348036 ACCAGAGGTCAGTTGCTTACC 59.652 52.381 0.00 0.00 0.00 2.85
1120 1157 1.347707 CCAGAGGTCAGTTGCTTACCA 59.652 52.381 2.83 0.00 35.64 3.25
1121 1158 2.224523 CCAGAGGTCAGTTGCTTACCAA 60.225 50.000 2.83 0.00 35.64 3.67
1122 1159 8.858051 TAACCAGAGGTCAGTTGCTTACCAAC 62.858 46.154 2.83 0.00 44.12 3.77
1136 1173 9.116067 GTTGCTTACCAACCATTAGATTATACA 57.884 33.333 0.00 0.00 46.44 2.29
1137 1174 9.860650 TTGCTTACCAACCATTAGATTATACAT 57.139 29.630 0.00 0.00 0.00 2.29
1138 1175 9.860650 TGCTTACCAACCATTAGATTATACATT 57.139 29.630 0.00 0.00 0.00 2.71
1158 1195 6.993079 ACATTGTTTTGGAAAGTAGAATCCC 58.007 36.000 0.00 0.00 34.68 3.85
1159 1196 6.782494 ACATTGTTTTGGAAAGTAGAATCCCT 59.218 34.615 0.00 0.00 34.68 4.20
1160 1197 7.290014 ACATTGTTTTGGAAAGTAGAATCCCTT 59.710 33.333 0.00 0.00 34.68 3.95
1161 1198 6.894339 TGTTTTGGAAAGTAGAATCCCTTC 57.106 37.500 0.00 0.00 34.68 3.46
1162 1199 6.369629 TGTTTTGGAAAGTAGAATCCCTTCA 58.630 36.000 0.00 0.00 34.68 3.02
1163 1200 6.836527 TGTTTTGGAAAGTAGAATCCCTTCAA 59.163 34.615 0.00 0.00 34.68 2.69
1164 1201 6.894339 TTTGGAAAGTAGAATCCCTTCAAC 57.106 37.500 0.00 0.00 34.68 3.18
1165 1202 4.575885 TGGAAAGTAGAATCCCTTCAACG 58.424 43.478 0.00 0.00 34.68 4.10
1166 1203 4.285003 TGGAAAGTAGAATCCCTTCAACGA 59.715 41.667 0.00 0.00 34.68 3.85
1167 1204 5.221762 TGGAAAGTAGAATCCCTTCAACGAA 60.222 40.000 0.00 0.00 34.68 3.85
1168 1205 5.880887 GGAAAGTAGAATCCCTTCAACGAAT 59.119 40.000 0.00 0.00 33.56 3.34
1169 1206 6.374613 GGAAAGTAGAATCCCTTCAACGAATT 59.625 38.462 0.00 0.00 33.56 2.17
1170 1207 7.551617 GGAAAGTAGAATCCCTTCAACGAATTA 59.448 37.037 0.00 0.00 33.56 1.40
1171 1208 8.494016 AAAGTAGAATCCCTTCAACGAATTAG 57.506 34.615 0.00 0.00 33.56 1.73
1172 1209 7.419711 AGTAGAATCCCTTCAACGAATTAGA 57.580 36.000 0.00 0.00 33.56 2.10
1173 1210 8.024145 AGTAGAATCCCTTCAACGAATTAGAT 57.976 34.615 0.00 0.00 33.56 1.98
1174 1211 8.487028 AGTAGAATCCCTTCAACGAATTAGATT 58.513 33.333 0.00 0.00 33.56 2.40
1175 1212 9.760077 GTAGAATCCCTTCAACGAATTAGATTA 57.240 33.333 0.00 0.00 33.56 1.75
1247 1284 9.515226 TCTAATATTTTGTTATGGATAGGTGCC 57.485 33.333 0.00 0.00 0.00 5.01
1248 1285 9.295825 CTAATATTTTGTTATGGATAGGTGCCA 57.704 33.333 0.00 0.00 40.24 4.92
1249 1286 5.852282 ATTTTGTTATGGATAGGTGCCAC 57.148 39.130 0.00 0.00 38.44 5.01
1250 1287 4.308526 TTTGTTATGGATAGGTGCCACA 57.691 40.909 0.00 0.00 38.44 4.17
1251 1288 3.275617 TGTTATGGATAGGTGCCACAC 57.724 47.619 0.00 0.00 38.44 3.82
1252 1289 2.573915 TGTTATGGATAGGTGCCACACA 59.426 45.455 0.00 0.00 38.44 3.72
1253 1290 3.009584 TGTTATGGATAGGTGCCACACAA 59.990 43.478 0.00 0.00 38.44 3.33
1254 1291 2.425143 ATGGATAGGTGCCACACAAG 57.575 50.000 0.00 0.00 38.44 3.16
1255 1292 0.322456 TGGATAGGTGCCACACAAGC 60.322 55.000 0.00 0.00 35.86 4.01
1256 1293 0.322456 GGATAGGTGCCACACAAGCA 60.322 55.000 0.00 0.00 35.86 3.91
1257 1294 1.533625 GATAGGTGCCACACAAGCAA 58.466 50.000 0.00 0.00 43.02 3.91
1258 1295 1.885887 GATAGGTGCCACACAAGCAAA 59.114 47.619 0.00 0.00 43.02 3.68
1259 1296 1.028905 TAGGTGCCACACAAGCAAAC 58.971 50.000 0.00 0.00 43.02 2.93
1260 1297 1.588667 GGTGCCACACAAGCAAACG 60.589 57.895 0.00 0.00 43.02 3.60
1261 1298 1.588667 GTGCCACACAAGCAAACGG 60.589 57.895 0.00 0.00 43.02 4.44
1262 1299 1.750780 TGCCACACAAGCAAACGGA 60.751 52.632 0.00 0.00 37.28 4.69
1263 1300 1.315981 TGCCACACAAGCAAACGGAA 61.316 50.000 0.00 0.00 37.28 4.30
1264 1301 0.594796 GCCACACAAGCAAACGGAAG 60.595 55.000 0.00 0.00 0.00 3.46
1265 1302 0.030638 CCACACAAGCAAACGGAAGG 59.969 55.000 0.00 0.00 0.00 3.46
1266 1303 0.030638 CACACAAGCAAACGGAAGGG 59.969 55.000 0.00 0.00 0.00 3.95
1267 1304 0.395173 ACACAAGCAAACGGAAGGGT 60.395 50.000 0.00 0.00 0.00 4.34
1268 1305 1.134037 ACACAAGCAAACGGAAGGGTA 60.134 47.619 0.00 0.00 0.00 3.69
1269 1306 1.950909 CACAAGCAAACGGAAGGGTAA 59.049 47.619 0.00 0.00 0.00 2.85
1270 1307 2.359531 CACAAGCAAACGGAAGGGTAAA 59.640 45.455 0.00 0.00 0.00 2.01
1271 1308 3.025262 ACAAGCAAACGGAAGGGTAAAA 58.975 40.909 0.00 0.00 0.00 1.52
1272 1309 3.639561 ACAAGCAAACGGAAGGGTAAAAT 59.360 39.130 0.00 0.00 0.00 1.82
1273 1310 4.100344 ACAAGCAAACGGAAGGGTAAAATT 59.900 37.500 0.00 0.00 0.00 1.82
1274 1311 4.251543 AGCAAACGGAAGGGTAAAATTG 57.748 40.909 0.00 0.00 0.00 2.32
1275 1312 3.006430 AGCAAACGGAAGGGTAAAATTGG 59.994 43.478 0.00 0.00 0.00 3.16
1276 1313 3.243941 GCAAACGGAAGGGTAAAATTGGT 60.244 43.478 0.00 0.00 0.00 3.67
1277 1314 4.741235 GCAAACGGAAGGGTAAAATTGGTT 60.741 41.667 0.00 0.00 0.00 3.67
1278 1315 5.509332 GCAAACGGAAGGGTAAAATTGGTTA 60.509 40.000 0.00 0.00 0.00 2.85
1279 1316 5.710513 AACGGAAGGGTAAAATTGGTTAC 57.289 39.130 0.00 0.00 33.91 2.50
1280 1317 4.989277 ACGGAAGGGTAAAATTGGTTACT 58.011 39.130 1.20 0.00 34.88 2.24
1281 1318 6.125589 ACGGAAGGGTAAAATTGGTTACTA 57.874 37.500 1.20 0.00 34.88 1.82
1282 1319 6.724351 ACGGAAGGGTAAAATTGGTTACTAT 58.276 36.000 1.20 0.00 34.88 2.12
1283 1320 7.177184 ACGGAAGGGTAAAATTGGTTACTATT 58.823 34.615 1.20 0.00 34.88 1.73
1284 1321 8.328014 ACGGAAGGGTAAAATTGGTTACTATTA 58.672 33.333 1.20 0.00 34.88 0.98
1285 1322 8.833493 CGGAAGGGTAAAATTGGTTACTATTAG 58.167 37.037 1.20 0.00 34.88 1.73
1286 1323 9.690913 GGAAGGGTAAAATTGGTTACTATTAGT 57.309 33.333 1.30 1.30 34.88 2.24
1299 1336 9.075678 TGGTTACTATTAGTAGTCATTCTAGCC 57.924 37.037 0.51 0.00 41.35 3.93
1300 1337 9.299465 GGTTACTATTAGTAGTCATTCTAGCCT 57.701 37.037 0.51 0.00 41.35 4.58
1304 1341 8.569641 ACTATTAGTAGTCATTCTAGCCTTTCG 58.430 37.037 0.00 0.00 36.41 3.46
1305 1342 7.584122 ATTAGTAGTCATTCTAGCCTTTCGA 57.416 36.000 0.00 0.00 0.00 3.71
1306 1343 5.916661 AGTAGTCATTCTAGCCTTTCGAA 57.083 39.130 0.00 0.00 0.00 3.71
1307 1344 6.282199 AGTAGTCATTCTAGCCTTTCGAAA 57.718 37.500 10.71 10.71 0.00 3.46
1308 1345 6.879400 AGTAGTCATTCTAGCCTTTCGAAAT 58.121 36.000 11.70 0.00 0.00 2.17
1309 1346 8.008513 AGTAGTCATTCTAGCCTTTCGAAATA 57.991 34.615 11.70 0.16 0.00 1.40
1310 1347 8.138712 AGTAGTCATTCTAGCCTTTCGAAATAG 58.861 37.037 11.70 10.50 0.00 1.73
1311 1348 7.113658 AGTCATTCTAGCCTTTCGAAATAGA 57.886 36.000 11.70 12.65 0.00 1.98
1312 1349 7.556844 AGTCATTCTAGCCTTTCGAAATAGAA 58.443 34.615 24.15 24.15 37.01 2.10
1313 1350 8.041323 AGTCATTCTAGCCTTTCGAAATAGAAA 58.959 33.333 25.05 14.05 36.40 2.52
1338 1375 9.832445 AAGACAGTATTAACAAGAAAGAACTGA 57.168 29.630 6.18 0.00 37.22 3.41
1339 1376 9.832445 AGACAGTATTAACAAGAAAGAACTGAA 57.168 29.630 6.18 0.00 37.22 3.02
1340 1377 9.865484 GACAGTATTAACAAGAAAGAACTGAAC 57.135 33.333 6.18 0.00 37.22 3.18
1341 1378 9.614792 ACAGTATTAACAAGAAAGAACTGAACT 57.385 29.630 6.18 0.00 37.22 3.01
1444 1481 1.138266 GGCACTCGGCTTATGTTCCTA 59.862 52.381 0.00 0.00 44.01 2.94
1457 1494 3.028094 TGTTCCTATAAGCCGAGTCCT 57.972 47.619 0.00 0.00 0.00 3.85
1481 1518 2.287829 AAAAACACCCGGCAAACCA 58.712 47.368 0.00 0.00 34.57 3.67
1496 1533 3.063588 GCAAACCATAAGTACTCGGCTTC 59.936 47.826 0.00 0.00 0.00 3.86
1519 1556 4.730949 GGCCATATATAAGCCGAGTGTA 57.269 45.455 10.48 0.00 36.84 2.90
1523 1561 6.128363 GGCCATATATAAGCCGAGTGTAAAAC 60.128 42.308 10.48 0.00 36.84 2.43
1628 1667 2.664851 TGTCTGCAACGAAGCGGG 60.665 61.111 11.58 2.69 41.26 6.13
1669 1708 1.146263 GCCTATAAGCCGTGTGCCT 59.854 57.895 0.00 0.00 42.71 4.75
1770 1809 1.972198 CCCTGTTACAGCACTCGGA 59.028 57.895 6.88 0.00 0.00 4.55
1777 1816 5.276461 TGTTACAGCACTCGGATTATGAT 57.724 39.130 0.00 0.00 0.00 2.45
1842 1881 2.963548 TGCGACCCACGACATTTATA 57.036 45.000 0.00 0.00 45.77 0.98
1923 1965 8.044908 TCATAATTTTCTTCCGGCTAGTTTACT 58.955 33.333 0.00 0.00 0.00 2.24
1955 1997 5.446875 GCTTTCGCCCCGCTTTATATATAAC 60.447 44.000 4.61 0.00 0.00 1.89
1956 1998 3.772932 TCGCCCCGCTTTATATATAACG 58.227 45.455 4.61 4.78 0.00 3.18
1994 2036 3.407698 AGCCGATACAAATGACAACACA 58.592 40.909 0.00 0.00 0.00 3.72
2007 2049 0.179176 CAACACACCACACCAACACG 60.179 55.000 0.00 0.00 0.00 4.49
2035 2077 1.142870 GGCCAGATACATAGGTGCCAA 59.857 52.381 0.00 0.00 37.36 4.52
2036 2078 2.498167 GCCAGATACATAGGTGCCAAG 58.502 52.381 0.00 0.00 0.00 3.61
2038 2080 3.805108 GCCAGATACATAGGTGCCAAGAG 60.805 52.174 0.00 0.00 0.00 2.85
2041 2100 1.879575 TACATAGGTGCCAAGAGCCT 58.120 50.000 0.00 0.00 42.71 4.58
2059 2120 2.793237 GCCTACAACAACAAACACACCG 60.793 50.000 0.00 0.00 0.00 4.94
2060 2121 2.678836 CCTACAACAACAAACACACCGA 59.321 45.455 0.00 0.00 0.00 4.69
2084 2145 5.687828 ACGACTCGAAGTAGACTAAACAAG 58.312 41.667 5.20 0.00 0.00 3.16
2089 2150 6.010294 TCGAAGTAGACTAAACAAGGACTG 57.990 41.667 0.00 0.00 0.00 3.51
2102 2163 4.377897 ACAAGGACTGTAAGCAACACTAC 58.622 43.478 0.00 0.00 37.60 2.73
2111 2172 2.813908 CAACACTACGGAGCCGCC 60.814 66.667 9.14 0.00 44.19 6.13
2127 2188 3.072468 CCGGAGCCCTTCACGGTA 61.072 66.667 0.00 0.00 41.34 4.02
2129 2190 1.153628 CGGAGCCCTTCACGGTAAG 60.154 63.158 0.00 0.00 0.00 2.34
2167 2228 0.237761 AGTTGAGAGTCGACGAACCG 59.762 55.000 10.46 0.00 35.92 4.44
2236 2297 1.146263 ACCGCCCGATCCAAAGATC 59.854 57.895 0.00 0.00 44.76 2.75
2244 2305 4.693095 GCCCGATCCAAAGATCTAGATTTC 59.307 45.833 6.70 0.00 45.83 2.17
2245 2306 5.743130 GCCCGATCCAAAGATCTAGATTTCA 60.743 44.000 6.70 0.00 45.83 2.69
2246 2307 6.471146 CCCGATCCAAAGATCTAGATTTCAT 58.529 40.000 6.70 0.00 45.83 2.57
2247 2308 6.593382 CCCGATCCAAAGATCTAGATTTCATC 59.407 42.308 6.70 2.81 45.83 2.92
2255 2317 3.735237 TCTAGATTTCATCCGGAGCAC 57.265 47.619 11.34 0.00 0.00 4.40
2290 2352 0.586802 GCAACCACAACGGAGACTTC 59.413 55.000 0.00 0.00 38.63 3.01
2293 2355 0.393077 ACCACAACGGAGACTTCAGG 59.607 55.000 0.00 0.00 38.63 3.86
2313 2375 1.239296 AAGATGACGACGACCACGGA 61.239 55.000 0.00 0.00 44.46 4.69
2358 2420 1.304052 CCAGGCGGGATTTTCACCA 60.304 57.895 0.00 0.00 40.01 4.17
2380 2442 1.475034 GGCAATCATACTCCGCCTTCA 60.475 52.381 0.00 0.00 39.73 3.02
2383 2445 0.759346 ATCATACTCCGCCTTCACCC 59.241 55.000 0.00 0.00 0.00 4.61
2407 2469 4.335647 CCGCCAGGCACAAGACCT 62.336 66.667 13.30 0.00 38.35 3.85
2408 2470 2.662596 CGCCAGGCACAAGACCTA 59.337 61.111 13.30 0.00 35.10 3.08
2410 2472 1.298859 CGCCAGGCACAAGACCTAAC 61.299 60.000 13.30 0.00 35.10 2.34
2411 2473 0.250727 GCCAGGCACAAGACCTAACA 60.251 55.000 6.55 0.00 35.10 2.41
2412 2474 1.813513 CCAGGCACAAGACCTAACAG 58.186 55.000 0.00 0.00 35.10 3.16
2413 2475 1.160137 CAGGCACAAGACCTAACAGC 58.840 55.000 0.00 0.00 35.10 4.40
2414 2476 0.320771 AGGCACAAGACCTAACAGCG 60.321 55.000 0.00 0.00 35.10 5.18
2415 2477 1.298859 GGCACAAGACCTAACAGCGG 61.299 60.000 0.00 0.00 0.00 5.52
2416 2478 1.912371 GCACAAGACCTAACAGCGGC 61.912 60.000 0.00 0.00 0.00 6.53
2417 2479 0.320771 CACAAGACCTAACAGCGGCT 60.321 55.000 0.00 0.00 0.00 5.52
2418 2480 0.320771 ACAAGACCTAACAGCGGCTG 60.321 55.000 27.43 27.43 37.52 4.85
2419 2481 1.021390 CAAGACCTAACAGCGGCTGG 61.021 60.000 31.38 17.62 35.51 4.85
2420 2482 1.192146 AAGACCTAACAGCGGCTGGA 61.192 55.000 31.38 18.77 35.51 3.86
2421 2483 1.448013 GACCTAACAGCGGCTGGAC 60.448 63.158 31.38 12.22 35.51 4.02
2422 2484 1.889530 GACCTAACAGCGGCTGGACT 61.890 60.000 31.38 18.42 35.51 3.85
2423 2485 0.613853 ACCTAACAGCGGCTGGACTA 60.614 55.000 31.38 18.54 35.51 2.59
2424 2486 0.753262 CCTAACAGCGGCTGGACTAT 59.247 55.000 31.38 15.26 35.51 2.12
2425 2487 1.961394 CCTAACAGCGGCTGGACTATA 59.039 52.381 31.38 15.53 35.51 1.31
2426 2488 2.364324 CCTAACAGCGGCTGGACTATAA 59.636 50.000 31.38 9.36 35.51 0.98
2427 2489 3.006967 CCTAACAGCGGCTGGACTATAAT 59.993 47.826 31.38 7.28 35.51 1.28
2428 2490 2.821991 ACAGCGGCTGGACTATAATC 57.178 50.000 31.38 0.00 35.51 1.75
2429 2491 1.344763 ACAGCGGCTGGACTATAATCC 59.655 52.381 31.38 0.00 39.45 3.01
2430 2492 0.603569 AGCGGCTGGACTATAATCCG 59.396 55.000 0.00 0.00 42.24 4.18
2431 2493 0.601558 GCGGCTGGACTATAATCCGA 59.398 55.000 2.41 0.00 42.24 4.55
2432 2494 1.402984 GCGGCTGGACTATAATCCGAG 60.403 57.143 2.41 0.00 42.24 4.63
2433 2495 1.887198 CGGCTGGACTATAATCCGAGT 59.113 52.381 0.00 0.00 42.24 4.18
2434 2496 3.079578 CGGCTGGACTATAATCCGAGTA 58.920 50.000 0.00 0.00 42.24 2.59
2435 2497 3.695060 CGGCTGGACTATAATCCGAGTAT 59.305 47.826 0.00 0.00 42.24 2.12
2436 2498 4.880120 CGGCTGGACTATAATCCGAGTATA 59.120 45.833 0.00 0.00 42.24 1.47
2437 2499 5.007823 CGGCTGGACTATAATCCGAGTATAG 59.992 48.000 17.45 17.45 42.24 1.31
2438 2500 5.221087 GGCTGGACTATAATCCGAGTATAGC 60.221 48.000 18.52 12.75 42.24 2.97
2439 2501 5.357314 GCTGGACTATAATCCGAGTATAGCA 59.643 44.000 18.52 10.94 42.24 3.49
2440 2502 6.459024 GCTGGACTATAATCCGAGTATAGCAG 60.459 46.154 18.52 17.92 42.24 4.24
2441 2503 5.886474 TGGACTATAATCCGAGTATAGCAGG 59.114 44.000 18.52 1.89 42.24 4.85
2442 2504 6.120905 GGACTATAATCCGAGTATAGCAGGA 58.879 44.000 18.52 0.00 35.71 3.86
2443 2505 6.261381 GGACTATAATCCGAGTATAGCAGGAG 59.739 46.154 18.52 2.27 35.71 3.69
2444 2506 6.723339 ACTATAATCCGAGTATAGCAGGAGT 58.277 40.000 18.52 2.81 35.71 3.85
2445 2507 7.176490 ACTATAATCCGAGTATAGCAGGAGTT 58.824 38.462 18.52 0.24 35.71 3.01
2446 2508 4.592485 AATCCGAGTATAGCAGGAGTTG 57.408 45.455 0.00 0.00 36.08 3.16
2447 2509 2.307768 TCCGAGTATAGCAGGAGTTGG 58.692 52.381 0.00 0.00 0.00 3.77
2448 2510 1.269831 CCGAGTATAGCAGGAGTTGGC 60.270 57.143 0.00 0.00 0.00 4.52
2449 2511 1.409064 CGAGTATAGCAGGAGTTGGCA 59.591 52.381 0.00 0.00 0.00 4.92
2450 2512 2.799917 CGAGTATAGCAGGAGTTGGCAC 60.800 54.545 0.00 0.00 0.00 5.01
2451 2513 2.432510 GAGTATAGCAGGAGTTGGCACT 59.567 50.000 0.00 0.00 35.17 4.40
2460 2522 1.873698 GAGTTGGCACTCGGTTTACA 58.126 50.000 0.00 0.00 40.30 2.41
2461 2523 2.423577 GAGTTGGCACTCGGTTTACAT 58.576 47.619 0.00 0.00 40.30 2.29
2462 2524 3.592059 GAGTTGGCACTCGGTTTACATA 58.408 45.455 0.00 0.00 40.30 2.29
2463 2525 3.998341 GAGTTGGCACTCGGTTTACATAA 59.002 43.478 0.00 0.00 40.30 1.90
2464 2526 4.391155 AGTTGGCACTCGGTTTACATAAA 58.609 39.130 0.00 0.00 0.00 1.40
2465 2527 4.822896 AGTTGGCACTCGGTTTACATAAAA 59.177 37.500 0.00 0.00 0.00 1.52
2466 2528 5.299782 AGTTGGCACTCGGTTTACATAAAAA 59.700 36.000 0.00 0.00 0.00 1.94
2467 2529 5.110940 TGGCACTCGGTTTACATAAAAAC 57.889 39.130 0.00 0.00 38.39 2.43
2474 2536 3.236005 GGTTTACATAAAAACCGTGCGG 58.764 45.455 9.29 9.29 46.51 5.69
2475 2537 2.615489 TTACATAAAAACCGTGCGGC 57.385 45.000 10.87 0.00 39.32 6.53
2476 2538 1.810959 TACATAAAAACCGTGCGGCT 58.189 45.000 10.87 0.00 39.32 5.52
2477 2539 0.519961 ACATAAAAACCGTGCGGCTC 59.480 50.000 10.87 0.00 39.32 4.70
2478 2540 0.519519 CATAAAAACCGTGCGGCTCA 59.480 50.000 10.87 0.00 39.32 4.26
2479 2541 1.132262 CATAAAAACCGTGCGGCTCAT 59.868 47.619 10.87 0.00 39.32 2.90
2480 2542 1.240256 TAAAAACCGTGCGGCTCATT 58.760 45.000 10.87 4.01 39.32 2.57
2481 2543 0.387565 AAAAACCGTGCGGCTCATTT 59.612 45.000 10.87 4.77 39.32 2.32
2482 2544 0.387565 AAAACCGTGCGGCTCATTTT 59.612 45.000 10.87 7.13 39.32 1.82
2483 2545 0.318614 AAACCGTGCGGCTCATTTTG 60.319 50.000 10.87 0.00 39.32 2.44
2484 2546 2.141122 AACCGTGCGGCTCATTTTGG 62.141 55.000 10.87 0.00 39.32 3.28
2485 2547 2.504681 CGTGCGGCTCATTTTGGC 60.505 61.111 0.00 0.00 0.00 4.52
2486 2548 2.650196 GTGCGGCTCATTTTGGCA 59.350 55.556 0.00 0.00 0.00 4.92
2487 2549 1.734117 GTGCGGCTCATTTTGGCAC 60.734 57.895 0.00 0.00 45.82 5.01
2488 2550 1.902918 TGCGGCTCATTTTGGCACT 60.903 52.632 0.00 0.00 0.00 4.40
2489 2551 1.153958 GCGGCTCATTTTGGCACTC 60.154 57.895 0.00 0.00 0.00 3.51
2490 2552 1.135315 CGGCTCATTTTGGCACTCG 59.865 57.895 0.00 0.00 0.00 4.18
2491 2553 1.508088 GGCTCATTTTGGCACTCGG 59.492 57.895 0.00 0.00 0.00 4.63
2492 2554 1.244019 GGCTCATTTTGGCACTCGGT 61.244 55.000 0.00 0.00 0.00 4.69
2493 2555 0.598065 GCTCATTTTGGCACTCGGTT 59.402 50.000 0.00 0.00 0.00 4.44
2494 2556 1.000274 GCTCATTTTGGCACTCGGTTT 60.000 47.619 0.00 0.00 0.00 3.27
2495 2557 2.227865 GCTCATTTTGGCACTCGGTTTA 59.772 45.455 0.00 0.00 0.00 2.01
2496 2558 3.119495 GCTCATTTTGGCACTCGGTTTAT 60.119 43.478 0.00 0.00 0.00 1.40
2497 2559 4.095782 GCTCATTTTGGCACTCGGTTTATA 59.904 41.667 0.00 0.00 0.00 0.98
2498 2560 5.221048 GCTCATTTTGGCACTCGGTTTATAT 60.221 40.000 0.00 0.00 0.00 0.86
2499 2561 6.017440 GCTCATTTTGGCACTCGGTTTATATA 60.017 38.462 0.00 0.00 0.00 0.86
2500 2562 7.468084 GCTCATTTTGGCACTCGGTTTATATAA 60.468 37.037 0.00 0.00 0.00 0.98
2501 2563 8.282455 TCATTTTGGCACTCGGTTTATATAAA 57.718 30.769 3.71 3.71 0.00 1.40
2502 2564 8.740906 TCATTTTGGCACTCGGTTTATATAAAA 58.259 29.630 9.48 0.00 0.00 1.52
2503 2565 9.360093 CATTTTGGCACTCGGTTTATATAAAAA 57.640 29.630 9.48 0.00 0.00 1.94
2504 2566 8.745464 TTTTGGCACTCGGTTTATATAAAAAC 57.255 30.769 9.48 5.49 38.39 2.43
2513 2575 5.265477 GGTTTATATAAAAACCGTGTCGCC 58.735 41.667 9.48 0.00 46.51 5.54
2514 2576 5.065090 GGTTTATATAAAAACCGTGTCGCCT 59.935 40.000 9.48 0.00 46.51 5.52
2515 2577 6.257630 GGTTTATATAAAAACCGTGTCGCCTA 59.742 38.462 9.48 0.00 46.51 3.93
2516 2578 7.201600 GGTTTATATAAAAACCGTGTCGCCTAA 60.202 37.037 9.48 0.00 46.51 2.69
2517 2579 5.978934 ATATAAAAACCGTGTCGCCTAAG 57.021 39.130 0.00 0.00 0.00 2.18
2518 2580 0.589708 AAAAACCGTGTCGCCTAAGC 59.410 50.000 0.00 0.00 0.00 3.09
2519 2581 0.533308 AAAACCGTGTCGCCTAAGCA 60.533 50.000 0.00 0.00 39.83 3.91
2520 2582 0.949105 AAACCGTGTCGCCTAAGCAG 60.949 55.000 0.00 0.00 39.83 4.24
2521 2583 2.509336 CCGTGTCGCCTAAGCAGG 60.509 66.667 0.00 0.00 45.77 4.85
2529 2591 2.982130 CCTAAGCAGGCACTCGGT 59.018 61.111 0.00 0.00 34.60 4.69
2530 2592 1.296715 CCTAAGCAGGCACTCGGTT 59.703 57.895 0.00 0.00 34.60 4.44
2531 2593 0.321653 CCTAAGCAGGCACTCGGTTT 60.322 55.000 0.00 0.00 34.60 3.27
2532 2594 1.066430 CCTAAGCAGGCACTCGGTTTA 60.066 52.381 0.00 0.00 34.60 2.01
2533 2595 2.420129 CCTAAGCAGGCACTCGGTTTAT 60.420 50.000 0.00 0.00 34.60 1.40
2534 2596 3.181469 CCTAAGCAGGCACTCGGTTTATA 60.181 47.826 0.00 0.00 34.60 0.98
2535 2597 3.560636 AAGCAGGCACTCGGTTTATAT 57.439 42.857 0.00 0.00 34.60 0.86
2536 2598 3.560636 AGCAGGCACTCGGTTTATATT 57.439 42.857 0.00 0.00 34.60 1.28
2537 2599 4.682778 AGCAGGCACTCGGTTTATATTA 57.317 40.909 0.00 0.00 34.60 0.98
2538 2600 5.031066 AGCAGGCACTCGGTTTATATTAA 57.969 39.130 0.00 0.00 34.60 1.40
2539 2601 5.057149 AGCAGGCACTCGGTTTATATTAAG 58.943 41.667 0.00 0.00 34.60 1.85
2540 2602 4.319549 GCAGGCACTCGGTTTATATTAAGC 60.320 45.833 0.00 0.00 34.60 3.09
2541 2603 5.057149 CAGGCACTCGGTTTATATTAAGCT 58.943 41.667 2.58 0.00 34.60 3.74
2542 2604 5.050091 CAGGCACTCGGTTTATATTAAGCTG 60.050 44.000 2.58 0.00 34.60 4.24
2543 2605 4.814771 GGCACTCGGTTTATATTAAGCTGT 59.185 41.667 2.58 0.00 0.00 4.40
2544 2606 5.277345 GGCACTCGGTTTATATTAAGCTGTG 60.277 44.000 15.62 15.62 34.22 3.66
2545 2607 5.738370 CACTCGGTTTATATTAAGCTGTGC 58.262 41.667 11.00 0.00 0.00 4.57
2546 2608 5.523916 CACTCGGTTTATATTAAGCTGTGCT 59.476 40.000 11.00 0.00 42.56 4.40
2548 2610 6.258068 ACTCGGTTTATATTAAGCTGTGCTTC 59.742 38.462 8.14 0.00 46.77 3.86
2549 2611 6.346096 TCGGTTTATATTAAGCTGTGCTTCT 58.654 36.000 8.14 1.00 46.77 2.85
2550 2612 6.479001 TCGGTTTATATTAAGCTGTGCTTCTC 59.521 38.462 8.14 0.00 46.77 2.87
2551 2613 6.257849 CGGTTTATATTAAGCTGTGCTTCTCA 59.742 38.462 8.14 0.00 46.77 3.27
2552 2614 7.041780 CGGTTTATATTAAGCTGTGCTTCTCAT 60.042 37.037 8.14 3.13 46.77 2.90
2553 2615 8.624776 GGTTTATATTAAGCTGTGCTTCTCATT 58.375 33.333 8.14 0.00 46.77 2.57
2556 2618 4.771590 TTAAGCTGTGCTTCTCATTTGG 57.228 40.909 8.14 0.00 46.77 3.28
2557 2619 1.542492 AGCTGTGCTTCTCATTTGGG 58.458 50.000 0.00 0.00 33.89 4.12
2558 2620 0.108945 GCTGTGCTTCTCATTTGGGC 60.109 55.000 0.00 0.00 0.00 5.36
2559 2621 1.250328 CTGTGCTTCTCATTTGGGCA 58.750 50.000 0.00 0.00 0.00 5.36
2560 2622 3.800628 GTGCTTCTCATTTGGGCAC 57.199 52.632 0.00 0.00 44.53 5.01
2561 2623 1.251251 GTGCTTCTCATTTGGGCACT 58.749 50.000 8.79 0.00 46.39 4.40
2562 2624 1.200948 GTGCTTCTCATTTGGGCACTC 59.799 52.381 8.79 0.00 46.39 3.51
2563 2625 0.449388 GCTTCTCATTTGGGCACTCG 59.551 55.000 0.00 0.00 0.00 4.18
2564 2626 1.089920 CTTCTCATTTGGGCACTCGG 58.910 55.000 0.00 0.00 0.00 4.63
2565 2627 0.400213 TTCTCATTTGGGCACTCGGT 59.600 50.000 0.00 0.00 0.00 4.69
2566 2628 0.400213 TCTCATTTGGGCACTCGGTT 59.600 50.000 0.00 0.00 0.00 4.44
2567 2629 1.202879 TCTCATTTGGGCACTCGGTTT 60.203 47.619 0.00 0.00 0.00 3.27
2568 2630 2.039216 TCTCATTTGGGCACTCGGTTTA 59.961 45.455 0.00 0.00 0.00 2.01
2569 2631 2.420022 CTCATTTGGGCACTCGGTTTAG 59.580 50.000 0.00 0.00 0.00 1.85
2570 2632 2.039216 TCATTTGGGCACTCGGTTTAGA 59.961 45.455 0.00 0.00 0.00 2.10
2571 2633 2.178912 TTTGGGCACTCGGTTTAGAG 57.821 50.000 0.00 0.00 43.56 2.43
2572 2634 1.344065 TTGGGCACTCGGTTTAGAGA 58.656 50.000 0.62 0.00 40.57 3.10
2573 2635 1.568504 TGGGCACTCGGTTTAGAGAT 58.431 50.000 0.62 0.00 40.57 2.75
2574 2636 2.742348 TGGGCACTCGGTTTAGAGATA 58.258 47.619 0.62 0.00 40.57 1.98
2575 2637 3.101437 TGGGCACTCGGTTTAGAGATAA 58.899 45.455 0.62 0.00 40.57 1.75
2576 2638 3.516300 TGGGCACTCGGTTTAGAGATAAA 59.484 43.478 0.62 0.00 40.57 1.40
2577 2639 4.020039 TGGGCACTCGGTTTAGAGATAAAA 60.020 41.667 0.62 0.00 40.57 1.52
2578 2640 4.331992 GGGCACTCGGTTTAGAGATAAAAC 59.668 45.833 0.62 0.00 40.57 2.43
2580 2642 4.624452 GCACTCGGTTTAGAGATAAAACGT 59.376 41.667 15.39 0.00 46.61 3.99
2581 2643 5.444218 GCACTCGGTTTAGAGATAAAACGTG 60.444 44.000 15.39 15.13 46.61 4.49
2582 2644 5.776744 ACTCGGTTTAGAGATAAAACGTGT 58.223 37.500 15.89 15.89 46.61 4.49
2584 2646 7.433873 CTCGGTTTAGAGATAAAACGTGTAG 57.566 40.000 15.39 5.03 46.61 2.74
2585 2647 5.801947 TCGGTTTAGAGATAAAACGTGTAGC 59.198 40.000 15.39 0.00 46.61 3.58
2586 2648 5.803967 CGGTTTAGAGATAAAACGTGTAGCT 59.196 40.000 9.42 0.00 43.00 3.32
2587 2649 6.020837 CGGTTTAGAGATAAAACGTGTAGCTC 60.021 42.308 14.01 14.01 43.00 4.09
2588 2650 7.034397 GGTTTAGAGATAAAACGTGTAGCTCT 58.966 38.462 23.13 23.13 44.39 4.09
2589 2651 8.186821 GGTTTAGAGATAAAACGTGTAGCTCTA 58.813 37.037 21.62 21.62 41.37 2.43
2590 2652 9.008289 GTTTAGAGATAAAACGTGTAGCTCTAC 57.992 37.037 23.73 16.77 43.01 2.59
2591 2653 6.134040 AGAGATAAAACGTGTAGCTCTACC 57.866 41.667 20.05 1.01 41.37 3.18
2592 2654 5.067544 AGAGATAAAACGTGTAGCTCTACCC 59.932 44.000 20.05 0.72 41.37 3.69
2593 2655 4.708421 AGATAAAACGTGTAGCTCTACCCA 59.292 41.667 0.00 0.00 35.26 4.51
2594 2656 3.314541 AAAACGTGTAGCTCTACCCAG 57.685 47.619 0.00 0.00 35.26 4.45
2595 2657 0.531200 AACGTGTAGCTCTACCCAGC 59.469 55.000 0.00 0.00 39.99 4.85
2596 2658 0.611062 ACGTGTAGCTCTACCCAGCA 60.611 55.000 0.00 0.00 42.40 4.41
2597 2659 0.179134 CGTGTAGCTCTACCCAGCAC 60.179 60.000 0.00 0.00 42.40 4.40
2598 2660 1.187087 GTGTAGCTCTACCCAGCACT 58.813 55.000 0.00 0.00 42.40 4.40
2599 2661 1.135333 GTGTAGCTCTACCCAGCACTC 59.865 57.143 0.00 0.00 42.40 3.51
2600 2662 1.272480 TGTAGCTCTACCCAGCACTCA 60.272 52.381 0.00 0.00 42.40 3.41
2601 2663 1.407258 GTAGCTCTACCCAGCACTCAG 59.593 57.143 0.00 0.00 42.40 3.35
2602 2664 0.252012 AGCTCTACCCAGCACTCAGT 60.252 55.000 0.00 0.00 42.40 3.41
2603 2665 0.610687 GCTCTACCCAGCACTCAGTT 59.389 55.000 0.00 0.00 39.43 3.16
2604 2666 1.002544 GCTCTACCCAGCACTCAGTTT 59.997 52.381 0.00 0.00 39.43 2.66
2605 2667 2.233922 GCTCTACCCAGCACTCAGTTTA 59.766 50.000 0.00 0.00 39.43 2.01
2606 2668 3.677424 GCTCTACCCAGCACTCAGTTTAG 60.677 52.174 0.00 0.00 39.43 1.85
2607 2669 3.764434 CTCTACCCAGCACTCAGTTTAGA 59.236 47.826 0.00 0.00 0.00 2.10
2608 2670 4.353777 TCTACCCAGCACTCAGTTTAGAT 58.646 43.478 0.00 0.00 0.00 1.98
2609 2671 5.516044 TCTACCCAGCACTCAGTTTAGATA 58.484 41.667 0.00 0.00 0.00 1.98
2610 2672 6.136857 TCTACCCAGCACTCAGTTTAGATAT 58.863 40.000 0.00 0.00 0.00 1.63
2611 2673 7.295340 TCTACCCAGCACTCAGTTTAGATATA 58.705 38.462 0.00 0.00 0.00 0.86
2612 2674 6.808321 ACCCAGCACTCAGTTTAGATATAA 57.192 37.500 0.00 0.00 0.00 0.98
2613 2675 7.195374 ACCCAGCACTCAGTTTAGATATAAA 57.805 36.000 0.00 0.00 0.00 1.40
2614 2676 7.048512 ACCCAGCACTCAGTTTAGATATAAAC 58.951 38.462 13.86 13.86 39.52 2.01
2615 2677 6.483640 CCCAGCACTCAGTTTAGATATAAACC 59.516 42.308 17.21 3.62 39.94 3.27
2616 2678 6.201044 CCAGCACTCAGTTTAGATATAAACCG 59.799 42.308 17.21 9.19 39.94 4.44
2617 2679 6.757010 CAGCACTCAGTTTAGATATAAACCGT 59.243 38.462 17.21 10.56 39.94 4.83
2618 2680 6.757010 AGCACTCAGTTTAGATATAAACCGTG 59.243 38.462 21.21 21.21 39.94 4.94
2619 2681 6.534079 GCACTCAGTTTAGATATAAACCGTGT 59.466 38.462 23.58 16.97 39.94 4.49
2620 2682 7.464178 GCACTCAGTTTAGATATAAACCGTGTG 60.464 40.741 23.93 23.93 40.75 3.82
2621 2683 7.010183 CACTCAGTTTAGATATAAACCGTGTGG 59.990 40.741 22.13 14.03 39.94 4.17
2622 2684 5.813672 TCAGTTTAGATATAAACCGTGTGGC 59.186 40.000 17.21 0.00 39.94 5.01
2623 2685 5.815740 CAGTTTAGATATAAACCGTGTGGCT 59.184 40.000 17.21 0.00 39.94 4.75
2624 2686 6.018994 CAGTTTAGATATAAACCGTGTGGCTC 60.019 42.308 17.21 0.00 39.94 4.70
2625 2687 3.470645 AGATATAAACCGTGTGGCTCC 57.529 47.619 0.00 0.00 39.70 4.70
2626 2688 2.769663 AGATATAAACCGTGTGGCTCCA 59.230 45.455 0.00 0.00 39.70 3.86
2627 2689 3.391296 AGATATAAACCGTGTGGCTCCAT 59.609 43.478 0.00 0.00 39.70 3.41
2628 2690 2.507407 ATAAACCGTGTGGCTCCATT 57.493 45.000 0.00 0.00 39.70 3.16
2629 2691 3.637911 ATAAACCGTGTGGCTCCATTA 57.362 42.857 0.00 0.00 39.70 1.90
2630 2692 1.821216 AAACCGTGTGGCTCCATTAG 58.179 50.000 0.00 0.00 39.70 1.73
2631 2693 0.035439 AACCGTGTGGCTCCATTAGG 60.035 55.000 0.00 0.00 39.70 2.69
2632 2694 1.198759 ACCGTGTGGCTCCATTAGGT 61.199 55.000 6.40 6.40 39.70 3.08
2633 2695 0.828022 CCGTGTGGCTCCATTAGGTA 59.172 55.000 0.00 0.00 35.89 3.08
2634 2696 1.472728 CCGTGTGGCTCCATTAGGTAC 60.473 57.143 0.00 0.00 35.89 3.34
2635 2697 1.480954 CGTGTGGCTCCATTAGGTACT 59.519 52.381 0.00 0.00 46.37 2.73
2636 2698 2.481449 CGTGTGGCTCCATTAGGTACTC 60.481 54.545 0.00 0.00 41.75 2.59
2637 2699 1.754803 TGTGGCTCCATTAGGTACTCG 59.245 52.381 0.00 0.00 41.75 4.18
2638 2700 1.068741 GTGGCTCCATTAGGTACTCGG 59.931 57.143 0.00 0.00 41.75 4.63
2639 2701 1.342674 TGGCTCCATTAGGTACTCGGT 60.343 52.381 0.00 0.00 41.75 4.69
2640 2702 1.761198 GGCTCCATTAGGTACTCGGTT 59.239 52.381 0.00 0.00 41.75 4.44
2641 2703 2.169978 GGCTCCATTAGGTACTCGGTTT 59.830 50.000 0.00 0.00 41.75 3.27
2642 2704 3.385755 GGCTCCATTAGGTACTCGGTTTA 59.614 47.826 0.00 0.00 41.75 2.01
2643 2705 4.040095 GGCTCCATTAGGTACTCGGTTTAT 59.960 45.833 0.00 0.00 41.75 1.40
2644 2706 5.244626 GGCTCCATTAGGTACTCGGTTTATA 59.755 44.000 0.00 0.00 41.75 0.98
2645 2707 6.388278 GCTCCATTAGGTACTCGGTTTATAG 58.612 44.000 0.00 0.00 41.75 1.31
2646 2708 6.208204 GCTCCATTAGGTACTCGGTTTATAGA 59.792 42.308 0.00 0.00 41.75 1.98
2647 2709 7.575343 GCTCCATTAGGTACTCGGTTTATAGAG 60.575 44.444 0.00 0.00 41.75 2.43
2648 2710 7.520798 TCCATTAGGTACTCGGTTTATAGAGA 58.479 38.462 0.00 0.00 41.75 3.10
2649 2711 7.446625 TCCATTAGGTACTCGGTTTATAGAGAC 59.553 40.741 0.00 0.00 41.75 3.36
2650 2712 6.851222 TTAGGTACTCGGTTTATAGAGACG 57.149 41.667 0.00 0.00 41.75 4.18
2651 2713 4.133078 AGGTACTCGGTTTATAGAGACGG 58.867 47.826 0.00 0.00 37.87 4.79
2652 2714 3.879892 GGTACTCGGTTTATAGAGACGGT 59.120 47.826 0.00 0.00 37.87 4.83
2653 2715 4.260948 GGTACTCGGTTTATAGAGACGGTG 60.261 50.000 0.00 0.00 37.87 4.94
2654 2716 3.614092 ACTCGGTTTATAGAGACGGTGA 58.386 45.455 0.00 0.00 37.87 4.02
2655 2717 3.376546 ACTCGGTTTATAGAGACGGTGAC 59.623 47.826 0.00 0.00 37.87 3.67
2656 2718 3.346315 TCGGTTTATAGAGACGGTGACA 58.654 45.455 0.00 0.00 0.00 3.58
2657 2719 3.127548 TCGGTTTATAGAGACGGTGACAC 59.872 47.826 0.00 0.00 0.00 3.67
2658 2720 3.432782 GGTTTATAGAGACGGTGACACG 58.567 50.000 0.00 0.00 40.31 4.49
2674 2736 2.279252 CGTGGCCGTTATCTCCCG 60.279 66.667 0.00 0.00 0.00 5.14
2675 2737 2.108362 GTGGCCGTTATCTCCCGG 59.892 66.667 0.00 0.00 46.90 5.73
2680 2742 1.664306 CCGTTATCTCCCGGCTACC 59.336 63.158 0.00 0.00 37.43 3.18
2682 2744 1.450531 CGTTATCTCCCGGCTACCGT 61.451 60.000 5.17 0.00 46.80 4.83
2683 2745 0.313357 GTTATCTCCCGGCTACCGTC 59.687 60.000 5.17 0.00 46.80 4.79
2684 2746 0.106569 TTATCTCCCGGCTACCGTCA 60.107 55.000 5.17 0.00 46.80 4.35
2685 2747 0.111832 TATCTCCCGGCTACCGTCAT 59.888 55.000 5.17 0.00 46.80 3.06
2686 2748 1.464376 ATCTCCCGGCTACCGTCATG 61.464 60.000 5.17 0.00 46.80 3.07
2687 2749 2.363276 TCCCGGCTACCGTCATGT 60.363 61.111 5.17 0.00 46.80 3.21
2688 2750 1.956629 CTCCCGGCTACCGTCATGTT 61.957 60.000 5.17 0.00 46.80 2.71
2689 2751 0.683828 TCCCGGCTACCGTCATGTTA 60.684 55.000 5.17 0.00 46.80 2.41
2690 2752 0.529119 CCCGGCTACCGTCATGTTAC 60.529 60.000 5.17 0.00 46.80 2.50
2691 2753 0.458669 CCGGCTACCGTCATGTTACT 59.541 55.000 5.17 0.00 46.80 2.24
2692 2754 1.134907 CCGGCTACCGTCATGTTACTT 60.135 52.381 5.17 0.00 46.80 2.24
2693 2755 2.613691 CGGCTACCGTCATGTTACTTT 58.386 47.619 0.00 0.00 42.73 2.66
2694 2756 3.429272 CCGGCTACCGTCATGTTACTTTA 60.429 47.826 5.17 0.00 46.80 1.85
2695 2757 3.795101 CGGCTACCGTCATGTTACTTTAG 59.205 47.826 0.00 0.00 42.73 1.85
2696 2758 4.676196 CGGCTACCGTCATGTTACTTTAGT 60.676 45.833 0.00 0.00 42.73 2.24
2697 2759 5.449041 CGGCTACCGTCATGTTACTTTAGTA 60.449 44.000 0.00 0.00 42.73 1.82
2698 2760 6.332630 GGCTACCGTCATGTTACTTTAGTAA 58.667 40.000 0.00 0.00 38.10 2.24
2699 2761 6.474751 GGCTACCGTCATGTTACTTTAGTAAG 59.525 42.308 2.68 0.00 40.74 2.34
2700 2762 6.020041 GCTACCGTCATGTTACTTTAGTAAGC 60.020 42.308 2.68 0.00 40.74 3.09
2701 2763 5.173664 ACCGTCATGTTACTTTAGTAAGCC 58.826 41.667 2.68 0.00 40.74 4.35
2702 2764 4.266976 CCGTCATGTTACTTTAGTAAGCCG 59.733 45.833 2.68 2.39 40.74 5.52
2703 2765 5.097529 CGTCATGTTACTTTAGTAAGCCGA 58.902 41.667 2.68 0.00 40.74 5.54
2704 2766 5.229469 CGTCATGTTACTTTAGTAAGCCGAG 59.771 44.000 2.68 0.00 40.74 4.63
2705 2767 6.327934 GTCATGTTACTTTAGTAAGCCGAGA 58.672 40.000 2.68 0.00 40.74 4.04
2706 2768 6.472808 GTCATGTTACTTTAGTAAGCCGAGAG 59.527 42.308 2.68 0.00 40.74 3.20
2707 2769 4.741342 TGTTACTTTAGTAAGCCGAGAGC 58.259 43.478 2.68 0.00 40.74 4.09
2708 2770 2.963548 ACTTTAGTAAGCCGAGAGCC 57.036 50.000 0.00 0.00 45.47 4.70
2709 2771 2.458620 ACTTTAGTAAGCCGAGAGCCT 58.541 47.619 0.00 0.00 45.47 4.58
2710 2772 2.832733 ACTTTAGTAAGCCGAGAGCCTT 59.167 45.455 0.00 0.00 45.47 4.35
2711 2773 2.961526 TTAGTAAGCCGAGAGCCTTG 57.038 50.000 0.00 0.00 45.47 3.61
2712 2774 1.848652 TAGTAAGCCGAGAGCCTTGT 58.151 50.000 0.00 0.00 45.47 3.16
2713 2775 1.848652 AGTAAGCCGAGAGCCTTGTA 58.151 50.000 0.00 0.00 45.47 2.41
2714 2776 2.389715 AGTAAGCCGAGAGCCTTGTAT 58.610 47.619 0.00 0.00 45.47 2.29
2715 2777 3.563223 AGTAAGCCGAGAGCCTTGTATA 58.437 45.455 0.00 0.00 45.47 1.47
2716 2778 3.958798 AGTAAGCCGAGAGCCTTGTATAA 59.041 43.478 0.00 0.00 45.47 0.98
2717 2779 3.906720 AAGCCGAGAGCCTTGTATAAA 57.093 42.857 0.00 0.00 45.47 1.40
2718 2780 3.180891 AGCCGAGAGCCTTGTATAAAC 57.819 47.619 0.00 0.00 45.47 2.01
2719 2781 2.500098 AGCCGAGAGCCTTGTATAAACA 59.500 45.455 0.00 0.00 45.47 2.83
2720 2782 2.608090 GCCGAGAGCCTTGTATAAACAC 59.392 50.000 0.00 0.00 32.61 3.32
2721 2783 3.857052 CCGAGAGCCTTGTATAAACACA 58.143 45.455 0.00 0.00 34.61 3.72
2722 2784 3.617263 CCGAGAGCCTTGTATAAACACAC 59.383 47.826 0.00 0.00 34.61 3.82
2723 2785 3.303495 CGAGAGCCTTGTATAAACACACG 59.697 47.826 0.00 0.00 34.61 4.49
2724 2786 3.596214 AGAGCCTTGTATAAACACACGG 58.404 45.455 0.00 0.00 40.04 4.94
2726 2788 2.798834 CCTTGTATAAACACACGGCG 57.201 50.000 4.80 4.80 34.61 6.46
2727 2789 2.070783 CCTTGTATAAACACACGGCGT 58.929 47.619 6.77 6.77 34.61 5.68
2728 2790 3.252400 CCTTGTATAAACACACGGCGTA 58.748 45.455 14.22 0.00 34.61 4.42
2729 2791 3.679025 CCTTGTATAAACACACGGCGTAA 59.321 43.478 14.22 0.00 34.61 3.18
2730 2792 4.152045 CCTTGTATAAACACACGGCGTAAA 59.848 41.667 14.22 0.00 34.61 2.01
2731 2793 5.163834 CCTTGTATAAACACACGGCGTAAAT 60.164 40.000 14.22 0.00 34.61 1.40
2732 2794 6.035866 CCTTGTATAAACACACGGCGTAAATA 59.964 38.462 14.22 2.32 34.61 1.40
2733 2795 6.572153 TGTATAAACACACGGCGTAAATAG 57.428 37.500 14.22 1.66 0.00 1.73
2734 2796 6.328714 TGTATAAACACACGGCGTAAATAGA 58.671 36.000 14.22 0.00 0.00 1.98
2735 2797 6.810676 TGTATAAACACACGGCGTAAATAGAA 59.189 34.615 14.22 0.00 0.00 2.10
2736 2798 6.724694 ATAAACACACGGCGTAAATAGAAA 57.275 33.333 14.22 0.00 0.00 2.52
2737 2799 4.394099 AACACACGGCGTAAATAGAAAC 57.606 40.909 14.22 0.00 0.00 2.78
2738 2800 2.738314 ACACACGGCGTAAATAGAAACC 59.262 45.455 14.22 0.00 0.00 3.27
2739 2801 1.994779 ACACGGCGTAAATAGAAACCG 59.005 47.619 14.22 0.00 45.86 4.44
2740 2802 2.261345 CACGGCGTAAATAGAAACCGA 58.739 47.619 14.22 0.00 43.19 4.69
2741 2803 2.280708 CACGGCGTAAATAGAAACCGAG 59.719 50.000 14.22 0.00 43.19 4.63
2742 2804 2.094545 ACGGCGTAAATAGAAACCGAGT 60.095 45.455 12.58 0.00 43.19 4.18
2743 2805 2.280708 CGGCGTAAATAGAAACCGAGTG 59.719 50.000 0.00 0.00 43.19 3.51
2744 2806 3.256558 GGCGTAAATAGAAACCGAGTGT 58.743 45.455 0.00 0.00 0.00 3.55
2745 2807 3.681417 GGCGTAAATAGAAACCGAGTGTT 59.319 43.478 0.00 0.00 39.43 3.32
2754 2816 2.559998 AACCGAGTGTTTTTGTGCAG 57.440 45.000 0.00 0.00 31.47 4.41
2755 2817 0.738389 ACCGAGTGTTTTTGTGCAGG 59.262 50.000 0.00 0.00 0.00 4.85
2756 2818 0.594796 CCGAGTGTTTTTGTGCAGGC 60.595 55.000 0.00 0.00 0.00 4.85
2757 2819 0.100325 CGAGTGTTTTTGTGCAGGCA 59.900 50.000 0.00 0.00 0.00 4.75
2758 2820 1.559831 GAGTGTTTTTGTGCAGGCAC 58.440 50.000 17.11 17.11 46.33 5.01
2759 2821 1.134946 GAGTGTTTTTGTGCAGGCACT 59.865 47.619 23.29 2.28 46.30 4.40
2760 2822 1.134946 AGTGTTTTTGTGCAGGCACTC 59.865 47.619 23.29 10.31 46.30 3.51
2761 2823 0.100325 TGTTTTTGTGCAGGCACTCG 59.900 50.000 23.29 0.00 46.30 4.18
2762 2824 0.594796 GTTTTTGTGCAGGCACTCGG 60.595 55.000 23.29 0.00 46.30 4.63
2763 2825 2.348605 TTTTTGTGCAGGCACTCGGC 62.349 55.000 23.29 0.00 46.30 5.54
2773 2835 2.596904 GGCACTCGGCTTATACTTCA 57.403 50.000 0.00 0.00 44.01 3.02
2774 2836 3.113260 GGCACTCGGCTTATACTTCAT 57.887 47.619 0.00 0.00 44.01 2.57
2775 2837 4.252971 GGCACTCGGCTTATACTTCATA 57.747 45.455 0.00 0.00 44.01 2.15
2776 2838 4.628074 GGCACTCGGCTTATACTTCATAA 58.372 43.478 0.00 0.00 44.01 1.90
2777 2839 4.686554 GGCACTCGGCTTATACTTCATAAG 59.313 45.833 0.60 0.60 46.17 1.73
2787 2849 6.665992 TTATACTTCATAAGCCGATGGAGT 57.334 37.500 12.73 12.73 45.80 3.85
2788 2850 3.185246 ACTTCATAAGCCGATGGAGTG 57.815 47.619 8.30 0.00 42.95 3.51
2789 2851 2.501723 ACTTCATAAGCCGATGGAGTGT 59.498 45.455 8.30 0.00 42.95 3.55
2790 2852 3.704566 ACTTCATAAGCCGATGGAGTGTA 59.295 43.478 8.30 0.00 42.95 2.90
2791 2853 4.161565 ACTTCATAAGCCGATGGAGTGTAA 59.838 41.667 8.30 0.00 42.95 2.41
2792 2854 4.322080 TCATAAGCCGATGGAGTGTAAG 57.678 45.455 0.00 0.00 0.00 2.34
2793 2855 2.596904 TAAGCCGATGGAGTGTAAGC 57.403 50.000 0.00 0.00 0.00 3.09
2794 2856 0.107654 AAGCCGATGGAGTGTAAGCC 60.108 55.000 0.00 0.00 0.00 4.35
2795 2857 1.883084 GCCGATGGAGTGTAAGCCG 60.883 63.158 0.00 0.00 0.00 5.52
2796 2858 1.515954 CCGATGGAGTGTAAGCCGT 59.484 57.895 0.00 0.00 0.00 5.68
2797 2859 0.806102 CCGATGGAGTGTAAGCCGTG 60.806 60.000 0.00 0.00 0.00 4.94
2798 2860 0.108804 CGATGGAGTGTAAGCCGTGT 60.109 55.000 0.00 0.00 0.00 4.49
2799 2861 1.641577 GATGGAGTGTAAGCCGTGTC 58.358 55.000 0.00 0.00 0.00 3.67
2800 2862 0.973632 ATGGAGTGTAAGCCGTGTCA 59.026 50.000 0.00 0.00 0.00 3.58
2801 2863 0.973632 TGGAGTGTAAGCCGTGTCAT 59.026 50.000 0.00 0.00 0.00 3.06
2802 2864 2.172679 TGGAGTGTAAGCCGTGTCATA 58.827 47.619 0.00 0.00 0.00 2.15
2803 2865 2.764010 TGGAGTGTAAGCCGTGTCATAT 59.236 45.455 0.00 0.00 0.00 1.78
2804 2866 3.955551 TGGAGTGTAAGCCGTGTCATATA 59.044 43.478 0.00 0.00 0.00 0.86
2805 2867 4.403113 TGGAGTGTAAGCCGTGTCATATAA 59.597 41.667 0.00 0.00 0.00 0.98
2806 2868 4.982916 GGAGTGTAAGCCGTGTCATATAAG 59.017 45.833 0.00 0.00 0.00 1.73
2807 2869 4.369182 AGTGTAAGCCGTGTCATATAAGC 58.631 43.478 0.00 0.00 0.00 3.09
2808 2870 3.493503 GTGTAAGCCGTGTCATATAAGCC 59.506 47.826 0.00 0.00 0.00 4.35
2809 2871 1.865865 AAGCCGTGTCATATAAGCCG 58.134 50.000 0.00 0.00 0.00 5.52
2810 2872 0.033504 AGCCGTGTCATATAAGCCGG 59.966 55.000 0.00 0.00 38.45 6.13
2811 2873 0.949105 GCCGTGTCATATAAGCCGGG 60.949 60.000 2.18 0.00 36.05 5.73
2812 2874 0.677288 CCGTGTCATATAAGCCGGGA 59.323 55.000 2.18 0.00 0.00 5.14
2813 2875 1.336887 CCGTGTCATATAAGCCGGGAG 60.337 57.143 2.18 0.00 0.00 4.30
2814 2876 1.340248 CGTGTCATATAAGCCGGGAGT 59.660 52.381 2.18 0.00 0.00 3.85
2815 2877 2.223971 CGTGTCATATAAGCCGGGAGTT 60.224 50.000 2.18 0.00 0.00 3.01
2816 2878 3.740141 CGTGTCATATAAGCCGGGAGTTT 60.740 47.826 2.18 0.00 0.00 2.66
2817 2879 4.196971 GTGTCATATAAGCCGGGAGTTTT 58.803 43.478 2.18 0.00 0.00 2.43
2818 2880 5.362263 GTGTCATATAAGCCGGGAGTTTTA 58.638 41.667 2.18 0.00 0.00 1.52
2819 2881 5.235831 GTGTCATATAAGCCGGGAGTTTTAC 59.764 44.000 2.18 0.00 0.00 2.01
2820 2882 4.753610 GTCATATAAGCCGGGAGTTTTACC 59.246 45.833 2.18 0.00 0.00 2.85
2821 2883 2.723322 ATAAGCCGGGAGTTTTACCC 57.277 50.000 2.18 0.00 43.57 3.69
2828 2890 2.723322 GGGAGTTTTACCCGGCTTAT 57.277 50.000 0.00 0.00 37.85 1.73
2829 2891 3.843893 GGGAGTTTTACCCGGCTTATA 57.156 47.619 0.00 0.00 37.85 0.98
2830 2892 4.362470 GGGAGTTTTACCCGGCTTATAT 57.638 45.455 0.00 0.00 37.85 0.86
2831 2893 5.488262 GGGAGTTTTACCCGGCTTATATA 57.512 43.478 0.00 0.00 37.85 0.86
2832 2894 6.058553 GGGAGTTTTACCCGGCTTATATAT 57.941 41.667 0.00 0.00 37.85 0.86
2833 2895 7.186570 GGGAGTTTTACCCGGCTTATATATA 57.813 40.000 0.00 0.00 37.85 0.86
2834 2896 7.623630 GGGAGTTTTACCCGGCTTATATATAA 58.376 38.462 0.00 5.10 37.85 0.98
2835 2897 8.102676 GGGAGTTTTACCCGGCTTATATATAAA 58.897 37.037 6.63 0.00 37.85 1.40
2836 2898 8.939929 GGAGTTTTACCCGGCTTATATATAAAC 58.060 37.037 6.63 2.36 0.00 2.01
2837 2899 8.853077 AGTTTTACCCGGCTTATATATAAACC 57.147 34.615 13.02 13.02 0.00 3.27
2838 2900 7.603784 AGTTTTACCCGGCTTATATATAAACCG 59.396 37.037 28.70 28.70 46.22 4.44
2839 2901 6.603940 TTACCCGGCTTATATATAAACCGT 57.396 37.500 31.00 21.95 45.59 4.83
2840 2902 4.824289 ACCCGGCTTATATATAAACCGTG 58.176 43.478 31.00 26.27 45.59 4.94
2841 2903 4.284234 ACCCGGCTTATATATAAACCGTGT 59.716 41.667 31.00 26.76 45.59 4.49
2842 2904 5.221702 ACCCGGCTTATATATAAACCGTGTT 60.222 40.000 31.00 19.12 45.59 3.32
2843 2905 5.349543 CCCGGCTTATATATAAACCGTGTTC 59.650 44.000 31.00 6.91 45.59 3.18
2844 2906 5.927689 CCGGCTTATATATAAACCGTGTTCA 59.072 40.000 31.00 1.28 45.59 3.18
2845 2907 6.592607 CCGGCTTATATATAAACCGTGTTCAT 59.407 38.462 31.00 0.00 45.59 2.57
2846 2908 7.760794 CCGGCTTATATATAAACCGTGTTCATA 59.239 37.037 31.00 0.69 45.59 2.15
2847 2909 9.309516 CGGCTTATATATAAACCGTGTTCATAT 57.690 33.333 27.86 0.16 43.38 1.78
2858 2920 8.677148 AAACCGTGTTCATATCAATATAAGCT 57.323 30.769 0.00 0.00 0.00 3.74
2859 2921 7.658179 ACCGTGTTCATATCAATATAAGCTG 57.342 36.000 0.00 0.00 0.00 4.24
2860 2922 7.441836 ACCGTGTTCATATCAATATAAGCTGA 58.558 34.615 0.00 0.00 0.00 4.26
2861 2923 7.600375 ACCGTGTTCATATCAATATAAGCTGAG 59.400 37.037 0.00 0.00 0.00 3.35
2862 2924 7.600375 CCGTGTTCATATCAATATAAGCTGAGT 59.400 37.037 0.00 0.00 0.00 3.41
2863 2925 8.430828 CGTGTTCATATCAATATAAGCTGAGTG 58.569 37.037 0.00 0.00 0.00 3.51
2864 2926 9.265901 GTGTTCATATCAATATAAGCTGAGTGT 57.734 33.333 0.00 0.00 0.00 3.55
2870 2932 9.896645 ATATCAATATAAGCTGAGTGTATTGGG 57.103 33.333 11.31 0.00 34.89 4.12
2871 2933 7.136822 TCAATATAAGCTGAGTGTATTGGGT 57.863 36.000 11.31 0.00 34.89 4.51
2872 2934 8.257602 TCAATATAAGCTGAGTGTATTGGGTA 57.742 34.615 11.31 0.00 34.89 3.69
2873 2935 8.148351 TCAATATAAGCTGAGTGTATTGGGTAC 58.852 37.037 11.31 0.00 34.89 3.34
2874 2936 5.950544 ATAAGCTGAGTGTATTGGGTACA 57.049 39.130 0.00 0.00 40.93 2.90
2881 2943 2.863132 TGTATTGGGTACACGGCTTT 57.137 45.000 0.00 0.00 38.37 3.51
2882 2944 3.977134 TGTATTGGGTACACGGCTTTA 57.023 42.857 0.00 0.00 38.37 1.85
2883 2945 4.283363 TGTATTGGGTACACGGCTTTAA 57.717 40.909 0.00 0.00 38.37 1.52
2884 2946 4.649692 TGTATTGGGTACACGGCTTTAAA 58.350 39.130 0.00 0.00 38.37 1.52
2885 2947 4.696402 TGTATTGGGTACACGGCTTTAAAG 59.304 41.667 11.02 11.02 38.37 1.85
2886 2948 2.934886 TGGGTACACGGCTTTAAAGT 57.065 45.000 16.38 0.00 0.00 2.66
2887 2949 3.211718 TGGGTACACGGCTTTAAAGTT 57.788 42.857 16.38 0.00 0.00 2.66
2888 2950 3.553904 TGGGTACACGGCTTTAAAGTTT 58.446 40.909 16.38 0.00 0.00 2.66
2889 2951 3.952967 TGGGTACACGGCTTTAAAGTTTT 59.047 39.130 16.38 0.00 0.00 2.43
2890 2952 4.401837 TGGGTACACGGCTTTAAAGTTTTT 59.598 37.500 16.38 1.26 0.00 1.94
2912 2974 8.710835 TTTTTCCTGTAGTGATTTTTGGAAAC 57.289 30.769 0.00 0.00 40.41 2.78
2913 2975 6.399639 TTCCTGTAGTGATTTTTGGAAACC 57.600 37.500 0.00 0.00 0.00 3.27
2914 2976 5.701224 TCCTGTAGTGATTTTTGGAAACCT 58.299 37.500 0.00 0.00 0.00 3.50
2915 2977 6.133356 TCCTGTAGTGATTTTTGGAAACCTT 58.867 36.000 0.00 0.00 0.00 3.50
2916 2978 7.291566 TCCTGTAGTGATTTTTGGAAACCTTA 58.708 34.615 0.00 0.00 0.00 2.69
2917 2979 7.780745 TCCTGTAGTGATTTTTGGAAACCTTAA 59.219 33.333 0.00 0.00 0.00 1.85
2918 2980 8.585018 CCTGTAGTGATTTTTGGAAACCTTAAT 58.415 33.333 0.00 0.00 0.00 1.40
2919 2981 9.981114 CTGTAGTGATTTTTGGAAACCTTAATT 57.019 29.630 0.00 0.00 0.00 1.40
2923 2985 9.898152 AGTGATTTTTGGAAACCTTAATTTTGA 57.102 25.926 0.00 0.00 0.00 2.69
2928 2990 7.954788 TTTGGAAACCTTAATTTTGAATCCG 57.045 32.000 0.00 0.00 0.00 4.18
2929 2991 6.031751 TGGAAACCTTAATTTTGAATCCGG 57.968 37.500 0.00 0.00 0.00 5.14
2930 2992 5.540719 TGGAAACCTTAATTTTGAATCCGGT 59.459 36.000 0.00 0.00 0.00 5.28
2931 2993 6.042208 TGGAAACCTTAATTTTGAATCCGGTT 59.958 34.615 0.00 0.00 35.20 4.44
2932 2994 6.932400 GGAAACCTTAATTTTGAATCCGGTTT 59.068 34.615 0.00 0.00 43.77 3.27
2933 2995 7.442969 GGAAACCTTAATTTTGAATCCGGTTTT 59.557 33.333 0.00 0.00 41.87 2.43
2934 2996 8.740123 AAACCTTAATTTTGAATCCGGTTTTT 57.260 26.923 0.00 0.00 39.66 1.94
2935 2997 9.833917 AAACCTTAATTTTGAATCCGGTTTTTA 57.166 25.926 0.00 0.00 39.66 1.52
2937 2999 9.430623 ACCTTAATTTTGAATCCGGTTTTTATG 57.569 29.630 0.00 0.00 0.00 1.90
2938 3000 8.878769 CCTTAATTTTGAATCCGGTTTTTATGG 58.121 33.333 0.00 3.22 0.00 2.74
2939 3001 9.430623 CTTAATTTTGAATCCGGTTTTTATGGT 57.569 29.630 0.00 0.00 0.00 3.55
2940 3002 9.780186 TTAATTTTGAATCCGGTTTTTATGGTT 57.220 25.926 0.00 0.00 0.00 3.67
2942 3004 8.996024 ATTTTGAATCCGGTTTTTATGGTTAG 57.004 30.769 0.00 0.00 0.00 2.34
2943 3005 7.762588 TTTGAATCCGGTTTTTATGGTTAGA 57.237 32.000 0.00 0.00 0.00 2.10
2944 3006 6.746745 TGAATCCGGTTTTTATGGTTAGAC 57.253 37.500 0.00 0.00 0.00 2.59
2945 3007 5.648960 TGAATCCGGTTTTTATGGTTAGACC 59.351 40.000 0.00 0.00 39.22 3.85
2958 3020 3.383505 TGGTTAGACCATCTCCACATACG 59.616 47.826 0.00 0.00 44.79 3.06
2959 3021 3.381949 GTTAGACCATCTCCACATACGC 58.618 50.000 0.00 0.00 0.00 4.42
2960 3022 0.753262 AGACCATCTCCACATACGCC 59.247 55.000 0.00 0.00 0.00 5.68
2961 3023 0.249911 GACCATCTCCACATACGCCC 60.250 60.000 0.00 0.00 0.00 6.13
2962 3024 0.980754 ACCATCTCCACATACGCCCA 60.981 55.000 0.00 0.00 0.00 5.36
2963 3025 0.180171 CCATCTCCACATACGCCCAA 59.820 55.000 0.00 0.00 0.00 4.12
2964 3026 1.408127 CCATCTCCACATACGCCCAAA 60.408 52.381 0.00 0.00 0.00 3.28
2965 3027 2.364632 CATCTCCACATACGCCCAAAA 58.635 47.619 0.00 0.00 0.00 2.44
2966 3028 2.570415 TCTCCACATACGCCCAAAAA 57.430 45.000 0.00 0.00 0.00 1.94
2982 3044 3.032339 AAAAACCGGCGCGCTAAA 58.968 50.000 32.29 0.00 0.00 1.85
2983 3045 1.359475 AAAAACCGGCGCGCTAAAA 59.641 47.368 32.29 0.00 0.00 1.52
2984 3046 0.038983 AAAAACCGGCGCGCTAAAAT 60.039 45.000 32.29 12.26 0.00 1.82
2985 3047 0.803740 AAAACCGGCGCGCTAAAATA 59.196 45.000 32.29 0.00 0.00 1.40
2986 3048 1.018910 AAACCGGCGCGCTAAAATAT 58.981 45.000 32.29 8.78 0.00 1.28
2987 3049 1.018910 AACCGGCGCGCTAAAATATT 58.981 45.000 32.29 12.70 0.00 1.28
2988 3050 1.018910 ACCGGCGCGCTAAAATATTT 58.981 45.000 32.29 0.00 0.00 1.40
2989 3051 1.402613 ACCGGCGCGCTAAAATATTTT 59.597 42.857 32.29 17.18 0.00 1.82
2990 3052 2.159352 ACCGGCGCGCTAAAATATTTTT 60.159 40.909 32.29 3.85 0.00 1.94
2991 3053 3.065095 ACCGGCGCGCTAAAATATTTTTA 59.935 39.130 32.29 4.74 0.00 1.52
2992 3054 3.419596 CCGGCGCGCTAAAATATTTTTAC 59.580 43.478 32.29 7.64 0.00 2.01
2993 3055 4.029704 CGGCGCGCTAAAATATTTTTACA 58.970 39.130 32.29 0.55 0.00 2.41
2994 3056 4.144051 CGGCGCGCTAAAATATTTTTACAG 59.856 41.667 32.29 11.00 0.00 2.74
2995 3057 5.032220 GGCGCGCTAAAATATTTTTACAGT 58.968 37.500 32.29 0.00 0.00 3.55
2996 3058 5.052633 GGCGCGCTAAAATATTTTTACAGTG 60.053 40.000 32.29 15.92 0.00 3.66
2997 3059 5.551920 GCGCGCTAAAATATTTTTACAGTGC 60.552 40.000 26.67 24.77 38.68 4.40
2998 3060 5.052633 CGCGCTAAAATATTTTTACAGTGCC 60.053 40.000 26.66 16.64 38.76 5.01
2999 3061 5.802956 GCGCTAAAATATTTTTACAGTGCCA 59.197 36.000 24.47 5.64 37.45 4.92
3000 3062 6.475402 GCGCTAAAATATTTTTACAGTGCCAT 59.525 34.615 24.47 2.46 37.45 4.40
3001 3063 7.010091 GCGCTAAAATATTTTTACAGTGCCATT 59.990 33.333 24.47 2.30 37.45 3.16
3002 3064 8.868916 CGCTAAAATATTTTTACAGTGCCATTT 58.131 29.630 18.14 0.00 0.00 2.32
3015 3077 9.849166 TTACAGTGCCATTTTAGTAATTTTAGC 57.151 29.630 0.00 0.00 0.00 3.09
3016 3078 7.320399 ACAGTGCCATTTTAGTAATTTTAGCC 58.680 34.615 0.00 0.00 0.00 3.93
3017 3079 7.178451 ACAGTGCCATTTTAGTAATTTTAGCCT 59.822 33.333 0.00 0.00 0.00 4.58
3018 3080 7.489113 CAGTGCCATTTTAGTAATTTTAGCCTG 59.511 37.037 0.00 0.00 0.00 4.85
3019 3081 6.255670 GTGCCATTTTAGTAATTTTAGCCTGC 59.744 38.462 0.00 0.00 0.00 4.85
3020 3082 5.753438 GCCATTTTAGTAATTTTAGCCTGCC 59.247 40.000 0.00 0.00 0.00 4.85
3021 3083 5.977129 CCATTTTAGTAATTTTAGCCTGCCG 59.023 40.000 0.00 0.00 0.00 5.69
3022 3084 6.405397 CCATTTTAGTAATTTTAGCCTGCCGT 60.405 38.462 0.00 0.00 0.00 5.68
3023 3085 5.554822 TTTAGTAATTTTAGCCTGCCGTG 57.445 39.130 0.00 0.00 0.00 4.94
3024 3086 3.343941 AGTAATTTTAGCCTGCCGTGA 57.656 42.857 0.00 0.00 0.00 4.35
3025 3087 3.007635 AGTAATTTTAGCCTGCCGTGAC 58.992 45.455 0.00 0.00 0.00 3.67
3026 3088 1.173913 AATTTTAGCCTGCCGTGACC 58.826 50.000 0.00 0.00 0.00 4.02
3027 3089 0.037590 ATTTTAGCCTGCCGTGACCA 59.962 50.000 0.00 0.00 0.00 4.02
3028 3090 0.605319 TTTTAGCCTGCCGTGACCAG 60.605 55.000 0.00 0.00 0.00 4.00
3029 3091 1.764571 TTTAGCCTGCCGTGACCAGT 61.765 55.000 0.00 0.00 0.00 4.00
3030 3092 2.167398 TTAGCCTGCCGTGACCAGTC 62.167 60.000 0.00 0.00 0.00 3.51
3032 3094 3.625897 CCTGCCGTGACCAGTCCA 61.626 66.667 0.00 0.00 0.00 4.02
3033 3095 2.047844 CTGCCGTGACCAGTCCAG 60.048 66.667 0.00 0.00 0.00 3.86
3034 3096 4.314440 TGCCGTGACCAGTCCAGC 62.314 66.667 0.00 0.00 0.00 4.85
3035 3097 4.314440 GCCGTGACCAGTCCAGCA 62.314 66.667 0.00 0.00 0.00 4.41
3036 3098 2.047844 CCGTGACCAGTCCAGCAG 60.048 66.667 0.00 0.00 0.00 4.24
3037 3099 2.047844 CGTGACCAGTCCAGCAGG 60.048 66.667 0.00 0.00 0.00 4.85
3038 3100 2.359230 GTGACCAGTCCAGCAGGC 60.359 66.667 0.00 0.00 33.74 4.85
3039 3101 4.007644 TGACCAGTCCAGCAGGCG 62.008 66.667 0.00 0.00 33.74 5.52
3043 3105 4.994471 CAGTCCAGCAGGCGCACA 62.994 66.667 10.83 0.00 42.27 4.57
3044 3106 4.254709 AGTCCAGCAGGCGCACAA 62.255 61.111 10.83 0.00 42.27 3.33
3045 3107 3.286751 GTCCAGCAGGCGCACAAA 61.287 61.111 10.83 0.00 42.27 2.83
3046 3108 2.518112 TCCAGCAGGCGCACAAAA 60.518 55.556 10.83 0.00 42.27 2.44
3047 3109 2.124060 TCCAGCAGGCGCACAAAAA 61.124 52.632 10.83 0.00 42.27 1.94
3048 3110 1.005867 CCAGCAGGCGCACAAAAAT 60.006 52.632 10.83 0.00 42.27 1.82
3049 3111 0.243365 CCAGCAGGCGCACAAAAATA 59.757 50.000 10.83 0.00 42.27 1.40
3050 3112 1.135024 CCAGCAGGCGCACAAAAATAT 60.135 47.619 10.83 0.00 42.27 1.28
3051 3113 2.098934 CCAGCAGGCGCACAAAAATATA 59.901 45.455 10.83 0.00 42.27 0.86
3052 3114 3.365832 CAGCAGGCGCACAAAAATATAG 58.634 45.455 10.83 0.00 42.27 1.31
3053 3115 2.119457 GCAGGCGCACAAAAATATAGC 58.881 47.619 10.83 0.00 38.36 2.97
3057 3119 1.753956 CGCACAAAAATATAGCGGGC 58.246 50.000 0.00 0.00 44.20 6.13
3058 3120 1.064803 CGCACAAAAATATAGCGGGCA 59.935 47.619 0.00 0.00 44.20 5.36
3059 3121 2.478709 CGCACAAAAATATAGCGGGCAA 60.479 45.455 0.00 0.00 44.20 4.52
3060 3122 2.857748 GCACAAAAATATAGCGGGCAAC 59.142 45.455 0.00 0.00 0.00 4.17
3062 3124 2.098443 ACAAAAATATAGCGGGCAACGG 59.902 45.455 2.23 0.00 44.51 4.44
3063 3125 2.335316 AAAATATAGCGGGCAACGGA 57.665 45.000 2.23 0.00 44.51 4.69
3064 3126 1.589803 AAATATAGCGGGCAACGGAC 58.410 50.000 2.23 0.00 44.51 4.79
3065 3127 0.466543 AATATAGCGGGCAACGGACA 59.533 50.000 2.23 0.00 44.51 4.02
3066 3128 0.033504 ATATAGCGGGCAACGGACAG 59.966 55.000 2.23 0.00 44.51 3.51
3067 3129 2.638330 TATAGCGGGCAACGGACAGC 62.638 60.000 2.23 0.00 44.40 4.40
3073 3135 3.947841 GCAACGGACAGCGCACAA 61.948 61.111 11.47 0.00 0.00 3.33
3074 3136 2.712539 CAACGGACAGCGCACAAA 59.287 55.556 11.47 0.00 0.00 2.83
3075 3137 1.063327 CAACGGACAGCGCACAAAA 59.937 52.632 11.47 0.00 0.00 2.44
3076 3138 0.929824 CAACGGACAGCGCACAAAAG 60.930 55.000 11.47 0.00 0.00 2.27
3077 3139 1.373590 AACGGACAGCGCACAAAAGT 61.374 50.000 11.47 0.00 0.00 2.66
3078 3140 1.082756 CGGACAGCGCACAAAAGTC 60.083 57.895 11.47 7.35 0.00 3.01
3079 3141 1.282875 GGACAGCGCACAAAAGTCC 59.717 57.895 11.47 12.80 41.59 3.85
3080 3142 1.444119 GGACAGCGCACAAAAGTCCA 61.444 55.000 11.47 0.00 46.15 4.02
3081 3143 0.040958 GACAGCGCACAAAAGTCCAG 60.041 55.000 11.47 0.00 0.00 3.86
3082 3144 1.370900 CAGCGCACAAAAGTCCAGC 60.371 57.895 11.47 0.00 0.00 4.85
3083 3145 2.050077 GCGCACAAAAGTCCAGCC 60.050 61.111 0.30 0.00 0.00 4.85
3084 3146 2.252260 CGCACAAAAGTCCAGCCG 59.748 61.111 0.00 0.00 0.00 5.52
3085 3147 2.250939 CGCACAAAAGTCCAGCCGA 61.251 57.895 0.00 0.00 0.00 5.54
3086 3148 1.282875 GCACAAAAGTCCAGCCGAC 59.717 57.895 0.00 0.00 42.32 4.79
3087 3149 1.569493 CACAAAAGTCCAGCCGACG 59.431 57.895 0.00 0.00 46.92 5.12
3088 3150 2.251642 ACAAAAGTCCAGCCGACGC 61.252 57.895 0.00 0.00 46.92 5.19
3089 3151 2.110213 AAAAGTCCAGCCGACGCA 59.890 55.556 0.00 0.00 46.92 5.24
3090 3152 2.251642 AAAAGTCCAGCCGACGCAC 61.252 57.895 0.00 0.00 46.92 5.34
3091 3153 2.660258 AAAAGTCCAGCCGACGCACT 62.660 55.000 0.00 0.00 46.92 4.40
3092 3154 1.812686 AAAGTCCAGCCGACGCACTA 61.813 55.000 0.00 0.00 46.92 2.74
3093 3155 1.812686 AAGTCCAGCCGACGCACTAA 61.813 55.000 0.00 0.00 46.92 2.24
3094 3156 1.373748 GTCCAGCCGACGCACTAAA 60.374 57.895 0.00 0.00 37.52 1.85
3095 3157 0.947180 GTCCAGCCGACGCACTAAAA 60.947 55.000 0.00 0.00 37.52 1.52
3096 3158 0.249953 TCCAGCCGACGCACTAAAAA 60.250 50.000 0.00 0.00 37.52 1.94
3114 3176 4.787381 AAAAATAAAGCGCCACAACAAC 57.213 36.364 2.29 0.00 0.00 3.32
3115 3177 3.444703 AAATAAAGCGCCACAACAACA 57.555 38.095 2.29 0.00 0.00 3.33
3116 3178 3.444703 AATAAAGCGCCACAACAACAA 57.555 38.095 2.29 0.00 0.00 2.83
3117 3179 2.941453 TAAAGCGCCACAACAACAAA 57.059 40.000 2.29 0.00 0.00 2.83
3118 3180 1.355005 AAAGCGCCACAACAACAAAC 58.645 45.000 2.29 0.00 0.00 2.93
3119 3181 0.244994 AAGCGCCACAACAACAAACA 59.755 45.000 2.29 0.00 0.00 2.83
3120 3182 0.244994 AGCGCCACAACAACAAACAA 59.755 45.000 2.29 0.00 0.00 2.83
3121 3183 0.644843 GCGCCACAACAACAAACAAG 59.355 50.000 0.00 0.00 0.00 3.16
3122 3184 1.989430 CGCCACAACAACAAACAAGT 58.011 45.000 0.00 0.00 0.00 3.16
3123 3185 1.917303 CGCCACAACAACAAACAAGTC 59.083 47.619 0.00 0.00 0.00 3.01
3124 3186 2.267426 GCCACAACAACAAACAAGTCC 58.733 47.619 0.00 0.00 0.00 3.85
3125 3187 2.887337 CCACAACAACAAACAAGTCCC 58.113 47.619 0.00 0.00 0.00 4.46
3126 3188 2.495669 CCACAACAACAAACAAGTCCCT 59.504 45.455 0.00 0.00 0.00 4.20
3127 3189 3.697045 CCACAACAACAAACAAGTCCCTA 59.303 43.478 0.00 0.00 0.00 3.53
3128 3190 4.158764 CCACAACAACAAACAAGTCCCTAA 59.841 41.667 0.00 0.00 0.00 2.69
3129 3191 5.099575 CACAACAACAAACAAGTCCCTAAC 58.900 41.667 0.00 0.00 0.00 2.34
3130 3192 4.767928 ACAACAACAAACAAGTCCCTAACA 59.232 37.500 0.00 0.00 0.00 2.41
3131 3193 5.420739 ACAACAACAAACAAGTCCCTAACAT 59.579 36.000 0.00 0.00 0.00 2.71
3132 3194 6.071051 ACAACAACAAACAAGTCCCTAACATT 60.071 34.615 0.00 0.00 0.00 2.71
3133 3195 6.538945 ACAACAAACAAGTCCCTAACATTT 57.461 33.333 0.00 0.00 0.00 2.32
3134 3196 7.648039 ACAACAAACAAGTCCCTAACATTTA 57.352 32.000 0.00 0.00 0.00 1.40
3135 3197 7.485810 ACAACAAACAAGTCCCTAACATTTAC 58.514 34.615 0.00 0.00 0.00 2.01
3136 3198 7.122948 ACAACAAACAAGTCCCTAACATTTACA 59.877 33.333 0.00 0.00 0.00 2.41
3137 3199 7.648039 ACAAACAAGTCCCTAACATTTACAA 57.352 32.000 0.00 0.00 0.00 2.41
3138 3200 8.068892 ACAAACAAGTCCCTAACATTTACAAA 57.931 30.769 0.00 0.00 0.00 2.83
3139 3201 8.700973 ACAAACAAGTCCCTAACATTTACAAAT 58.299 29.630 0.00 0.00 0.00 2.32
3143 3205 9.582648 ACAAGTCCCTAACATTTACAAATAAGT 57.417 29.630 0.00 0.00 0.00 2.24
3145 3207 8.803397 AGTCCCTAACATTTACAAATAAGTCC 57.197 34.615 0.00 0.00 0.00 3.85
3146 3208 8.387813 AGTCCCTAACATTTACAAATAAGTCCA 58.612 33.333 0.00 0.00 0.00 4.02
3147 3209 9.185680 GTCCCTAACATTTACAAATAAGTCCAT 57.814 33.333 0.00 0.00 0.00 3.41
3148 3210 9.762381 TCCCTAACATTTACAAATAAGTCCATT 57.238 29.630 0.00 0.00 0.00 3.16
3153 3215 9.705290 AACATTTACAAATAAGTCCATTTGACC 57.295 29.630 13.82 0.00 44.96 4.02
3154 3216 8.865090 ACATTTACAAATAAGTCCATTTGACCA 58.135 29.630 13.82 0.23 44.96 4.02
3155 3217 9.703892 CATTTACAAATAAGTCCATTTGACCAA 57.296 29.630 13.82 5.42 44.96 3.67
3158 3220 9.535878 TTACAAATAAGTCCATTTGACCAAAAC 57.464 29.630 13.82 0.00 44.96 2.43
3159 3221 7.560368 ACAAATAAGTCCATTTGACCAAAACA 58.440 30.769 13.82 0.00 44.96 2.83
3160 3222 8.043710 ACAAATAAGTCCATTTGACCAAAACAA 58.956 29.630 13.82 0.00 44.96 2.83
3161 3223 8.887717 CAAATAAGTCCATTTGACCAAAACAAA 58.112 29.630 3.07 0.00 44.96 2.83
3162 3224 9.454859 AAATAAGTCCATTTGACCAAAACAAAA 57.545 25.926 0.00 0.00 45.68 2.44
3163 3225 9.454859 AATAAGTCCATTTGACCAAAACAAAAA 57.545 25.926 0.00 0.00 45.68 1.94
3164 3226 6.735678 AGTCCATTTGACCAAAACAAAAAC 57.264 33.333 0.00 0.00 45.68 2.43
3165 3227 5.350091 AGTCCATTTGACCAAAACAAAAACG 59.650 36.000 0.00 0.00 45.68 3.60
3166 3228 4.093556 TCCATTTGACCAAAACAAAAACGC 59.906 37.500 0.00 0.00 39.95 4.84
3167 3229 4.142816 CCATTTGACCAAAACAAAAACGCA 60.143 37.500 0.00 0.00 39.95 5.24
3168 3230 5.385617 CATTTGACCAAAACAAAAACGCAA 58.614 33.333 0.00 0.00 39.95 4.85
3169 3231 5.613358 TTTGACCAAAACAAAAACGCAAT 57.387 30.435 0.00 0.00 34.89 3.56
3170 3232 6.721571 TTTGACCAAAACAAAAACGCAATA 57.278 29.167 0.00 0.00 34.89 1.90
3171 3233 5.957910 TGACCAAAACAAAAACGCAATAG 57.042 34.783 0.00 0.00 0.00 1.73
3172 3234 5.651530 TGACCAAAACAAAAACGCAATAGA 58.348 33.333 0.00 0.00 0.00 1.98
3173 3235 6.276847 TGACCAAAACAAAAACGCAATAGAT 58.723 32.000 0.00 0.00 0.00 1.98
3174 3236 6.419413 TGACCAAAACAAAAACGCAATAGATC 59.581 34.615 0.00 0.00 0.00 2.75
3175 3237 5.694458 ACCAAAACAAAAACGCAATAGATCC 59.306 36.000 0.00 0.00 0.00 3.36
3176 3238 5.120053 CCAAAACAAAAACGCAATAGATCCC 59.880 40.000 0.00 0.00 0.00 3.85
3177 3239 4.450082 AACAAAAACGCAATAGATCCCC 57.550 40.909 0.00 0.00 0.00 4.81
3178 3240 3.426615 ACAAAAACGCAATAGATCCCCA 58.573 40.909 0.00 0.00 0.00 4.96
3179 3241 3.829601 ACAAAAACGCAATAGATCCCCAA 59.170 39.130 0.00 0.00 0.00 4.12
3180 3242 4.282195 ACAAAAACGCAATAGATCCCCAAA 59.718 37.500 0.00 0.00 0.00 3.28
3181 3243 5.221541 ACAAAAACGCAATAGATCCCCAAAA 60.222 36.000 0.00 0.00 0.00 2.44
3182 3244 4.718940 AAACGCAATAGATCCCCAAAAG 57.281 40.909 0.00 0.00 0.00 2.27
3183 3245 3.366052 ACGCAATAGATCCCCAAAAGT 57.634 42.857 0.00 0.00 0.00 2.66
3184 3246 3.697166 ACGCAATAGATCCCCAAAAGTT 58.303 40.909 0.00 0.00 0.00 2.66
3185 3247 3.443681 ACGCAATAGATCCCCAAAAGTTG 59.556 43.478 0.00 0.00 0.00 3.16
3198 3260 3.642705 CAAAAGTTGGAGCAAACTAGCC 58.357 45.455 0.00 0.00 39.48 3.93
3199 3261 2.959465 AAGTTGGAGCAAACTAGCCT 57.041 45.000 0.00 0.00 39.48 4.58
3200 3262 2.959465 AGTTGGAGCAAACTAGCCTT 57.041 45.000 0.00 0.00 38.62 4.35
3201 3263 3.229697 AGTTGGAGCAAACTAGCCTTT 57.770 42.857 0.00 0.00 38.62 3.11
3202 3264 4.367039 AGTTGGAGCAAACTAGCCTTTA 57.633 40.909 0.00 0.00 38.62 1.85
3203 3265 4.327680 AGTTGGAGCAAACTAGCCTTTAG 58.672 43.478 0.00 0.00 38.62 1.85
3204 3266 4.041691 AGTTGGAGCAAACTAGCCTTTAGA 59.958 41.667 0.00 0.00 38.62 2.10
3205 3267 4.634012 TGGAGCAAACTAGCCTTTAGAA 57.366 40.909 0.00 0.00 34.23 2.10
3206 3268 4.980573 TGGAGCAAACTAGCCTTTAGAAA 58.019 39.130 0.00 0.00 34.23 2.52
3207 3269 5.570320 TGGAGCAAACTAGCCTTTAGAAAT 58.430 37.500 0.00 0.00 34.23 2.17
3208 3270 6.010219 TGGAGCAAACTAGCCTTTAGAAATT 58.990 36.000 0.00 0.00 34.23 1.82
3209 3271 7.172342 TGGAGCAAACTAGCCTTTAGAAATTA 58.828 34.615 0.00 0.00 34.23 1.40
3210 3272 7.336931 TGGAGCAAACTAGCCTTTAGAAATTAG 59.663 37.037 0.00 0.00 34.23 1.73
3211 3273 7.553044 GGAGCAAACTAGCCTTTAGAAATTAGA 59.447 37.037 0.00 0.00 34.23 2.10
3212 3274 8.863872 AGCAAACTAGCCTTTAGAAATTAGAA 57.136 30.769 0.00 0.00 34.23 2.10
3213 3275 9.297037 AGCAAACTAGCCTTTAGAAATTAGAAA 57.703 29.630 0.00 0.00 34.23 2.52
3214 3276 9.343103 GCAAACTAGCCTTTAGAAATTAGAAAC 57.657 33.333 0.00 0.00 0.00 2.78
3217 3279 9.794719 AACTAGCCTTTAGAAATTAGAAACACT 57.205 29.630 0.00 0.00 0.00 3.55
3218 3280 9.794719 ACTAGCCTTTAGAAATTAGAAACACTT 57.205 29.630 0.00 0.00 0.00 3.16
3221 3283 9.131791 AGCCTTTAGAAATTAGAAACACTTTCA 57.868 29.630 0.00 0.00 42.10 2.69
3222 3284 9.744468 GCCTTTAGAAATTAGAAACACTTTCAA 57.256 29.630 0.00 0.00 42.10 2.69
3329 3391 7.672983 TTTTATGACTAGAAGCCACAAGAAG 57.327 36.000 0.00 0.00 0.00 2.85
3330 3392 4.899352 ATGACTAGAAGCCACAAGAAGT 57.101 40.909 0.00 0.00 0.00 3.01
3331 3393 4.689612 TGACTAGAAGCCACAAGAAGTT 57.310 40.909 0.00 0.00 0.00 2.66
3332 3394 5.801531 TGACTAGAAGCCACAAGAAGTTA 57.198 39.130 0.00 0.00 0.00 2.24
3333 3395 5.784177 TGACTAGAAGCCACAAGAAGTTAG 58.216 41.667 0.00 0.00 0.00 2.34
3334 3396 5.538813 TGACTAGAAGCCACAAGAAGTTAGA 59.461 40.000 0.00 0.00 0.00 2.10
3335 3397 6.041637 TGACTAGAAGCCACAAGAAGTTAGAA 59.958 38.462 0.00 0.00 0.00 2.10
3336 3398 7.010339 ACTAGAAGCCACAAGAAGTTAGAAT 57.990 36.000 0.00 0.00 0.00 2.40
3337 3399 7.454225 ACTAGAAGCCACAAGAAGTTAGAATT 58.546 34.615 0.00 0.00 0.00 2.17
3338 3400 6.566197 AGAAGCCACAAGAAGTTAGAATTG 57.434 37.500 0.00 0.00 0.00 2.32
3339 3401 6.064717 AGAAGCCACAAGAAGTTAGAATTGT 58.935 36.000 0.00 0.00 36.34 2.71
3340 3402 7.224297 AGAAGCCACAAGAAGTTAGAATTGTA 58.776 34.615 0.00 0.00 34.26 2.41
3341 3403 7.719633 AGAAGCCACAAGAAGTTAGAATTGTAA 59.280 33.333 0.00 0.00 34.26 2.41
3342 3404 7.817418 AGCCACAAGAAGTTAGAATTGTAAA 57.183 32.000 0.00 0.00 34.26 2.01
3343 3405 8.232913 AGCCACAAGAAGTTAGAATTGTAAAA 57.767 30.769 0.00 0.00 34.26 1.52
3344 3406 8.860088 AGCCACAAGAAGTTAGAATTGTAAAAT 58.140 29.630 0.00 0.00 34.26 1.82
3345 3407 9.476202 GCCACAAGAAGTTAGAATTGTAAAATT 57.524 29.630 0.00 0.00 34.26 1.82
3380 3442 9.734984 TCTACATCCGATCAATATTACTAGTCA 57.265 33.333 0.00 0.00 0.00 3.41
3381 3443 9.776158 CTACATCCGATCAATATTACTAGTCAC 57.224 37.037 0.00 0.00 0.00 3.67
3382 3444 8.178313 ACATCCGATCAATATTACTAGTCACA 57.822 34.615 0.00 0.00 0.00 3.58
3383 3445 8.300286 ACATCCGATCAATATTACTAGTCACAG 58.700 37.037 0.00 0.00 0.00 3.66
3384 3446 6.678878 TCCGATCAATATTACTAGTCACAGC 58.321 40.000 0.00 0.00 0.00 4.40
3385 3447 6.490381 TCCGATCAATATTACTAGTCACAGCT 59.510 38.462 0.00 0.00 0.00 4.24
3386 3448 7.014326 TCCGATCAATATTACTAGTCACAGCTT 59.986 37.037 0.00 0.00 0.00 3.74
3387 3449 8.297426 CCGATCAATATTACTAGTCACAGCTTA 58.703 37.037 0.00 0.00 0.00 3.09
3388 3450 9.678941 CGATCAATATTACTAGTCACAGCTTAA 57.321 33.333 0.00 0.00 0.00 1.85
3423 3485 7.865706 AGCATAAACTGGTACTAAATCTTGG 57.134 36.000 0.00 0.00 32.64 3.61
3424 3486 6.828785 AGCATAAACTGGTACTAAATCTTGGG 59.171 38.462 0.00 0.00 32.64 4.12
3425 3487 6.039382 GCATAAACTGGTACTAAATCTTGGGG 59.961 42.308 0.00 0.00 0.00 4.96
3426 3488 5.853572 AAACTGGTACTAAATCTTGGGGA 57.146 39.130 0.00 0.00 0.00 4.81
3427 3489 5.853572 AACTGGTACTAAATCTTGGGGAA 57.146 39.130 0.00 0.00 0.00 3.97
3428 3490 5.853572 ACTGGTACTAAATCTTGGGGAAA 57.146 39.130 0.00 0.00 0.00 3.13
3429 3491 6.402981 ACTGGTACTAAATCTTGGGGAAAT 57.597 37.500 0.00 0.00 0.00 2.17
3430 3492 7.519347 ACTGGTACTAAATCTTGGGGAAATA 57.481 36.000 0.00 0.00 0.00 1.40
3431 3493 7.574607 ACTGGTACTAAATCTTGGGGAAATAG 58.425 38.462 0.00 0.00 0.00 1.73
3432 3494 7.184022 ACTGGTACTAAATCTTGGGGAAATAGT 59.816 37.037 0.00 0.00 35.26 2.12
3433 3495 8.626917 TGGTACTAAATCTTGGGGAAATAGTA 57.373 34.615 0.00 0.00 33.98 1.82
3434 3496 9.232882 TGGTACTAAATCTTGGGGAAATAGTAT 57.767 33.333 0.00 0.00 35.78 2.12
3435 3497 9.503399 GGTACTAAATCTTGGGGAAATAGTATG 57.497 37.037 0.00 0.00 35.78 2.39
3440 3502 7.986085 AATCTTGGGGAAATAGTATGAATCG 57.014 36.000 0.00 0.00 0.00 3.34
3441 3503 5.865085 TCTTGGGGAAATAGTATGAATCGG 58.135 41.667 0.00 0.00 0.00 4.18
3442 3504 5.605069 TCTTGGGGAAATAGTATGAATCGGA 59.395 40.000 0.00 0.00 0.00 4.55
3443 3505 5.483685 TGGGGAAATAGTATGAATCGGAG 57.516 43.478 0.00 0.00 0.00 4.63
3444 3506 4.286032 TGGGGAAATAGTATGAATCGGAGG 59.714 45.833 0.00 0.00 0.00 4.30
3445 3507 4.323562 GGGGAAATAGTATGAATCGGAGGG 60.324 50.000 0.00 0.00 0.00 4.30
3446 3508 4.530946 GGGAAATAGTATGAATCGGAGGGA 59.469 45.833 0.00 0.00 0.00 4.20
3447 3509 5.480205 GGAAATAGTATGAATCGGAGGGAC 58.520 45.833 0.00 0.00 0.00 4.46
3449 3511 6.436532 GGAAATAGTATGAATCGGAGGGACTA 59.563 42.308 0.00 0.00 41.55 2.59
3450 3512 7.363094 GGAAATAGTATGAATCGGAGGGACTAG 60.363 44.444 0.00 0.00 41.55 2.57
3451 3513 4.726035 AGTATGAATCGGAGGGACTAGA 57.274 45.455 0.00 0.00 41.55 2.43
3452 3514 5.063017 AGTATGAATCGGAGGGACTAGAA 57.937 43.478 0.00 0.00 41.55 2.10
3453 3515 5.646215 AGTATGAATCGGAGGGACTAGAAT 58.354 41.667 0.00 0.00 41.55 2.40
3454 3516 6.078664 AGTATGAATCGGAGGGACTAGAATT 58.921 40.000 0.00 0.00 41.55 2.17
3455 3517 5.896073 ATGAATCGGAGGGACTAGAATTT 57.104 39.130 0.00 0.00 41.55 1.82
3456 3518 5.693769 TGAATCGGAGGGACTAGAATTTT 57.306 39.130 0.00 0.00 41.55 1.82
3457 3519 5.428253 TGAATCGGAGGGACTAGAATTTTG 58.572 41.667 0.00 0.00 41.55 2.44
3458 3520 5.045869 TGAATCGGAGGGACTAGAATTTTGT 60.046 40.000 0.00 0.00 41.55 2.83
3459 3521 6.155565 TGAATCGGAGGGACTAGAATTTTGTA 59.844 38.462 0.00 0.00 41.55 2.41
3460 3522 5.334724 TCGGAGGGACTAGAATTTTGTAC 57.665 43.478 0.00 0.00 41.55 2.90
3461 3523 4.161001 TCGGAGGGACTAGAATTTTGTACC 59.839 45.833 0.00 0.00 41.55 3.34
3462 3524 4.161754 CGGAGGGACTAGAATTTTGTACCT 59.838 45.833 9.16 9.16 46.86 3.08
3465 3527 6.954352 AGGGACTAGAATTTTGTACCTCTT 57.046 37.500 0.00 0.00 40.82 2.85
3466 3528 6.712276 AGGGACTAGAATTTTGTACCTCTTG 58.288 40.000 0.00 0.00 40.82 3.02
3467 3529 6.500751 AGGGACTAGAATTTTGTACCTCTTGA 59.499 38.462 0.00 0.00 40.82 3.02
3468 3530 6.819146 GGGACTAGAATTTTGTACCTCTTGAG 59.181 42.308 0.00 0.00 32.16 3.02
3469 3531 7.387643 GGACTAGAATTTTGTACCTCTTGAGT 58.612 38.462 0.00 0.00 0.00 3.41
3470 3532 7.878644 GGACTAGAATTTTGTACCTCTTGAGTT 59.121 37.037 0.00 0.00 0.00 3.01
3471 3533 9.924650 GACTAGAATTTTGTACCTCTTGAGTTA 57.075 33.333 0.00 0.00 0.00 2.24
3474 3536 8.045176 AGAATTTTGTACCTCTTGAGTTATGC 57.955 34.615 0.00 0.00 0.00 3.14
3475 3537 7.885399 AGAATTTTGTACCTCTTGAGTTATGCT 59.115 33.333 0.00 0.00 0.00 3.79
3476 3538 8.409358 AATTTTGTACCTCTTGAGTTATGCTT 57.591 30.769 0.00 0.00 0.00 3.91
3477 3539 6.801539 TTTGTACCTCTTGAGTTATGCTTG 57.198 37.500 0.00 0.00 0.00 4.01
3478 3540 5.483685 TGTACCTCTTGAGTTATGCTTGT 57.516 39.130 0.00 0.00 0.00 3.16
3479 3541 5.865085 TGTACCTCTTGAGTTATGCTTGTT 58.135 37.500 0.00 0.00 0.00 2.83
3480 3542 5.700832 TGTACCTCTTGAGTTATGCTTGTTG 59.299 40.000 0.00 0.00 0.00 3.33
3481 3543 4.973168 ACCTCTTGAGTTATGCTTGTTGA 58.027 39.130 0.00 0.00 0.00 3.18
3482 3544 5.376625 ACCTCTTGAGTTATGCTTGTTGAA 58.623 37.500 0.00 0.00 0.00 2.69
3483 3545 5.239525 ACCTCTTGAGTTATGCTTGTTGAAC 59.760 40.000 0.00 0.00 0.00 3.18
3484 3546 5.239306 CCTCTTGAGTTATGCTTGTTGAACA 59.761 40.000 0.00 0.00 0.00 3.18
3485 3547 6.072286 CCTCTTGAGTTATGCTTGTTGAACAT 60.072 38.462 0.00 0.00 0.00 2.71
3486 3548 7.275888 TCTTGAGTTATGCTTGTTGAACATT 57.724 32.000 0.00 0.00 0.00 2.71
3487 3549 8.389779 TCTTGAGTTATGCTTGTTGAACATTA 57.610 30.769 0.00 0.00 0.00 1.90
3488 3550 8.289618 TCTTGAGTTATGCTTGTTGAACATTAC 58.710 33.333 0.00 0.00 0.00 1.89
3489 3551 7.744087 TGAGTTATGCTTGTTGAACATTACT 57.256 32.000 0.00 0.00 0.00 2.24
3490 3552 8.165239 TGAGTTATGCTTGTTGAACATTACTT 57.835 30.769 0.00 0.00 0.00 2.24
3491 3553 9.278978 TGAGTTATGCTTGTTGAACATTACTTA 57.721 29.630 0.00 0.00 0.00 2.24
3497 3559 9.979578 ATGCTTGTTGAACATTACTTATTTCAA 57.020 25.926 0.00 0.00 35.98 2.69
3503 3565 7.428282 TGAACATTACTTATTTCAACTCGCA 57.572 32.000 0.00 0.00 0.00 5.10
3504 3566 8.039603 TGAACATTACTTATTTCAACTCGCAT 57.960 30.769 0.00 0.00 0.00 4.73
3505 3567 9.157104 TGAACATTACTTATTTCAACTCGCATA 57.843 29.630 0.00 0.00 0.00 3.14
3506 3568 9.982291 GAACATTACTTATTTCAACTCGCATAA 57.018 29.630 0.00 0.00 0.00 1.90
3550 3612 7.973048 TTACAACTGAACTCATCCCTATACT 57.027 36.000 0.00 0.00 0.00 2.12
3551 3613 6.472686 ACAACTGAACTCATCCCTATACTC 57.527 41.667 0.00 0.00 0.00 2.59
3552 3614 6.198639 ACAACTGAACTCATCCCTATACTCT 58.801 40.000 0.00 0.00 0.00 3.24
3553 3615 7.355101 ACAACTGAACTCATCCCTATACTCTA 58.645 38.462 0.00 0.00 0.00 2.43
3554 3616 7.839705 ACAACTGAACTCATCCCTATACTCTAA 59.160 37.037 0.00 0.00 0.00 2.10
3555 3617 8.696374 CAACTGAACTCATCCCTATACTCTAAA 58.304 37.037 0.00 0.00 0.00 1.85
3556 3618 8.840200 ACTGAACTCATCCCTATACTCTAAAA 57.160 34.615 0.00 0.00 0.00 1.52
3557 3619 9.440761 ACTGAACTCATCCCTATACTCTAAAAT 57.559 33.333 0.00 0.00 0.00 1.82
3597 3659 9.740239 TTGCGAATACTCTAAAATATACTTCGT 57.260 29.630 0.00 0.00 36.34 3.85
3598 3660 9.390795 TGCGAATACTCTAAAATATACTTCGTC 57.609 33.333 0.00 0.00 36.34 4.20
3599 3661 8.848528 GCGAATACTCTAAAATATACTTCGTCC 58.151 37.037 0.00 0.00 36.34 4.79
3600 3662 9.888878 CGAATACTCTAAAATATACTTCGTCCA 57.111 33.333 0.00 0.00 0.00 4.02
3665 3727 7.767250 TGTAAACATATGACATTCCAAACCA 57.233 32.000 10.38 0.00 0.00 3.67
3666 3728 7.825681 TGTAAACATATGACATTCCAAACCAG 58.174 34.615 10.38 0.00 0.00 4.00
3667 3729 6.916360 AAACATATGACATTCCAAACCAGT 57.084 33.333 10.38 0.00 0.00 4.00
3668 3730 6.515272 AACATATGACATTCCAAACCAGTC 57.485 37.500 10.38 0.00 0.00 3.51
3669 3731 5.569355 ACATATGACATTCCAAACCAGTCA 58.431 37.500 10.38 0.00 42.62 3.41
3670 3732 6.009589 ACATATGACATTCCAAACCAGTCAA 58.990 36.000 10.38 0.00 41.86 3.18
3671 3733 6.664816 ACATATGACATTCCAAACCAGTCAAT 59.335 34.615 10.38 0.00 41.86 2.57
3672 3734 7.178983 ACATATGACATTCCAAACCAGTCAATT 59.821 33.333 10.38 0.00 41.86 2.32
3673 3735 5.867903 TGACATTCCAAACCAGTCAATTT 57.132 34.783 0.00 0.00 36.39 1.82
3674 3736 6.232581 TGACATTCCAAACCAGTCAATTTT 57.767 33.333 0.00 0.00 36.39 1.82
3675 3737 6.648192 TGACATTCCAAACCAGTCAATTTTT 58.352 32.000 0.00 0.00 36.39 1.94
3695 3757 3.455990 TTTTACCAGCTGACACGTACA 57.544 42.857 17.39 0.00 0.00 2.90
3696 3758 3.455990 TTTACCAGCTGACACGTACAA 57.544 42.857 17.39 3.86 0.00 2.41
3697 3759 3.671008 TTACCAGCTGACACGTACAAT 57.329 42.857 17.39 0.00 0.00 2.71
3698 3760 4.787260 TTACCAGCTGACACGTACAATA 57.213 40.909 17.39 0.00 0.00 1.90
3699 3761 2.955614 ACCAGCTGACACGTACAATAC 58.044 47.619 17.39 0.00 0.00 1.89
3700 3762 2.297880 ACCAGCTGACACGTACAATACA 59.702 45.455 17.39 0.00 0.00 2.29
3701 3763 3.243941 ACCAGCTGACACGTACAATACAA 60.244 43.478 17.39 0.00 0.00 2.41
3702 3764 3.122948 CCAGCTGACACGTACAATACAAC 59.877 47.826 17.39 0.00 0.00 3.32
3703 3765 3.122948 CAGCTGACACGTACAATACAACC 59.877 47.826 8.42 0.00 0.00 3.77
3704 3766 3.061322 GCTGACACGTACAATACAACCA 58.939 45.455 0.00 0.00 0.00 3.67
3705 3767 3.682858 GCTGACACGTACAATACAACCAT 59.317 43.478 0.00 0.00 0.00 3.55
3706 3768 4.153475 GCTGACACGTACAATACAACCATT 59.847 41.667 0.00 0.00 0.00 3.16
3707 3769 5.334569 GCTGACACGTACAATACAACCATTT 60.335 40.000 0.00 0.00 0.00 2.32
3708 3770 5.991568 TGACACGTACAATACAACCATTTG 58.008 37.500 0.00 0.00 38.83 2.32
3719 3781 3.811083 ACAACCATTTGTAAGTGTCGGA 58.189 40.909 0.00 0.00 44.53 4.55
3720 3782 3.562557 ACAACCATTTGTAAGTGTCGGAC 59.437 43.478 0.00 0.00 44.53 4.79
3721 3783 3.478857 ACCATTTGTAAGTGTCGGACA 57.521 42.857 6.76 6.76 0.00 4.02
3722 3784 3.811083 ACCATTTGTAAGTGTCGGACAA 58.189 40.909 13.23 0.00 0.00 3.18
3723 3785 3.562557 ACCATTTGTAAGTGTCGGACAAC 59.437 43.478 13.23 8.40 32.98 3.32
3724 3786 3.562141 CCATTTGTAAGTGTCGGACAACA 59.438 43.478 13.23 11.04 32.98 3.33
3725 3787 4.035792 CCATTTGTAAGTGTCGGACAACAA 59.964 41.667 18.16 18.16 32.98 2.83
3726 3788 5.449314 CCATTTGTAAGTGTCGGACAACAAA 60.449 40.000 28.01 28.01 42.31 2.83
3727 3789 5.821516 TTTGTAAGTGTCGGACAACAAAT 57.178 34.783 24.76 10.08 37.58 2.32
3728 3790 5.412526 TTGTAAGTGTCGGACAACAAATC 57.587 39.130 19.25 5.48 32.64 2.17
3729 3791 4.443621 TGTAAGTGTCGGACAACAAATCA 58.556 39.130 13.23 5.33 0.00 2.57
3730 3792 4.876679 TGTAAGTGTCGGACAACAAATCAA 59.123 37.500 13.23 0.00 0.00 2.57
3731 3793 5.529430 TGTAAGTGTCGGACAACAAATCAAT 59.471 36.000 13.23 0.00 0.00 2.57
3732 3794 4.749245 AGTGTCGGACAACAAATCAATC 57.251 40.909 13.23 0.00 0.00 2.67
3733 3795 4.133820 AGTGTCGGACAACAAATCAATCA 58.866 39.130 13.23 0.00 0.00 2.57
3734 3796 4.214119 AGTGTCGGACAACAAATCAATCAG 59.786 41.667 13.23 0.00 0.00 2.90
3735 3797 3.501828 TGTCGGACAACAAATCAATCAGG 59.498 43.478 8.68 0.00 0.00 3.86
3736 3798 2.487762 TCGGACAACAAATCAATCAGGC 59.512 45.455 0.00 0.00 0.00 4.85
3737 3799 2.728846 CGGACAACAAATCAATCAGGCG 60.729 50.000 0.00 0.00 0.00 5.52
3738 3800 2.228822 GGACAACAAATCAATCAGGCGT 59.771 45.455 0.00 0.00 0.00 5.68
3739 3801 3.492313 GACAACAAATCAATCAGGCGTC 58.508 45.455 0.00 0.00 0.00 5.19
3740 3802 2.095768 ACAACAAATCAATCAGGCGTCG 60.096 45.455 0.00 0.00 0.00 5.12
3741 3803 0.447801 ACAAATCAATCAGGCGTCGC 59.552 50.000 9.22 9.22 0.00 5.19
3751 3813 3.782042 GGCGTCGCCTAGAAGTTG 58.218 61.111 28.98 0.00 46.69 3.16
3752 3814 2.453638 GGCGTCGCCTAGAAGTTGC 61.454 63.158 28.98 0.00 46.69 4.17
3753 3815 1.446272 GCGTCGCCTAGAAGTTGCT 60.446 57.895 5.75 0.00 0.00 3.91
3754 3816 1.014564 GCGTCGCCTAGAAGTTGCTT 61.015 55.000 5.75 0.00 0.00 3.91
3755 3817 1.734707 GCGTCGCCTAGAAGTTGCTTA 60.735 52.381 5.75 0.00 0.00 3.09
3756 3818 2.810650 CGTCGCCTAGAAGTTGCTTAT 58.189 47.619 0.00 0.00 0.00 1.73
3757 3819 3.187700 CGTCGCCTAGAAGTTGCTTATT 58.812 45.455 0.00 0.00 0.00 1.40
3758 3820 3.617263 CGTCGCCTAGAAGTTGCTTATTT 59.383 43.478 0.00 0.00 0.00 1.40
3759 3821 4.802039 CGTCGCCTAGAAGTTGCTTATTTA 59.198 41.667 0.00 0.00 0.00 1.40
3760 3822 5.290158 CGTCGCCTAGAAGTTGCTTATTTAA 59.710 40.000 0.00 0.00 0.00 1.52
3761 3823 6.183360 CGTCGCCTAGAAGTTGCTTATTTAAA 60.183 38.462 0.00 0.00 0.00 1.52
3762 3824 7.465513 CGTCGCCTAGAAGTTGCTTATTTAAAT 60.466 37.037 5.89 5.89 0.00 1.40
3763 3825 8.823818 GTCGCCTAGAAGTTGCTTATTTAAATA 58.176 33.333 3.71 3.71 0.00 1.40
3764 3826 9.555727 TCGCCTAGAAGTTGCTTATTTAAATAT 57.444 29.630 8.70 0.00 0.00 1.28
3798 3860 5.996669 TGATTATGTCATGCTGATGTCAC 57.003 39.130 0.00 0.00 31.61 3.67
3799 3861 5.430007 TGATTATGTCATGCTGATGTCACA 58.570 37.500 0.00 0.00 31.61 3.58
3800 3862 5.526111 TGATTATGTCATGCTGATGTCACAG 59.474 40.000 0.00 0.00 40.43 3.66
3801 3863 3.622166 ATGTCATGCTGATGTCACAGA 57.378 42.857 0.00 0.00 39.94 3.41
3802 3864 3.405823 TGTCATGCTGATGTCACAGAA 57.594 42.857 0.00 0.00 39.94 3.02
3803 3865 3.069289 TGTCATGCTGATGTCACAGAAC 58.931 45.455 0.00 0.00 39.94 3.01
3804 3866 3.244318 TGTCATGCTGATGTCACAGAACT 60.244 43.478 0.00 0.00 39.94 3.01
3805 3867 3.124806 GTCATGCTGATGTCACAGAACTG 59.875 47.826 0.00 0.00 39.94 3.16
3806 3868 3.007182 TCATGCTGATGTCACAGAACTGA 59.993 43.478 8.87 0.00 39.94 3.41
3807 3869 3.473923 TGCTGATGTCACAGAACTGAA 57.526 42.857 8.87 0.00 39.94 3.02
3808 3870 3.807553 TGCTGATGTCACAGAACTGAAA 58.192 40.909 8.87 0.00 39.94 2.69
3809 3871 4.198530 TGCTGATGTCACAGAACTGAAAA 58.801 39.130 8.87 0.00 39.94 2.29
3810 3872 4.639755 TGCTGATGTCACAGAACTGAAAAA 59.360 37.500 8.87 0.00 39.94 1.94
3811 3873 5.210715 GCTGATGTCACAGAACTGAAAAAG 58.789 41.667 8.87 0.00 39.94 2.27
3812 3874 5.008019 GCTGATGTCACAGAACTGAAAAAGA 59.992 40.000 8.87 0.00 39.94 2.52
3813 3875 6.293845 GCTGATGTCACAGAACTGAAAAAGAT 60.294 38.462 8.87 0.00 39.94 2.40
3814 3876 6.962686 TGATGTCACAGAACTGAAAAAGATG 58.037 36.000 8.87 0.00 0.00 2.90
3815 3877 6.543465 TGATGTCACAGAACTGAAAAAGATGT 59.457 34.615 8.87 0.00 0.00 3.06
3816 3878 6.757897 TGTCACAGAACTGAAAAAGATGTT 57.242 33.333 8.87 0.00 0.00 2.71
3817 3879 7.857734 TGTCACAGAACTGAAAAAGATGTTA 57.142 32.000 8.87 0.00 0.00 2.41
3818 3880 7.693952 TGTCACAGAACTGAAAAAGATGTTAC 58.306 34.615 8.87 0.00 0.00 2.50
3819 3881 7.335673 TGTCACAGAACTGAAAAAGATGTTACA 59.664 33.333 8.87 0.00 29.99 2.41
3820 3882 8.181573 GTCACAGAACTGAAAAAGATGTTACAA 58.818 33.333 8.87 0.00 0.00 2.41
3821 3883 8.902806 TCACAGAACTGAAAAAGATGTTACAAT 58.097 29.630 8.87 0.00 0.00 2.71
3822 3884 8.961092 CACAGAACTGAAAAAGATGTTACAATG 58.039 33.333 8.87 0.00 0.00 2.82
3823 3885 8.137437 ACAGAACTGAAAAAGATGTTACAATGG 58.863 33.333 8.87 0.00 0.00 3.16
3824 3886 7.115378 CAGAACTGAAAAAGATGTTACAATGGC 59.885 37.037 0.00 0.00 0.00 4.40
3825 3887 6.403866 ACTGAAAAAGATGTTACAATGGCA 57.596 33.333 0.00 0.00 0.00 4.92
3826 3888 6.815089 ACTGAAAAAGATGTTACAATGGCAA 58.185 32.000 0.00 0.00 0.00 4.52
3827 3889 7.444299 ACTGAAAAAGATGTTACAATGGCAAT 58.556 30.769 0.00 0.00 0.00 3.56
3828 3890 7.385752 ACTGAAAAAGATGTTACAATGGCAATG 59.614 33.333 0.00 0.00 0.00 2.82
3829 3891 6.147492 TGAAAAAGATGTTACAATGGCAATGC 59.853 34.615 1.63 0.00 0.00 3.56
3830 3892 5.410355 AAAGATGTTACAATGGCAATGCT 57.590 34.783 4.82 0.00 0.00 3.79
3831 3893 4.644103 AGATGTTACAATGGCAATGCTC 57.356 40.909 4.82 0.00 0.00 4.26
3832 3894 3.382546 AGATGTTACAATGGCAATGCTCC 59.617 43.478 4.82 0.00 0.00 4.70
3833 3895 2.806434 TGTTACAATGGCAATGCTCCT 58.194 42.857 4.82 0.00 0.00 3.69
3834 3896 3.164268 TGTTACAATGGCAATGCTCCTT 58.836 40.909 4.82 0.00 0.00 3.36
3835 3897 4.339748 TGTTACAATGGCAATGCTCCTTA 58.660 39.130 4.82 0.00 0.00 2.69
3836 3898 4.955450 TGTTACAATGGCAATGCTCCTTAT 59.045 37.500 4.82 0.00 0.00 1.73
3837 3899 5.421693 TGTTACAATGGCAATGCTCCTTATT 59.578 36.000 4.82 0.00 0.00 1.40
3838 3900 6.070881 TGTTACAATGGCAATGCTCCTTATTT 60.071 34.615 4.82 0.00 0.00 1.40
3839 3901 4.761975 ACAATGGCAATGCTCCTTATTTG 58.238 39.130 4.82 2.14 0.00 2.32
3840 3902 4.223477 ACAATGGCAATGCTCCTTATTTGT 59.777 37.500 4.82 2.72 0.00 2.83
3841 3903 5.421693 ACAATGGCAATGCTCCTTATTTGTA 59.578 36.000 4.82 0.00 0.00 2.41
3842 3904 4.981806 TGGCAATGCTCCTTATTTGTAC 57.018 40.909 4.82 0.00 0.00 2.90
3843 3905 3.376859 TGGCAATGCTCCTTATTTGTACG 59.623 43.478 4.82 0.00 0.00 3.67
3844 3906 3.363178 GCAATGCTCCTTATTTGTACGC 58.637 45.455 0.00 0.00 0.00 4.42
3845 3907 3.065371 GCAATGCTCCTTATTTGTACGCT 59.935 43.478 0.00 0.00 0.00 5.07
3846 3908 4.272504 GCAATGCTCCTTATTTGTACGCTA 59.727 41.667 0.00 0.00 0.00 4.26
3847 3909 5.049405 GCAATGCTCCTTATTTGTACGCTAT 60.049 40.000 0.00 0.00 0.00 2.97
3848 3910 6.593978 CAATGCTCCTTATTTGTACGCTATC 58.406 40.000 0.00 0.00 0.00 2.08
3849 3911 4.628074 TGCTCCTTATTTGTACGCTATCC 58.372 43.478 0.00 0.00 0.00 2.59
3850 3912 4.100344 TGCTCCTTATTTGTACGCTATCCA 59.900 41.667 0.00 0.00 0.00 3.41
3851 3913 5.221641 TGCTCCTTATTTGTACGCTATCCAT 60.222 40.000 0.00 0.00 0.00 3.41
3852 3914 5.701290 GCTCCTTATTTGTACGCTATCCATT 59.299 40.000 0.00 0.00 0.00 3.16
3853 3915 6.204882 GCTCCTTATTTGTACGCTATCCATTT 59.795 38.462 0.00 0.00 0.00 2.32
3854 3916 7.571428 GCTCCTTATTTGTACGCTATCCATTTC 60.571 40.741 0.00 0.00 0.00 2.17
3855 3917 7.276658 TCCTTATTTGTACGCTATCCATTTCA 58.723 34.615 0.00 0.00 0.00 2.69
3856 3918 7.771361 TCCTTATTTGTACGCTATCCATTTCAA 59.229 33.333 0.00 0.00 0.00 2.69
3857 3919 8.567948 CCTTATTTGTACGCTATCCATTTCAAT 58.432 33.333 0.00 0.00 0.00 2.57
3858 3920 9.599322 CTTATTTGTACGCTATCCATTTCAATC 57.401 33.333 0.00 0.00 0.00 2.67
3859 3921 5.651172 TTGTACGCTATCCATTTCAATCG 57.349 39.130 0.00 0.00 0.00 3.34
3860 3922 4.939271 TGTACGCTATCCATTTCAATCGA 58.061 39.130 0.00 0.00 0.00 3.59
3861 3923 5.538118 TGTACGCTATCCATTTCAATCGAT 58.462 37.500 0.00 0.00 0.00 3.59
3862 3924 6.683715 TGTACGCTATCCATTTCAATCGATA 58.316 36.000 0.00 0.00 0.00 2.92
3863 3925 6.584942 TGTACGCTATCCATTTCAATCGATAC 59.415 38.462 0.00 0.00 0.00 2.24
3864 3926 5.784177 ACGCTATCCATTTCAATCGATACT 58.216 37.500 0.00 0.00 0.00 2.12
3865 3927 5.635280 ACGCTATCCATTTCAATCGATACTG 59.365 40.000 0.00 0.00 0.00 2.74
3866 3928 5.445142 CGCTATCCATTTCAATCGATACTGC 60.445 44.000 0.00 0.00 0.00 4.40
3867 3929 4.997905 ATCCATTTCAATCGATACTGCG 57.002 40.909 0.00 0.00 0.00 5.18
3868 3930 3.792401 TCCATTTCAATCGATACTGCGT 58.208 40.909 0.00 0.00 0.00 5.24
3869 3931 3.555547 TCCATTTCAATCGATACTGCGTG 59.444 43.478 0.00 0.00 0.00 5.34
3870 3932 3.309682 CCATTTCAATCGATACTGCGTGT 59.690 43.478 0.00 0.00 0.00 4.49
3871 3933 4.506288 CCATTTCAATCGATACTGCGTGTA 59.494 41.667 0.00 0.00 35.37 2.90
3872 3934 5.177511 CCATTTCAATCGATACTGCGTGTAT 59.822 40.000 0.00 2.39 43.94 2.29
3873 3935 5.635549 TTTCAATCGATACTGCGTGTATG 57.364 39.130 0.00 0.00 41.55 2.39
3874 3936 4.301637 TCAATCGATACTGCGTGTATGT 57.698 40.909 0.00 0.00 41.55 2.29
3875 3937 4.678622 TCAATCGATACTGCGTGTATGTT 58.321 39.130 0.00 0.00 41.55 2.71
3876 3938 5.106442 TCAATCGATACTGCGTGTATGTTT 58.894 37.500 0.00 0.90 41.55 2.83
3877 3939 5.579119 TCAATCGATACTGCGTGTATGTTTT 59.421 36.000 0.00 0.00 41.55 2.43
3878 3940 4.833469 TCGATACTGCGTGTATGTTTTG 57.167 40.909 6.87 0.00 41.55 2.44
3879 3941 4.487019 TCGATACTGCGTGTATGTTTTGA 58.513 39.130 6.87 0.00 41.55 2.69
3880 3942 4.325204 TCGATACTGCGTGTATGTTTTGAC 59.675 41.667 6.87 0.00 41.55 3.18
3881 3943 4.491924 CGATACTGCGTGTATGTTTTGACC 60.492 45.833 6.87 0.00 41.55 4.02
3882 3944 2.566913 ACTGCGTGTATGTTTTGACCA 58.433 42.857 0.00 0.00 0.00 4.02
3883 3945 2.548057 ACTGCGTGTATGTTTTGACCAG 59.452 45.455 0.00 0.00 0.00 4.00
3884 3946 2.805671 CTGCGTGTATGTTTTGACCAGA 59.194 45.455 0.00 0.00 0.00 3.86
3885 3947 3.206964 TGCGTGTATGTTTTGACCAGAA 58.793 40.909 0.00 0.00 0.00 3.02
3886 3948 3.628032 TGCGTGTATGTTTTGACCAGAAA 59.372 39.130 0.00 0.00 0.00 2.52
3887 3949 4.096532 TGCGTGTATGTTTTGACCAGAAAA 59.903 37.500 0.00 0.00 0.00 2.29
3888 3950 5.219633 GCGTGTATGTTTTGACCAGAAAAT 58.780 37.500 0.00 0.00 0.00 1.82
3889 3951 5.689961 GCGTGTATGTTTTGACCAGAAAATT 59.310 36.000 0.00 0.00 0.00 1.82
3890 3952 6.858993 GCGTGTATGTTTTGACCAGAAAATTA 59.141 34.615 0.00 0.00 0.00 1.40
3891 3953 7.380065 GCGTGTATGTTTTGACCAGAAAATTAA 59.620 33.333 0.00 0.00 0.00 1.40
3892 3954 8.687301 CGTGTATGTTTTGACCAGAAAATTAAC 58.313 33.333 0.00 0.00 0.00 2.01
3893 3955 9.522804 GTGTATGTTTTGACCAGAAAATTAACA 57.477 29.630 0.00 0.00 0.00 2.41
4001 4063 8.920509 TTGAAACCTAGTTTACTTTTGAAAGC 57.079 30.769 3.48 0.00 36.36 3.51
4002 4064 7.190871 TGAAACCTAGTTTACTTTTGAAAGCG 58.809 34.615 3.48 0.00 36.36 4.68
4003 4065 6.930667 AACCTAGTTTACTTTTGAAAGCGA 57.069 33.333 3.48 0.00 39.63 4.93
4004 4066 6.296365 ACCTAGTTTACTTTTGAAAGCGAC 57.704 37.500 3.48 1.13 39.63 5.19
4005 4067 6.053650 ACCTAGTTTACTTTTGAAAGCGACT 58.946 36.000 3.48 7.51 39.63 4.18
4006 4068 6.541278 ACCTAGTTTACTTTTGAAAGCGACTT 59.459 34.615 3.48 0.00 39.63 3.01
4007 4069 7.070183 CCTAGTTTACTTTTGAAAGCGACTTC 58.930 38.462 3.48 0.00 39.63 3.01
4008 4070 6.679327 AGTTTACTTTTGAAAGCGACTTCT 57.321 33.333 3.48 0.00 39.63 2.85
4009 4071 7.781548 AGTTTACTTTTGAAAGCGACTTCTA 57.218 32.000 3.48 0.00 39.63 2.10
4010 4072 8.379457 AGTTTACTTTTGAAAGCGACTTCTAT 57.621 30.769 3.48 0.00 39.63 1.98
4011 4073 9.485206 AGTTTACTTTTGAAAGCGACTTCTATA 57.515 29.630 3.48 0.00 39.63 1.31
4014 4076 9.701098 TTACTTTTGAAAGCGACTTCTATAAGA 57.299 29.630 3.48 0.00 39.63 2.10
4015 4077 8.603242 ACTTTTGAAAGCGACTTCTATAAGAA 57.397 30.769 3.48 0.00 39.63 2.52
4016 4078 9.220767 ACTTTTGAAAGCGACTTCTATAAGAAT 57.779 29.630 3.48 0.00 39.63 2.40
4069 4131 5.450818 AGGAAAAATGCATCCTACTACCA 57.549 39.130 4.72 0.00 44.24 3.25
4070 4132 5.440610 AGGAAAAATGCATCCTACTACCAG 58.559 41.667 4.72 0.00 44.24 4.00
4071 4133 4.580580 GGAAAAATGCATCCTACTACCAGG 59.419 45.833 0.00 0.00 37.00 4.45
4072 4134 4.862641 AAAATGCATCCTACTACCAGGT 57.137 40.909 0.00 0.00 36.99 4.00
4073 4135 3.845781 AATGCATCCTACTACCAGGTG 57.154 47.619 0.76 0.00 36.99 4.00
4074 4136 2.247699 TGCATCCTACTACCAGGTGT 57.752 50.000 0.76 0.92 36.99 4.16
4075 4137 3.391799 TGCATCCTACTACCAGGTGTA 57.608 47.619 0.76 2.15 36.99 2.90
4092 4154 2.241160 TGTAGCTACACCCGTTTCTCA 58.759 47.619 22.67 0.00 0.00 3.27
4093 4155 2.829720 TGTAGCTACACCCGTTTCTCAT 59.170 45.455 22.67 0.00 0.00 2.90
4094 4156 4.018490 TGTAGCTACACCCGTTTCTCATA 58.982 43.478 22.67 0.00 0.00 2.15
4095 4157 4.647853 TGTAGCTACACCCGTTTCTCATAT 59.352 41.667 22.67 0.00 0.00 1.78
4096 4158 5.829391 TGTAGCTACACCCGTTTCTCATATA 59.171 40.000 22.67 0.00 0.00 0.86
4097 4159 5.197682 AGCTACACCCGTTTCTCATATAC 57.802 43.478 0.00 0.00 0.00 1.47
4098 4160 4.894114 AGCTACACCCGTTTCTCATATACT 59.106 41.667 0.00 0.00 0.00 2.12
4099 4161 6.066690 AGCTACACCCGTTTCTCATATACTA 58.933 40.000 0.00 0.00 0.00 1.82
4100 4162 6.720288 AGCTACACCCGTTTCTCATATACTAT 59.280 38.462 0.00 0.00 0.00 2.12
4101 4163 7.028361 GCTACACCCGTTTCTCATATACTATC 58.972 42.308 0.00 0.00 0.00 2.08
4102 4164 6.971726 ACACCCGTTTCTCATATACTATCA 57.028 37.500 0.00 0.00 0.00 2.15
4103 4165 7.540474 ACACCCGTTTCTCATATACTATCAT 57.460 36.000 0.00 0.00 0.00 2.45
4104 4166 7.378966 ACACCCGTTTCTCATATACTATCATG 58.621 38.462 0.00 0.00 0.00 3.07
4105 4167 7.015292 ACACCCGTTTCTCATATACTATCATGT 59.985 37.037 0.00 0.00 0.00 3.21
4106 4168 7.329471 CACCCGTTTCTCATATACTATCATGTG 59.671 40.741 0.00 0.00 0.00 3.21
4107 4169 6.813649 CCCGTTTCTCATATACTATCATGTGG 59.186 42.308 0.00 0.00 0.00 4.17
4108 4170 7.378966 CCGTTTCTCATATACTATCATGTGGT 58.621 38.462 0.00 0.00 0.00 4.16
4109 4171 8.520351 CCGTTTCTCATATACTATCATGTGGTA 58.480 37.037 0.00 0.00 0.00 3.25
4110 4172 9.561270 CGTTTCTCATATACTATCATGTGGTAG 57.439 37.037 0.00 0.00 0.00 3.18
4178 4240 7.496346 TCTAAGATACTCCCAAGTGATTTGT 57.504 36.000 0.00 0.00 36.92 2.83
4179 4241 8.603898 TCTAAGATACTCCCAAGTGATTTGTA 57.396 34.615 0.00 0.00 36.92 2.41
4180 4242 9.213777 TCTAAGATACTCCCAAGTGATTTGTAT 57.786 33.333 0.00 0.00 36.92 2.29
4181 4243 9.265901 CTAAGATACTCCCAAGTGATTTGTATG 57.734 37.037 0.00 0.00 36.92 2.39
4182 4244 7.437713 AGATACTCCCAAGTGATTTGTATGA 57.562 36.000 0.00 0.00 36.92 2.15
4183 4245 7.861629 AGATACTCCCAAGTGATTTGTATGAA 58.138 34.615 0.00 0.00 36.92 2.57
4184 4246 8.328758 AGATACTCCCAAGTGATTTGTATGAAA 58.671 33.333 0.00 0.00 36.92 2.69
4185 4247 8.877864 ATACTCCCAAGTGATTTGTATGAAAA 57.122 30.769 0.00 0.00 36.92 2.29
4186 4248 7.595819 ACTCCCAAGTGATTTGTATGAAAAA 57.404 32.000 0.00 0.00 34.87 1.94
4208 4270 8.907222 AAAAATTGCAAGTGAGGTCATAATTT 57.093 26.923 4.94 0.00 0.00 1.82
4209 4271 8.907222 AAAATTGCAAGTGAGGTCATAATTTT 57.093 26.923 4.94 0.00 33.89 1.82
4210 4272 9.995003 AAAATTGCAAGTGAGGTCATAATTTTA 57.005 25.926 4.94 0.00 35.77 1.52
4213 4275 8.984891 TTGCAAGTGAGGTCATAATTTTATTG 57.015 30.769 0.00 0.00 0.00 1.90
4214 4276 8.121305 TGCAAGTGAGGTCATAATTTTATTGT 57.879 30.769 0.00 0.00 0.00 2.71
4215 4277 9.237187 TGCAAGTGAGGTCATAATTTTATTGTA 57.763 29.630 0.00 0.00 0.00 2.41
4259 4321 6.922980 TTATACGTGAAATAGAGTATGCGC 57.077 37.500 0.00 0.00 32.71 6.09
4260 4322 3.159353 ACGTGAAATAGAGTATGCGCA 57.841 42.857 14.96 14.96 0.00 6.09
4261 4323 3.517602 ACGTGAAATAGAGTATGCGCAA 58.482 40.909 17.11 0.11 0.00 4.85
4262 4324 3.930229 ACGTGAAATAGAGTATGCGCAAA 59.070 39.130 17.11 0.00 0.00 3.68
4263 4325 4.390603 ACGTGAAATAGAGTATGCGCAAAA 59.609 37.500 17.11 2.00 0.00 2.44
4264 4326 5.064707 ACGTGAAATAGAGTATGCGCAAAAT 59.935 36.000 17.11 1.85 0.00 1.82
4265 4327 6.256975 ACGTGAAATAGAGTATGCGCAAAATA 59.743 34.615 17.11 0.00 0.00 1.40
4266 4328 7.042051 ACGTGAAATAGAGTATGCGCAAAATAT 60.042 33.333 17.11 6.17 0.00 1.28
4267 4329 7.266966 CGTGAAATAGAGTATGCGCAAAATATG 59.733 37.037 17.11 0.00 0.00 1.78
4268 4330 8.282592 GTGAAATAGAGTATGCGCAAAATATGA 58.717 33.333 17.11 0.00 0.00 2.15
4269 4331 9.002600 TGAAATAGAGTATGCGCAAAATATGAT 57.997 29.630 17.11 0.00 0.00 2.45
4272 4334 9.435688 AATAGAGTATGCGCAAAATATGATACA 57.564 29.630 17.11 0.00 0.00 2.29
4273 4335 7.912056 AGAGTATGCGCAAAATATGATACAT 57.088 32.000 17.11 0.00 0.00 2.29
4275 4337 8.873830 AGAGTATGCGCAAAATATGATACATAC 58.126 33.333 17.11 7.56 38.98 2.39
4276 4338 8.777865 AGTATGCGCAAAATATGATACATACT 57.222 30.769 17.11 10.01 41.30 2.12
4277 4339 9.869757 AGTATGCGCAAAATATGATACATACTA 57.130 29.630 17.11 0.00 42.63 1.82
4278 4340 9.901724 GTATGCGCAAAATATGATACATACTAC 57.098 33.333 17.11 1.73 37.48 2.73
4279 4341 7.359262 TGCGCAAAATATGATACATACTACC 57.641 36.000 8.16 0.00 0.00 3.18
4280 4342 6.931840 TGCGCAAAATATGATACATACTACCA 59.068 34.615 8.16 0.00 0.00 3.25
4281 4343 7.442666 TGCGCAAAATATGATACATACTACCAA 59.557 33.333 8.16 0.00 0.00 3.67
4282 4344 8.286800 GCGCAAAATATGATACATACTACCAAA 58.713 33.333 0.30 0.00 0.00 3.28
4343 4405 8.586570 ACTACATACTACGTGTACATACTCTC 57.413 38.462 0.00 0.00 33.45 3.20
4344 4406 6.857777 ACATACTACGTGTACATACTCTCC 57.142 41.667 0.00 0.00 33.45 3.71
4345 4407 5.464722 ACATACTACGTGTACATACTCTCCG 59.535 44.000 0.00 0.00 33.45 4.63
4346 4408 4.128925 ACTACGTGTACATACTCTCCGA 57.871 45.455 0.00 0.00 0.00 4.55
4347 4409 4.701765 ACTACGTGTACATACTCTCCGAT 58.298 43.478 0.00 0.00 0.00 4.18
4348 4410 5.847304 ACTACGTGTACATACTCTCCGATA 58.153 41.667 0.00 0.00 0.00 2.92
4884 4946 4.630894 AAATTCAATAAATGAGCCGCGA 57.369 36.364 8.23 0.00 39.77 5.87
4885 4947 3.609103 ATTCAATAAATGAGCCGCGAC 57.391 42.857 8.23 0.00 39.77 5.19
4886 4948 2.017138 TCAATAAATGAGCCGCGACA 57.983 45.000 8.23 5.25 33.04 4.35
4887 4949 2.560504 TCAATAAATGAGCCGCGACAT 58.439 42.857 8.23 7.67 33.04 3.06
4888 4950 2.543848 TCAATAAATGAGCCGCGACATC 59.456 45.455 8.23 2.50 33.04 3.06
4889 4951 2.238942 ATAAATGAGCCGCGACATCA 57.761 45.000 8.23 9.18 0.00 3.07
4890 4952 1.570813 TAAATGAGCCGCGACATCAG 58.429 50.000 8.23 0.00 0.00 2.90
4891 4953 1.709147 AAATGAGCCGCGACATCAGC 61.709 55.000 8.23 0.00 0.00 4.26
4892 4954 2.857575 AATGAGCCGCGACATCAGCA 62.858 55.000 8.23 0.00 34.19 4.41
4893 4955 3.260483 GAGCCGCGACATCAGCAG 61.260 66.667 8.23 0.00 34.19 4.24
4894 4956 3.997064 GAGCCGCGACATCAGCAGT 62.997 63.158 8.23 0.00 34.19 4.40
4895 4957 3.121030 GCCGCGACATCAGCAGTT 61.121 61.111 8.23 0.00 34.19 3.16
4896 4958 1.809619 GCCGCGACATCAGCAGTTA 60.810 57.895 8.23 0.00 34.19 2.24
4897 4959 1.999051 CCGCGACATCAGCAGTTAC 59.001 57.895 8.23 0.00 34.19 2.50
4898 4960 1.421410 CCGCGACATCAGCAGTTACC 61.421 60.000 8.23 0.00 34.19 2.85
4899 4961 1.742900 CGCGACATCAGCAGTTACCG 61.743 60.000 0.00 0.00 34.19 4.02
4900 4962 0.457853 GCGACATCAGCAGTTACCGA 60.458 55.000 0.00 0.00 34.19 4.69
4901 4963 1.990799 CGACATCAGCAGTTACCGAA 58.009 50.000 0.00 0.00 0.00 4.30
4902 4964 2.333926 CGACATCAGCAGTTACCGAAA 58.666 47.619 0.00 0.00 0.00 3.46
4903 4965 2.930040 CGACATCAGCAGTTACCGAAAT 59.070 45.455 0.00 0.00 0.00 2.17
4904 4966 3.370978 CGACATCAGCAGTTACCGAAATT 59.629 43.478 0.00 0.00 0.00 1.82
4905 4967 4.142902 CGACATCAGCAGTTACCGAAATTT 60.143 41.667 0.00 0.00 0.00 1.82
4906 4968 5.046910 ACATCAGCAGTTACCGAAATTTG 57.953 39.130 0.00 0.00 0.00 2.32
4907 4969 4.759693 ACATCAGCAGTTACCGAAATTTGA 59.240 37.500 0.00 0.00 0.00 2.69
4908 4970 5.106555 ACATCAGCAGTTACCGAAATTTGAG 60.107 40.000 0.00 0.00 0.00 3.02
4909 4971 4.637276 TCAGCAGTTACCGAAATTTGAGA 58.363 39.130 0.00 0.00 0.00 3.27
4910 4972 4.690748 TCAGCAGTTACCGAAATTTGAGAG 59.309 41.667 0.00 0.00 0.00 3.20
4911 4973 4.690748 CAGCAGTTACCGAAATTTGAGAGA 59.309 41.667 0.00 0.00 0.00 3.10
4912 4974 4.691216 AGCAGTTACCGAAATTTGAGAGAC 59.309 41.667 0.00 0.00 0.00 3.36
4913 4975 4.451096 GCAGTTACCGAAATTTGAGAGACA 59.549 41.667 0.00 0.00 0.00 3.41
4914 4976 5.049680 GCAGTTACCGAAATTTGAGAGACAA 60.050 40.000 0.00 0.00 36.65 3.18
4915 4977 6.363473 CAGTTACCGAAATTTGAGAGACAAC 58.637 40.000 0.00 0.00 38.29 3.32
4916 4978 5.469084 AGTTACCGAAATTTGAGAGACAACC 59.531 40.000 0.00 0.00 38.29 3.77
4917 4979 3.815809 ACCGAAATTTGAGAGACAACCA 58.184 40.909 0.00 0.00 38.29 3.67
4918 4980 4.204012 ACCGAAATTTGAGAGACAACCAA 58.796 39.130 0.00 0.00 38.29 3.67
4919 4981 4.827284 ACCGAAATTTGAGAGACAACCAAT 59.173 37.500 0.00 0.00 38.29 3.16
4920 4982 5.048713 ACCGAAATTTGAGAGACAACCAATC 60.049 40.000 0.00 0.00 38.29 2.67
4921 4983 5.048782 CCGAAATTTGAGAGACAACCAATCA 60.049 40.000 0.00 0.00 38.29 2.57
4922 4984 6.349611 CCGAAATTTGAGAGACAACCAATCAT 60.350 38.462 0.00 0.00 38.29 2.45
4923 4985 6.525628 CGAAATTTGAGAGACAACCAATCATG 59.474 38.462 0.00 0.00 38.29 3.07
4924 4986 6.906157 AATTTGAGAGACAACCAATCATGT 57.094 33.333 0.00 0.00 38.29 3.21
4925 4987 5.947228 TTTGAGAGACAACCAATCATGTC 57.053 39.130 0.00 0.00 44.92 3.06
4926 4988 4.622260 TGAGAGACAACCAATCATGTCA 57.378 40.909 8.43 0.00 46.55 3.58
4927 4989 4.971939 TGAGAGACAACCAATCATGTCAA 58.028 39.130 8.43 0.00 46.55 3.18
4928 4990 5.375773 TGAGAGACAACCAATCATGTCAAA 58.624 37.500 8.43 0.00 46.55 2.69
4929 4991 6.005823 TGAGAGACAACCAATCATGTCAAAT 58.994 36.000 8.43 0.00 46.55 2.32
4930 4992 7.167535 TGAGAGACAACCAATCATGTCAAATA 58.832 34.615 8.43 0.00 46.55 1.40
4931 4993 7.830697 TGAGAGACAACCAATCATGTCAAATAT 59.169 33.333 8.43 0.00 46.55 1.28
4932 4994 7.993101 AGAGACAACCAATCATGTCAAATATG 58.007 34.615 8.43 0.00 46.55 1.78
4933 4995 7.830697 AGAGACAACCAATCATGTCAAATATGA 59.169 33.333 8.43 0.00 46.55 2.15
4934 4996 8.529424 AGACAACCAATCATGTCAAATATGAT 57.471 30.769 8.43 0.00 46.55 2.45
4935 4997 9.631257 AGACAACCAATCATGTCAAATATGATA 57.369 29.630 8.43 0.00 46.55 2.15
4968 5030 9.545105 TTCAATTATTCCAAATAATGCATGTCC 57.455 29.630 0.00 0.00 0.00 4.02
4969 5031 8.702819 TCAATTATTCCAAATAATGCATGTCCA 58.297 29.630 0.00 0.00 0.00 4.02
4970 5032 9.496873 CAATTATTCCAAATAATGCATGTCCAT 57.503 29.630 0.00 0.00 0.00 3.41
4974 5036 7.658525 TTCCAAATAATGCATGTCCATTAGT 57.341 32.000 0.00 6.20 40.04 2.24
4975 5037 8.759481 TTCCAAATAATGCATGTCCATTAGTA 57.241 30.769 0.00 0.00 40.04 1.82
4976 5038 8.165239 TCCAAATAATGCATGTCCATTAGTAC 57.835 34.615 0.00 0.00 40.04 2.73
4977 5039 7.041440 TCCAAATAATGCATGTCCATTAGTACG 60.041 37.037 0.00 4.85 40.04 3.67
4978 5040 7.041440 CCAAATAATGCATGTCCATTAGTACGA 60.041 37.037 0.00 0.00 40.04 3.43
4979 5041 7.421530 AATAATGCATGTCCATTAGTACGAC 57.578 36.000 0.00 0.00 40.04 4.34
4980 5042 2.804647 TGCATGTCCATTAGTACGACG 58.195 47.619 0.00 0.00 0.00 5.12
4981 5043 2.124903 GCATGTCCATTAGTACGACGG 58.875 52.381 0.00 0.00 0.00 4.79
4982 5044 2.739292 CATGTCCATTAGTACGACGGG 58.261 52.381 0.00 0.00 0.00 5.28
4983 5045 1.105457 TGTCCATTAGTACGACGGGG 58.895 55.000 0.00 0.00 0.00 5.73
4984 5046 1.340893 TGTCCATTAGTACGACGGGGA 60.341 52.381 0.00 0.00 0.00 4.81
4985 5047 1.066152 GTCCATTAGTACGACGGGGAC 59.934 57.143 0.00 9.78 36.86 4.46
4986 5048 1.105457 CCATTAGTACGACGGGGACA 58.895 55.000 0.00 0.00 0.00 4.02
4987 5049 1.684983 CCATTAGTACGACGGGGACAT 59.315 52.381 0.00 0.00 0.00 3.06
4988 5050 2.545113 CCATTAGTACGACGGGGACATG 60.545 54.545 0.00 0.00 0.00 3.21
4989 5051 2.127271 TTAGTACGACGGGGACATGA 57.873 50.000 0.00 0.00 0.00 3.07
4990 5052 1.382522 TAGTACGACGGGGACATGAC 58.617 55.000 0.00 0.00 0.00 3.06
4991 5053 1.140375 GTACGACGGGGACATGACC 59.860 63.158 5.56 5.56 0.00 4.02
4992 5054 1.304299 TACGACGGGGACATGACCA 60.304 57.895 16.14 0.00 0.00 4.02
4993 5055 1.317431 TACGACGGGGACATGACCAG 61.317 60.000 16.14 12.19 0.00 4.00
4994 5056 2.348104 CGACGGGGACATGACCAGA 61.348 63.158 16.14 0.00 0.00 3.86
4995 5057 1.884075 CGACGGGGACATGACCAGAA 61.884 60.000 16.14 0.00 0.00 3.02
4996 5058 0.323629 GACGGGGACATGACCAGAAA 59.676 55.000 16.14 0.00 0.00 2.52
4997 5059 0.768622 ACGGGGACATGACCAGAAAA 59.231 50.000 16.14 0.00 0.00 2.29
4998 5060 1.271379 ACGGGGACATGACCAGAAAAG 60.271 52.381 16.14 3.08 0.00 2.27
4999 5061 1.839424 GGGGACATGACCAGAAAAGG 58.161 55.000 16.14 0.00 0.00 3.11
5000 5062 1.354368 GGGGACATGACCAGAAAAGGA 59.646 52.381 16.14 0.00 0.00 3.36
5001 5063 2.437413 GGGACATGACCAGAAAAGGAC 58.563 52.381 16.14 0.00 0.00 3.85
5002 5064 2.224769 GGGACATGACCAGAAAAGGACA 60.225 50.000 16.14 0.00 37.71 4.02
5003 5065 3.486383 GGACATGACCAGAAAAGGACAA 58.514 45.455 9.48 0.00 36.93 3.18
5004 5066 3.888930 GGACATGACCAGAAAAGGACAAA 59.111 43.478 9.48 0.00 36.93 2.83
5005 5067 4.261614 GGACATGACCAGAAAAGGACAAAC 60.262 45.833 9.48 0.00 36.93 2.93
5006 5068 3.636764 ACATGACCAGAAAAGGACAAACC 59.363 43.478 0.00 0.00 36.93 3.27
5007 5069 3.374042 TGACCAGAAAAGGACAAACCA 57.626 42.857 0.00 0.00 42.04 3.67
5008 5070 3.020984 TGACCAGAAAAGGACAAACCAC 58.979 45.455 0.00 0.00 42.04 4.16
5009 5071 2.021457 ACCAGAAAAGGACAAACCACG 58.979 47.619 0.00 0.00 42.04 4.94
5010 5072 2.021457 CCAGAAAAGGACAAACCACGT 58.979 47.619 0.00 0.00 42.04 4.49
5011 5073 2.425668 CCAGAAAAGGACAAACCACGTT 59.574 45.455 0.00 0.00 42.04 3.99
5012 5074 3.434637 CAGAAAAGGACAAACCACGTTG 58.565 45.455 0.00 0.00 42.04 4.10
5013 5075 3.127895 CAGAAAAGGACAAACCACGTTGA 59.872 43.478 0.00 0.00 42.04 3.18
5014 5076 3.377172 AGAAAAGGACAAACCACGTTGAG 59.623 43.478 0.00 0.00 42.04 3.02
5015 5077 2.702592 AAGGACAAACCACGTTGAGA 57.297 45.000 0.00 0.00 42.04 3.27
5016 5078 2.240493 AGGACAAACCACGTTGAGAG 57.760 50.000 0.00 0.00 42.04 3.20
5017 5079 1.485066 AGGACAAACCACGTTGAGAGT 59.515 47.619 0.00 0.00 42.04 3.24
5018 5080 1.597663 GGACAAACCACGTTGAGAGTG 59.402 52.381 0.00 0.00 38.79 3.51
5019 5081 2.546778 GACAAACCACGTTGAGAGTGA 58.453 47.619 0.00 0.00 41.83 3.41
5020 5082 2.540101 GACAAACCACGTTGAGAGTGAG 59.460 50.000 0.00 0.00 41.83 3.51
5021 5083 2.093658 ACAAACCACGTTGAGAGTGAGT 60.094 45.455 0.00 0.00 41.83 3.41
5022 5084 2.225068 AACCACGTTGAGAGTGAGTG 57.775 50.000 0.00 0.00 41.83 3.51
5023 5085 3.201342 CCACGTTGAGAGTGAGTGG 57.799 57.895 0.00 0.00 45.01 4.00
5024 5086 0.319900 CCACGTTGAGAGTGAGTGGG 60.320 60.000 5.12 0.00 46.15 4.61
5025 5087 0.673985 CACGTTGAGAGTGAGTGGGA 59.326 55.000 0.00 0.00 41.83 4.37
5026 5088 0.674534 ACGTTGAGAGTGAGTGGGAC 59.325 55.000 0.00 0.00 0.00 4.46
5027 5089 0.673985 CGTTGAGAGTGAGTGGGACA 59.326 55.000 0.00 0.00 0.00 4.02
5028 5090 1.273606 CGTTGAGAGTGAGTGGGACAT 59.726 52.381 0.00 0.00 44.52 3.06
5029 5091 2.492088 CGTTGAGAGTGAGTGGGACATA 59.508 50.000 0.00 0.00 44.52 2.29
5030 5092 3.056821 CGTTGAGAGTGAGTGGGACATAA 60.057 47.826 0.00 0.00 44.52 1.90
5031 5093 4.382040 CGTTGAGAGTGAGTGGGACATAAT 60.382 45.833 0.00 0.00 44.52 1.28
5032 5094 4.743057 TGAGAGTGAGTGGGACATAATG 57.257 45.455 0.00 0.00 44.52 1.90
5033 5095 3.118629 TGAGAGTGAGTGGGACATAATGC 60.119 47.826 0.00 0.00 44.52 3.56
5034 5096 3.110705 AGAGTGAGTGGGACATAATGCT 58.889 45.455 0.00 0.00 44.52 3.79
5035 5097 3.521126 AGAGTGAGTGGGACATAATGCTT 59.479 43.478 0.00 0.00 44.52 3.91
5036 5098 4.018960 AGAGTGAGTGGGACATAATGCTTT 60.019 41.667 0.00 0.00 44.52 3.51
5037 5099 5.189736 AGAGTGAGTGGGACATAATGCTTTA 59.810 40.000 0.00 0.00 44.52 1.85
5038 5100 6.006275 AGTGAGTGGGACATAATGCTTTAT 57.994 37.500 0.00 0.00 44.52 1.40
5039 5101 6.426587 AGTGAGTGGGACATAATGCTTTATT 58.573 36.000 2.22 0.00 44.52 1.40
5040 5102 7.573710 AGTGAGTGGGACATAATGCTTTATTA 58.426 34.615 2.22 0.00 44.52 0.98
5041 5103 8.220559 AGTGAGTGGGACATAATGCTTTATTAT 58.779 33.333 2.22 0.00 44.52 1.28
5056 5118 8.510243 TGCTTTATTATGCATATGGATAGGTG 57.490 34.615 15.46 8.13 33.94 4.00
5057 5119 8.328014 TGCTTTATTATGCATATGGATAGGTGA 58.672 33.333 15.46 3.37 33.94 4.02
5058 5120 9.177608 GCTTTATTATGCATATGGATAGGTGAA 57.822 33.333 15.46 10.99 30.10 3.18
5066 5128 8.681486 TGCATATGGATAGGTGAATATAATGC 57.319 34.615 4.56 0.00 0.00 3.56
5067 5129 8.273605 TGCATATGGATAGGTGAATATAATGCA 58.726 33.333 4.56 0.00 0.00 3.96
5068 5130 8.562892 GCATATGGATAGGTGAATATAATGCAC 58.437 37.037 4.56 0.00 0.00 4.57
5069 5131 9.842775 CATATGGATAGGTGAATATAATGCACT 57.157 33.333 0.00 0.00 33.25 4.40
5072 5134 8.664669 TGGATAGGTGAATATAATGCACTAGA 57.335 34.615 0.00 0.00 33.25 2.43
5073 5135 9.271921 TGGATAGGTGAATATAATGCACTAGAT 57.728 33.333 0.00 0.00 33.25 1.98
5088 5150 9.905713 AATGCACTAGATTAATAAGTGAAAGGA 57.094 29.630 24.49 7.82 42.59 3.36
5089 5151 9.905713 ATGCACTAGATTAATAAGTGAAAGGAA 57.094 29.630 24.49 9.70 42.59 3.36
5090 5152 9.733556 TGCACTAGATTAATAAGTGAAAGGAAA 57.266 29.630 24.49 6.56 42.59 3.13
5104 5166 8.237811 AGTGAAAGGAAAAATTAGAAAGAGCA 57.762 30.769 0.00 0.00 0.00 4.26
5105 5167 8.864087 AGTGAAAGGAAAAATTAGAAAGAGCAT 58.136 29.630 0.00 0.00 0.00 3.79
5106 5168 9.133627 GTGAAAGGAAAAATTAGAAAGAGCATC 57.866 33.333 0.00 0.00 0.00 3.91
5107 5169 8.023128 TGAAAGGAAAAATTAGAAAGAGCATCG 58.977 33.333 0.00 0.00 42.67 3.84
5108 5170 7.687941 AAGGAAAAATTAGAAAGAGCATCGA 57.312 32.000 0.00 0.00 42.67 3.59
5109 5171 7.078011 AGGAAAAATTAGAAAGAGCATCGAC 57.922 36.000 0.00 0.00 42.67 4.20
5110 5172 6.655003 AGGAAAAATTAGAAAGAGCATCGACA 59.345 34.615 0.00 0.00 42.67 4.35
5111 5173 7.174946 AGGAAAAATTAGAAAGAGCATCGACAA 59.825 33.333 0.00 0.00 42.67 3.18
5112 5174 7.271438 GGAAAAATTAGAAAGAGCATCGACAAC 59.729 37.037 0.00 0.00 42.67 3.32
5113 5175 6.801539 AAATTAGAAAGAGCATCGACAACA 57.198 33.333 0.00 0.00 42.67 3.33
5114 5176 5.786401 ATTAGAAAGAGCATCGACAACAC 57.214 39.130 0.00 0.00 42.67 3.32
5115 5177 3.393089 AGAAAGAGCATCGACAACACT 57.607 42.857 0.00 0.00 42.67 3.55
5116 5178 4.521130 AGAAAGAGCATCGACAACACTA 57.479 40.909 0.00 0.00 42.67 2.74
5117 5179 4.883083 AGAAAGAGCATCGACAACACTAA 58.117 39.130 0.00 0.00 42.67 2.24
5118 5180 5.297547 AGAAAGAGCATCGACAACACTAAA 58.702 37.500 0.00 0.00 42.67 1.85
5119 5181 5.758296 AGAAAGAGCATCGACAACACTAAAA 59.242 36.000 0.00 0.00 42.67 1.52
5120 5182 6.260050 AGAAAGAGCATCGACAACACTAAAAA 59.740 34.615 0.00 0.00 42.67 1.94
5139 5201 4.539509 AAAACTAAACGCATCGACAACA 57.460 36.364 0.00 0.00 0.00 3.33
5140 5202 3.515071 AACTAAACGCATCGACAACAC 57.485 42.857 0.00 0.00 0.00 3.32
5141 5203 2.750948 ACTAAACGCATCGACAACACT 58.249 42.857 0.00 0.00 0.00 3.55
5142 5204 2.729882 ACTAAACGCATCGACAACACTC 59.270 45.455 0.00 0.00 0.00 3.51
5143 5205 0.865769 AAACGCATCGACAACACTCC 59.134 50.000 0.00 0.00 0.00 3.85
5144 5206 0.949105 AACGCATCGACAACACTCCC 60.949 55.000 0.00 0.00 0.00 4.30
5145 5207 1.374125 CGCATCGACAACACTCCCA 60.374 57.895 0.00 0.00 0.00 4.37
5146 5208 1.354337 CGCATCGACAACACTCCCAG 61.354 60.000 0.00 0.00 0.00 4.45
5147 5209 1.639298 GCATCGACAACACTCCCAGC 61.639 60.000 0.00 0.00 0.00 4.85
5148 5210 0.320683 CATCGACAACACTCCCAGCA 60.321 55.000 0.00 0.00 0.00 4.41
5149 5211 0.396435 ATCGACAACACTCCCAGCAA 59.604 50.000 0.00 0.00 0.00 3.91
5150 5212 0.396435 TCGACAACACTCCCAGCAAT 59.604 50.000 0.00 0.00 0.00 3.56
5151 5213 0.518636 CGACAACACTCCCAGCAATG 59.481 55.000 0.00 0.00 0.00 2.82
5152 5214 1.609208 GACAACACTCCCAGCAATGT 58.391 50.000 0.00 0.00 0.00 2.71
5153 5215 2.778299 GACAACACTCCCAGCAATGTA 58.222 47.619 0.00 0.00 0.00 2.29
5154 5216 2.744202 GACAACACTCCCAGCAATGTAG 59.256 50.000 0.00 0.00 0.00 2.74
5155 5217 2.086869 CAACACTCCCAGCAATGTAGG 58.913 52.381 0.00 0.00 0.00 3.18
5156 5218 1.362224 ACACTCCCAGCAATGTAGGT 58.638 50.000 0.00 0.00 0.00 3.08
5157 5219 1.003580 ACACTCCCAGCAATGTAGGTG 59.996 52.381 0.00 0.00 36.79 4.00
5162 5224 3.955145 CAGCAATGTAGGTGGTGGA 57.045 52.632 0.00 0.00 40.10 4.02
5163 5225 1.742761 CAGCAATGTAGGTGGTGGAG 58.257 55.000 0.00 0.00 40.10 3.86
5164 5226 1.278985 CAGCAATGTAGGTGGTGGAGA 59.721 52.381 0.00 0.00 40.10 3.71
5165 5227 1.985159 AGCAATGTAGGTGGTGGAGAA 59.015 47.619 0.00 0.00 0.00 2.87
5166 5228 2.375174 AGCAATGTAGGTGGTGGAGAAA 59.625 45.455 0.00 0.00 0.00 2.52
5167 5229 3.010584 AGCAATGTAGGTGGTGGAGAAAT 59.989 43.478 0.00 0.00 0.00 2.17
5168 5230 3.378427 GCAATGTAGGTGGTGGAGAAATC 59.622 47.826 0.00 0.00 0.00 2.17
5169 5231 4.588899 CAATGTAGGTGGTGGAGAAATCA 58.411 43.478 0.00 0.00 0.00 2.57
5170 5232 5.195940 CAATGTAGGTGGTGGAGAAATCAT 58.804 41.667 0.00 0.00 0.00 2.45
5171 5233 4.220693 TGTAGGTGGTGGAGAAATCATG 57.779 45.455 0.00 0.00 0.00 3.07
5172 5234 3.587061 TGTAGGTGGTGGAGAAATCATGT 59.413 43.478 0.00 0.00 0.00 3.21
5173 5235 4.780554 TGTAGGTGGTGGAGAAATCATGTA 59.219 41.667 0.00 0.00 0.00 2.29
5174 5236 5.428457 TGTAGGTGGTGGAGAAATCATGTAT 59.572 40.000 0.00 0.00 0.00 2.29
5175 5237 5.041191 AGGTGGTGGAGAAATCATGTATC 57.959 43.478 0.00 0.00 0.00 2.24
5176 5238 4.474651 AGGTGGTGGAGAAATCATGTATCA 59.525 41.667 0.00 0.00 0.00 2.15
5177 5239 4.576463 GGTGGTGGAGAAATCATGTATCAC 59.424 45.833 0.00 0.00 0.00 3.06
5178 5240 5.431765 GTGGTGGAGAAATCATGTATCACT 58.568 41.667 0.00 0.00 0.00 3.41
5179 5241 5.882557 GTGGTGGAGAAATCATGTATCACTT 59.117 40.000 0.00 0.00 0.00 3.16
5180 5242 6.375455 GTGGTGGAGAAATCATGTATCACTTT 59.625 38.462 0.00 0.00 0.00 2.66
5181 5243 6.947733 TGGTGGAGAAATCATGTATCACTTTT 59.052 34.615 0.00 0.00 0.00 2.27
5182 5244 7.451255 TGGTGGAGAAATCATGTATCACTTTTT 59.549 33.333 0.00 0.00 0.00 1.94
5183 5245 7.756722 GGTGGAGAAATCATGTATCACTTTTTG 59.243 37.037 0.00 0.00 0.00 2.44
5184 5246 8.514594 GTGGAGAAATCATGTATCACTTTTTGA 58.485 33.333 0.00 0.00 39.11 2.69
5185 5247 8.514594 TGGAGAAATCATGTATCACTTTTTGAC 58.485 33.333 0.00 0.00 36.92 3.18
5186 5248 8.514594 GGAGAAATCATGTATCACTTTTTGACA 58.485 33.333 0.00 0.00 36.92 3.58
5187 5249 9.334693 GAGAAATCATGTATCACTTTTTGACAC 57.665 33.333 0.00 0.00 36.92 3.67
5188 5250 8.017373 AGAAATCATGTATCACTTTTTGACACG 58.983 33.333 0.00 0.00 33.97 4.49
5189 5251 7.433708 AATCATGTATCACTTTTTGACACGA 57.566 32.000 0.00 0.00 33.97 4.35
5190 5252 6.466308 TCATGTATCACTTTTTGACACGAG 57.534 37.500 0.00 0.00 33.97 4.18
5191 5253 4.725556 TGTATCACTTTTTGACACGAGC 57.274 40.909 0.00 0.00 33.97 5.03
5192 5254 4.123506 TGTATCACTTTTTGACACGAGCA 58.876 39.130 0.00 0.00 33.97 4.26
5193 5255 4.572795 TGTATCACTTTTTGACACGAGCAA 59.427 37.500 0.00 0.00 33.97 3.91
5194 5256 4.836125 ATCACTTTTTGACACGAGCAAT 57.164 36.364 0.00 0.00 36.92 3.56
5195 5257 5.940192 ATCACTTTTTGACACGAGCAATA 57.060 34.783 0.00 0.00 36.92 1.90
5196 5258 5.940192 TCACTTTTTGACACGAGCAATAT 57.060 34.783 0.00 0.00 0.00 1.28
5197 5259 7.609760 ATCACTTTTTGACACGAGCAATATA 57.390 32.000 0.00 0.00 36.92 0.86
5198 5260 7.609760 TCACTTTTTGACACGAGCAATATAT 57.390 32.000 0.00 0.00 0.00 0.86
5199 5261 8.710835 TCACTTTTTGACACGAGCAATATATA 57.289 30.769 0.00 0.00 0.00 0.86
5200 5262 9.325198 TCACTTTTTGACACGAGCAATATATAT 57.675 29.630 0.00 0.00 0.00 0.86
5201 5263 9.935682 CACTTTTTGACACGAGCAATATATATT 57.064 29.630 1.91 1.91 0.00 1.28
5206 5268 9.489084 TTTGACACGAGCAATATATATTTAGCT 57.511 29.630 16.28 16.28 30.49 3.32
5207 5269 9.489084 TTGACACGAGCAATATATATTTAGCTT 57.511 29.630 17.02 5.88 28.71 3.74
5338 5400 9.547279 AATTCACCCTTCTTTACATAGGAAATT 57.453 29.630 0.00 0.00 0.00 1.82
5339 5401 7.938140 TCACCCTTCTTTACATAGGAAATTG 57.062 36.000 0.00 0.00 0.00 2.32
5340 5402 6.889722 TCACCCTTCTTTACATAGGAAATTGG 59.110 38.462 0.00 0.00 0.00 3.16
5341 5403 6.889722 CACCCTTCTTTACATAGGAAATTGGA 59.110 38.462 0.00 0.00 0.00 3.53
5342 5404 7.396055 CACCCTTCTTTACATAGGAAATTGGAA 59.604 37.037 0.00 0.00 0.00 3.53
5343 5405 8.122481 ACCCTTCTTTACATAGGAAATTGGAAT 58.878 33.333 0.00 0.00 0.00 3.01
5344 5406 8.981659 CCCTTCTTTACATAGGAAATTGGAATT 58.018 33.333 0.00 0.00 0.00 2.17
5345 5407 9.807649 CCTTCTTTACATAGGAAATTGGAATTG 57.192 33.333 0.00 0.00 0.00 2.32
5346 5408 9.807649 CTTCTTTACATAGGAAATTGGAATTGG 57.192 33.333 0.00 0.00 0.00 3.16
5347 5409 9.540538 TTCTTTACATAGGAAATTGGAATTGGA 57.459 29.630 0.00 0.00 0.00 3.53
5348 5410 8.966868 TCTTTACATAGGAAATTGGAATTGGAC 58.033 33.333 0.00 0.00 0.00 4.02
5349 5411 8.657387 TTTACATAGGAAATTGGAATTGGACA 57.343 30.769 0.00 0.00 0.00 4.02
5350 5412 6.780457 ACATAGGAAATTGGAATTGGACAG 57.220 37.500 0.00 0.00 0.00 3.51
5351 5413 6.256053 ACATAGGAAATTGGAATTGGACAGT 58.744 36.000 0.00 0.00 0.00 3.55
5352 5414 6.378280 ACATAGGAAATTGGAATTGGACAGTC 59.622 38.462 0.00 0.00 0.00 3.51
5353 5415 5.003096 AGGAAATTGGAATTGGACAGTCT 57.997 39.130 0.00 0.00 0.00 3.24
5354 5416 4.768968 AGGAAATTGGAATTGGACAGTCTG 59.231 41.667 0.00 0.00 0.00 3.51
5355 5417 4.766891 GGAAATTGGAATTGGACAGTCTGA 59.233 41.667 6.91 0.00 0.00 3.27
5356 5418 5.105997 GGAAATTGGAATTGGACAGTCTGAG 60.106 44.000 6.91 0.00 0.00 3.35
5357 5419 4.916041 ATTGGAATTGGACAGTCTGAGA 57.084 40.909 6.91 0.00 0.00 3.27
5358 5420 4.705110 TTGGAATTGGACAGTCTGAGAA 57.295 40.909 6.91 0.00 0.00 2.87
5359 5421 4.705110 TGGAATTGGACAGTCTGAGAAA 57.295 40.909 6.91 0.00 0.00 2.52
5360 5422 5.246981 TGGAATTGGACAGTCTGAGAAAT 57.753 39.130 6.91 0.23 0.00 2.17
5361 5423 6.373005 TGGAATTGGACAGTCTGAGAAATA 57.627 37.500 6.91 0.00 0.00 1.40
5362 5424 6.409704 TGGAATTGGACAGTCTGAGAAATAG 58.590 40.000 6.91 0.00 0.00 1.73
5363 5425 5.819901 GGAATTGGACAGTCTGAGAAATAGG 59.180 44.000 6.91 0.00 0.00 2.57
5364 5426 6.380079 AATTGGACAGTCTGAGAAATAGGT 57.620 37.500 6.91 0.00 0.00 3.08
5365 5427 5.407407 TTGGACAGTCTGAGAAATAGGTC 57.593 43.478 6.91 0.00 0.00 3.85
5366 5428 4.416516 TGGACAGTCTGAGAAATAGGTCA 58.583 43.478 6.91 0.00 0.00 4.02
5367 5429 5.026121 TGGACAGTCTGAGAAATAGGTCAT 58.974 41.667 6.91 0.00 0.00 3.06
5368 5430 5.485353 TGGACAGTCTGAGAAATAGGTCATT 59.515 40.000 6.91 0.00 0.00 2.57
5369 5431 6.013379 TGGACAGTCTGAGAAATAGGTCATTT 60.013 38.462 6.91 0.00 39.63 2.32
5370 5432 6.314896 GGACAGTCTGAGAAATAGGTCATTTG 59.685 42.308 6.91 0.00 36.96 2.32
5371 5433 6.773638 ACAGTCTGAGAAATAGGTCATTTGT 58.226 36.000 6.91 0.00 36.96 2.83
5372 5434 7.227156 ACAGTCTGAGAAATAGGTCATTTGTT 58.773 34.615 6.91 0.00 36.96 2.83
5373 5435 7.721399 ACAGTCTGAGAAATAGGTCATTTGTTT 59.279 33.333 6.91 0.00 36.96 2.83
5374 5436 8.571336 CAGTCTGAGAAATAGGTCATTTGTTTT 58.429 33.333 0.00 0.00 36.96 2.43
5375 5437 9.793259 AGTCTGAGAAATAGGTCATTTGTTTTA 57.207 29.630 0.00 0.00 36.96 1.52
5385 5447 9.975218 ATAGGTCATTTGTTTTATTCTACAGGT 57.025 29.630 0.00 0.00 0.00 4.00
5386 5448 8.110860 AGGTCATTTGTTTTATTCTACAGGTG 57.889 34.615 0.00 0.00 0.00 4.00
5387 5449 7.176690 AGGTCATTTGTTTTATTCTACAGGTGG 59.823 37.037 0.00 0.00 0.00 4.61
5388 5450 7.175990 GGTCATTTGTTTTATTCTACAGGTGGA 59.824 37.037 0.00 0.00 0.00 4.02
5389 5451 8.739972 GTCATTTGTTTTATTCTACAGGTGGAT 58.260 33.333 0.00 0.00 0.00 3.41
5390 5452 8.956426 TCATTTGTTTTATTCTACAGGTGGATC 58.044 33.333 0.00 0.00 0.00 3.36
5391 5453 8.739039 CATTTGTTTTATTCTACAGGTGGATCA 58.261 33.333 0.00 0.00 0.00 2.92
5392 5454 8.698973 TTTGTTTTATTCTACAGGTGGATCAA 57.301 30.769 0.00 0.00 0.00 2.57
5393 5455 7.921786 TGTTTTATTCTACAGGTGGATCAAG 57.078 36.000 0.00 0.00 0.00 3.02
5394 5456 7.685481 TGTTTTATTCTACAGGTGGATCAAGA 58.315 34.615 0.00 0.00 0.00 3.02
5395 5457 8.160765 TGTTTTATTCTACAGGTGGATCAAGAA 58.839 33.333 0.00 0.00 0.00 2.52
5396 5458 9.178758 GTTTTATTCTACAGGTGGATCAAGAAT 57.821 33.333 0.00 0.00 37.43 2.40
5398 5460 9.832445 TTTATTCTACAGGTGGATCAAGAATAC 57.168 33.333 0.00 0.00 36.29 1.89
5399 5461 6.867519 TTCTACAGGTGGATCAAGAATACA 57.132 37.500 0.00 0.00 0.00 2.29
5400 5462 6.867519 TCTACAGGTGGATCAAGAATACAA 57.132 37.500 0.00 0.00 26.83 2.41
5401 5463 6.640518 TCTACAGGTGGATCAAGAATACAAC 58.359 40.000 0.00 0.00 35.96 3.32
5403 5465 5.491982 ACAGGTGGATCAAGAATACAACTC 58.508 41.667 0.00 0.00 43.26 3.01
5404 5466 5.013079 ACAGGTGGATCAAGAATACAACTCA 59.987 40.000 0.00 0.00 43.26 3.41
5405 5467 5.939883 CAGGTGGATCAAGAATACAACTCAA 59.060 40.000 0.00 0.00 43.26 3.02
5406 5468 6.600822 CAGGTGGATCAAGAATACAACTCAAT 59.399 38.462 0.00 0.00 43.26 2.57
5407 5469 7.121759 CAGGTGGATCAAGAATACAACTCAATT 59.878 37.037 0.00 0.00 43.26 2.32
5408 5470 7.671398 AGGTGGATCAAGAATACAACTCAATTT 59.329 33.333 0.00 0.00 43.26 1.82
5409 5471 7.756722 GGTGGATCAAGAATACAACTCAATTTG 59.243 37.037 0.00 0.00 32.55 2.32
5410 5472 7.756722 GTGGATCAAGAATACAACTCAATTTGG 59.243 37.037 0.00 0.00 26.83 3.28
5411 5473 7.451255 TGGATCAAGAATACAACTCAATTTGGT 59.549 33.333 0.00 0.00 0.00 3.67
5412 5474 8.956426 GGATCAAGAATACAACTCAATTTGGTA 58.044 33.333 0.00 0.00 0.00 3.25
5423 5485 8.950210 ACAACTCAATTTGGTATACTGAGATTG 58.050 33.333 20.14 19.52 37.53 2.67
5424 5486 8.400947 CAACTCAATTTGGTATACTGAGATTGG 58.599 37.037 20.14 12.03 37.53 3.16
5425 5487 7.861629 ACTCAATTTGGTATACTGAGATTGGA 58.138 34.615 20.14 7.66 37.53 3.53
5426 5488 7.989741 ACTCAATTTGGTATACTGAGATTGGAG 59.010 37.037 20.14 14.76 37.53 3.86
5427 5489 7.861629 TCAATTTGGTATACTGAGATTGGAGT 58.138 34.615 2.25 0.00 0.00 3.85
5428 5490 8.988060 TCAATTTGGTATACTGAGATTGGAGTA 58.012 33.333 2.25 0.00 0.00 2.59
5429 5491 9.613428 CAATTTGGTATACTGAGATTGGAGTAA 57.387 33.333 2.25 0.00 0.00 2.24
5434 5496 9.090103 TGGTATACTGAGATTGGAGTAATAAGG 57.910 37.037 2.25 0.00 0.00 2.69
5435 5497 9.310449 GGTATACTGAGATTGGAGTAATAAGGA 57.690 37.037 2.25 0.00 0.00 3.36
5438 5500 7.130681 ACTGAGATTGGAGTAATAAGGAAGG 57.869 40.000 0.00 0.00 0.00 3.46
5439 5501 6.903534 ACTGAGATTGGAGTAATAAGGAAGGA 59.096 38.462 0.00 0.00 0.00 3.36
5440 5502 7.403231 ACTGAGATTGGAGTAATAAGGAAGGAA 59.597 37.037 0.00 0.00 0.00 3.36
5441 5503 8.158025 TGAGATTGGAGTAATAAGGAAGGAAA 57.842 34.615 0.00 0.00 0.00 3.13
5442 5504 8.611257 TGAGATTGGAGTAATAAGGAAGGAAAA 58.389 33.333 0.00 0.00 0.00 2.29
5443 5505 9.462606 GAGATTGGAGTAATAAGGAAGGAAAAA 57.537 33.333 0.00 0.00 0.00 1.94
5444 5506 9.997172 AGATTGGAGTAATAAGGAAGGAAAAAT 57.003 29.630 0.00 0.00 0.00 1.82
5447 5509 8.726870 TGGAGTAATAAGGAAGGAAAAATACG 57.273 34.615 0.00 0.00 0.00 3.06
5448 5510 7.281549 TGGAGTAATAAGGAAGGAAAAATACGC 59.718 37.037 0.00 0.00 0.00 4.42
5449 5511 7.255035 GGAGTAATAAGGAAGGAAAAATACGCC 60.255 40.741 0.00 0.00 0.00 5.68
5450 5512 7.114095 AGTAATAAGGAAGGAAAAATACGCCA 58.886 34.615 0.00 0.00 0.00 5.69
5451 5513 6.451064 AATAAGGAAGGAAAAATACGCCAG 57.549 37.500 0.00 0.00 0.00 4.85
5452 5514 3.713826 AGGAAGGAAAAATACGCCAGA 57.286 42.857 0.00 0.00 0.00 3.86
5453 5515 4.028993 AGGAAGGAAAAATACGCCAGAA 57.971 40.909 0.00 0.00 0.00 3.02
5454 5516 3.756963 AGGAAGGAAAAATACGCCAGAAC 59.243 43.478 0.00 0.00 0.00 3.01
5455 5517 3.756963 GGAAGGAAAAATACGCCAGAACT 59.243 43.478 0.00 0.00 0.00 3.01
5456 5518 4.939439 GGAAGGAAAAATACGCCAGAACTA 59.061 41.667 0.00 0.00 0.00 2.24
5457 5519 5.413523 GGAAGGAAAAATACGCCAGAACTAA 59.586 40.000 0.00 0.00 0.00 2.24
5458 5520 6.095021 GGAAGGAAAAATACGCCAGAACTAAT 59.905 38.462 0.00 0.00 0.00 1.73
5459 5521 7.281549 GGAAGGAAAAATACGCCAGAACTAATA 59.718 37.037 0.00 0.00 0.00 0.98
5460 5522 8.570068 AAGGAAAAATACGCCAGAACTAATAA 57.430 30.769 0.00 0.00 0.00 1.40
5461 5523 8.570068 AGGAAAAATACGCCAGAACTAATAAA 57.430 30.769 0.00 0.00 0.00 1.40
5462 5524 9.185680 AGGAAAAATACGCCAGAACTAATAAAT 57.814 29.630 0.00 0.00 0.00 1.40
5527 5589 8.523915 TGTATTCTTTTTCATATGCTCATGGT 57.476 30.769 0.00 0.00 0.00 3.55
5528 5590 8.970020 TGTATTCTTTTTCATATGCTCATGGTT 58.030 29.630 0.00 0.00 0.00 3.67
5529 5591 9.807649 GTATTCTTTTTCATATGCTCATGGTTT 57.192 29.630 0.00 0.00 0.00 3.27
5530 5592 8.712285 ATTCTTTTTCATATGCTCATGGTTTG 57.288 30.769 0.00 0.00 0.00 2.93
5531 5593 7.230849 TCTTTTTCATATGCTCATGGTTTGT 57.769 32.000 0.00 0.00 0.00 2.83
5532 5594 7.669427 TCTTTTTCATATGCTCATGGTTTGTT 58.331 30.769 0.00 0.00 0.00 2.83
5533 5595 7.599621 TCTTTTTCATATGCTCATGGTTTGTTG 59.400 33.333 0.00 0.00 0.00 3.33
5534 5596 6.587206 TTTCATATGCTCATGGTTTGTTGA 57.413 33.333 0.00 0.00 0.00 3.18
5535 5597 6.587206 TTCATATGCTCATGGTTTGTTGAA 57.413 33.333 0.00 0.00 0.00 2.69
5536 5598 6.587206 TCATATGCTCATGGTTTGTTGAAA 57.413 33.333 0.00 0.00 0.00 2.69
5537 5599 6.990798 TCATATGCTCATGGTTTGTTGAAAA 58.009 32.000 0.00 0.00 0.00 2.29
5538 5600 7.440198 TCATATGCTCATGGTTTGTTGAAAAA 58.560 30.769 0.00 0.00 0.00 1.94
5539 5601 8.095792 TCATATGCTCATGGTTTGTTGAAAAAT 58.904 29.630 0.00 0.00 0.00 1.82
5540 5602 8.723311 CATATGCTCATGGTTTGTTGAAAAATT 58.277 29.630 0.00 0.00 0.00 1.82
5541 5603 6.601741 TGCTCATGGTTTGTTGAAAAATTC 57.398 33.333 0.00 0.00 0.00 2.17
5542 5604 6.347696 TGCTCATGGTTTGTTGAAAAATTCT 58.652 32.000 0.00 0.00 0.00 2.40
5543 5605 6.258287 TGCTCATGGTTTGTTGAAAAATTCTG 59.742 34.615 0.00 0.00 0.00 3.02
5544 5606 6.293027 GCTCATGGTTTGTTGAAAAATTCTGG 60.293 38.462 0.00 0.00 0.00 3.86
5545 5607 6.054295 TCATGGTTTGTTGAAAAATTCTGGG 58.946 36.000 0.00 0.00 0.00 4.45
5546 5608 4.195416 TGGTTTGTTGAAAAATTCTGGGC 58.805 39.130 0.00 0.00 0.00 5.36
5547 5609 4.080638 TGGTTTGTTGAAAAATTCTGGGCT 60.081 37.500 0.00 0.00 0.00 5.19
5548 5610 4.273235 GGTTTGTTGAAAAATTCTGGGCTG 59.727 41.667 0.00 0.00 0.00 4.85
5549 5611 4.751767 TTGTTGAAAAATTCTGGGCTGT 57.248 36.364 0.00 0.00 0.00 4.40
5550 5612 4.320608 TGTTGAAAAATTCTGGGCTGTC 57.679 40.909 0.00 0.00 0.00 3.51
5551 5613 3.703556 TGTTGAAAAATTCTGGGCTGTCA 59.296 39.130 0.00 0.00 0.00 3.58
5552 5614 4.344679 TGTTGAAAAATTCTGGGCTGTCAT 59.655 37.500 0.00 0.00 0.00 3.06
5553 5615 4.524316 TGAAAAATTCTGGGCTGTCATG 57.476 40.909 0.00 0.00 0.00 3.07
5554 5616 4.151121 TGAAAAATTCTGGGCTGTCATGA 58.849 39.130 0.00 0.00 0.00 3.07
5555 5617 4.773674 TGAAAAATTCTGGGCTGTCATGAT 59.226 37.500 0.00 0.00 0.00 2.45
5556 5618 5.951148 TGAAAAATTCTGGGCTGTCATGATA 59.049 36.000 0.00 0.00 0.00 2.15
5557 5619 6.608405 TGAAAAATTCTGGGCTGTCATGATAT 59.392 34.615 0.00 0.00 0.00 1.63
5558 5620 7.779326 TGAAAAATTCTGGGCTGTCATGATATA 59.221 33.333 0.00 0.00 0.00 0.86
5559 5621 8.716674 AAAAATTCTGGGCTGTCATGATATAT 57.283 30.769 0.00 0.00 0.00 0.86
5560 5622 7.934855 AAATTCTGGGCTGTCATGATATATC 57.065 36.000 5.73 5.73 0.00 1.63
5561 5623 6.631763 ATTCTGGGCTGTCATGATATATCA 57.368 37.500 17.56 17.56 41.70 2.15
5636 5698 7.703058 TTAGATATCTAGACATCGGATTGCA 57.297 36.000 12.16 0.00 0.00 4.08
5637 5699 6.596309 AGATATCTAGACATCGGATTGCAA 57.404 37.500 2.53 0.00 0.00 4.08
5638 5700 6.629128 AGATATCTAGACATCGGATTGCAAG 58.371 40.000 2.53 0.00 0.00 4.01
5639 5701 4.944619 ATCTAGACATCGGATTGCAAGA 57.055 40.909 4.94 0.00 0.00 3.02
5640 5702 4.736126 TCTAGACATCGGATTGCAAGAA 57.264 40.909 4.94 0.00 0.00 2.52
5641 5703 4.686972 TCTAGACATCGGATTGCAAGAAG 58.313 43.478 4.94 0.00 0.00 2.85
5642 5704 3.340814 AGACATCGGATTGCAAGAAGT 57.659 42.857 4.94 0.00 0.00 3.01
5643 5705 3.679389 AGACATCGGATTGCAAGAAGTT 58.321 40.909 4.94 0.00 0.00 2.66
5644 5706 4.074970 AGACATCGGATTGCAAGAAGTTT 58.925 39.130 4.94 0.00 0.00 2.66
5645 5707 4.154918 AGACATCGGATTGCAAGAAGTTTC 59.845 41.667 4.94 0.00 0.00 2.78
5646 5708 4.074970 ACATCGGATTGCAAGAAGTTTCT 58.925 39.130 4.94 0.00 39.74 2.52
5647 5709 4.154918 ACATCGGATTGCAAGAAGTTTCTC 59.845 41.667 4.94 0.00 36.28 2.87
5648 5710 4.008074 TCGGATTGCAAGAAGTTTCTCT 57.992 40.909 4.94 0.00 36.28 3.10
5649 5711 3.997021 TCGGATTGCAAGAAGTTTCTCTC 59.003 43.478 4.94 0.00 36.28 3.20
5650 5712 3.126000 CGGATTGCAAGAAGTTTCTCTCC 59.874 47.826 4.94 1.66 36.28 3.71
5651 5713 4.331108 GGATTGCAAGAAGTTTCTCTCCT 58.669 43.478 4.94 0.00 36.28 3.69
5652 5714 4.764308 GGATTGCAAGAAGTTTCTCTCCTT 59.236 41.667 4.94 0.00 36.28 3.36
5653 5715 5.940470 GGATTGCAAGAAGTTTCTCTCCTTA 59.060 40.000 4.94 0.00 36.28 2.69
5654 5716 6.093357 GGATTGCAAGAAGTTTCTCTCCTTAG 59.907 42.308 4.94 0.00 36.28 2.18
5655 5717 5.808366 TGCAAGAAGTTTCTCTCCTTAGA 57.192 39.130 0.00 0.00 36.28 2.10
5656 5718 6.365970 TGCAAGAAGTTTCTCTCCTTAGAT 57.634 37.500 0.00 0.00 36.28 1.98
5657 5719 6.169094 TGCAAGAAGTTTCTCTCCTTAGATG 58.831 40.000 0.00 0.00 36.28 2.90
5658 5720 6.014242 TGCAAGAAGTTTCTCTCCTTAGATGA 60.014 38.462 0.00 0.00 36.28 2.92
5659 5721 6.876257 GCAAGAAGTTTCTCTCCTTAGATGAA 59.124 38.462 0.00 0.00 36.28 2.57
5660 5722 7.064490 GCAAGAAGTTTCTCTCCTTAGATGAAG 59.936 40.741 0.00 0.00 36.28 3.02
5661 5723 8.310382 CAAGAAGTTTCTCTCCTTAGATGAAGA 58.690 37.037 0.00 0.00 35.16 2.87
5662 5724 8.429237 AGAAGTTTCTCTCCTTAGATGAAGAA 57.571 34.615 0.00 0.00 32.35 2.52
5663 5725 8.311109 AGAAGTTTCTCTCCTTAGATGAAGAAC 58.689 37.037 0.00 0.00 32.35 3.01
5664 5726 7.546250 AGTTTCTCTCCTTAGATGAAGAACA 57.454 36.000 0.00 0.00 37.33 3.18
5665 5727 7.382898 AGTTTCTCTCCTTAGATGAAGAACAC 58.617 38.462 0.00 0.00 37.33 3.32
5666 5728 7.234577 AGTTTCTCTCCTTAGATGAAGAACACT 59.765 37.037 0.00 0.00 37.33 3.55
5667 5729 8.524487 GTTTCTCTCCTTAGATGAAGAACACTA 58.476 37.037 0.00 0.00 37.33 2.74
5668 5730 8.830915 TTCTCTCCTTAGATGAAGAACACTAT 57.169 34.615 0.00 0.00 37.33 2.12
5669 5731 8.830915 TCTCTCCTTAGATGAAGAACACTATT 57.169 34.615 0.00 0.00 37.33 1.73
5670 5732 9.922477 TCTCTCCTTAGATGAAGAACACTATTA 57.078 33.333 0.00 0.00 37.33 0.98
5686 5748 8.732746 AACACTATTATGTTCTTCGGCTAATT 57.267 30.769 0.00 0.00 38.44 1.40
5687 5749 8.732746 ACACTATTATGTTCTTCGGCTAATTT 57.267 30.769 0.00 0.00 0.00 1.82
5688 5750 9.174166 ACACTATTATGTTCTTCGGCTAATTTT 57.826 29.630 0.00 0.00 0.00 1.82
5689 5751 9.438291 CACTATTATGTTCTTCGGCTAATTTTG 57.562 33.333 0.00 0.00 0.00 2.44
5690 5752 9.174166 ACTATTATGTTCTTCGGCTAATTTTGT 57.826 29.630 0.00 0.00 0.00 2.83
5693 5755 8.556213 TTATGTTCTTCGGCTAATTTTGTACT 57.444 30.769 0.00 0.00 0.00 2.73
5694 5756 9.656040 TTATGTTCTTCGGCTAATTTTGTACTA 57.344 29.630 0.00 0.00 0.00 1.82
5695 5757 7.591006 TGTTCTTCGGCTAATTTTGTACTAG 57.409 36.000 0.00 0.00 0.00 2.57
5696 5758 6.091713 TGTTCTTCGGCTAATTTTGTACTAGC 59.908 38.462 3.14 3.14 37.84 3.42
5697 5759 5.726397 TCTTCGGCTAATTTTGTACTAGCA 58.274 37.500 11.77 0.00 39.88 3.49
5698 5760 6.167685 TCTTCGGCTAATTTTGTACTAGCAA 58.832 36.000 11.77 0.57 39.88 3.91
5699 5761 6.821665 TCTTCGGCTAATTTTGTACTAGCAAT 59.178 34.615 11.77 0.00 39.88 3.56
5700 5762 6.358118 TCGGCTAATTTTGTACTAGCAATG 57.642 37.500 11.77 3.38 39.88 2.82
5701 5763 6.110033 TCGGCTAATTTTGTACTAGCAATGA 58.890 36.000 11.77 5.19 39.88 2.57
5702 5764 6.257849 TCGGCTAATTTTGTACTAGCAATGAG 59.742 38.462 11.77 0.00 39.88 2.90
5703 5765 6.202226 GGCTAATTTTGTACTAGCAATGAGC 58.798 40.000 11.77 7.62 39.88 4.26
5718 5780 6.907206 GCAATGAGCCATGCTTTTATTAAA 57.093 33.333 0.00 0.00 39.88 1.52
5719 5781 6.708676 GCAATGAGCCATGCTTTTATTAAAC 58.291 36.000 0.00 0.00 39.88 2.01
5720 5782 6.536224 GCAATGAGCCATGCTTTTATTAAACT 59.464 34.615 0.00 0.00 39.88 2.66
5721 5783 7.706179 GCAATGAGCCATGCTTTTATTAAACTA 59.294 33.333 0.00 0.00 39.88 2.24
5722 5784 9.585099 CAATGAGCCATGCTTTTATTAAACTAA 57.415 29.630 0.00 0.00 39.88 2.24
5772 5834 7.485418 TTTTTAACGCAGACAGTCTAAATCA 57.515 32.000 1.67 0.00 0.00 2.57
5773 5835 7.667043 TTTTAACGCAGACAGTCTAAATCAT 57.333 32.000 1.67 0.00 0.00 2.45
5774 5836 6.647212 TTAACGCAGACAGTCTAAATCATG 57.353 37.500 1.67 0.00 0.00 3.07
5775 5837 2.932614 ACGCAGACAGTCTAAATCATGC 59.067 45.455 1.67 0.52 0.00 4.06
5776 5838 2.931969 CGCAGACAGTCTAAATCATGCA 59.068 45.455 1.67 0.00 32.79 3.96
5777 5839 3.242220 CGCAGACAGTCTAAATCATGCAC 60.242 47.826 1.67 0.00 32.79 4.57
5778 5840 3.064545 GCAGACAGTCTAAATCATGCACC 59.935 47.826 1.67 0.00 32.79 5.01
5779 5841 4.511527 CAGACAGTCTAAATCATGCACCT 58.488 43.478 1.67 0.00 0.00 4.00
5780 5842 4.569966 CAGACAGTCTAAATCATGCACCTC 59.430 45.833 1.67 0.00 0.00 3.85
5781 5843 4.223700 AGACAGTCTAAATCATGCACCTCA 59.776 41.667 0.00 0.00 0.00 3.86
5782 5844 4.910195 ACAGTCTAAATCATGCACCTCAA 58.090 39.130 0.00 0.00 0.00 3.02
5783 5845 4.940046 ACAGTCTAAATCATGCACCTCAAG 59.060 41.667 0.00 0.00 0.00 3.02
5784 5846 3.944015 AGTCTAAATCATGCACCTCAAGC 59.056 43.478 0.00 0.00 0.00 4.01
5786 5848 4.156556 GTCTAAATCATGCACCTCAAGCAA 59.843 41.667 0.00 0.00 46.27 3.91
5787 5849 4.951715 TCTAAATCATGCACCTCAAGCAAT 59.048 37.500 0.00 0.00 46.27 3.56
5788 5850 4.546829 AAATCATGCACCTCAAGCAATT 57.453 36.364 0.00 0.00 46.27 2.32
5789 5851 3.795623 ATCATGCACCTCAAGCAATTC 57.204 42.857 0.00 0.00 46.27 2.17
5790 5852 1.820519 TCATGCACCTCAAGCAATTCC 59.179 47.619 0.00 0.00 46.27 3.01
5791 5853 1.546923 CATGCACCTCAAGCAATTCCA 59.453 47.619 0.00 0.00 46.27 3.53
5792 5854 0.961019 TGCACCTCAAGCAATTCCAC 59.039 50.000 0.00 0.00 39.39 4.02
5793 5855 0.109597 GCACCTCAAGCAATTCCACG 60.110 55.000 0.00 0.00 0.00 4.94
5794 5856 1.522668 CACCTCAAGCAATTCCACGA 58.477 50.000 0.00 0.00 0.00 4.35
5795 5857 1.197721 CACCTCAAGCAATTCCACGAC 59.802 52.381 0.00 0.00 0.00 4.34
5796 5858 1.072331 ACCTCAAGCAATTCCACGACT 59.928 47.619 0.00 0.00 0.00 4.18
5797 5859 2.301870 ACCTCAAGCAATTCCACGACTA 59.698 45.455 0.00 0.00 0.00 2.59
5798 5860 3.244422 ACCTCAAGCAATTCCACGACTAA 60.244 43.478 0.00 0.00 0.00 2.24
5799 5861 3.941483 CCTCAAGCAATTCCACGACTAAT 59.059 43.478 0.00 0.00 0.00 1.73
5800 5862 5.116180 CCTCAAGCAATTCCACGACTAATA 58.884 41.667 0.00 0.00 0.00 0.98
5801 5863 5.584649 CCTCAAGCAATTCCACGACTAATAA 59.415 40.000 0.00 0.00 0.00 1.40
5802 5864 6.238211 CCTCAAGCAATTCCACGACTAATAAG 60.238 42.308 0.00 0.00 0.00 1.73
5803 5865 5.064707 TCAAGCAATTCCACGACTAATAAGC 59.935 40.000 0.00 0.00 0.00 3.09
5804 5866 3.877508 AGCAATTCCACGACTAATAAGCC 59.122 43.478 0.00 0.00 0.00 4.35
5805 5867 3.625764 GCAATTCCACGACTAATAAGCCA 59.374 43.478 0.00 0.00 0.00 4.75
5806 5868 4.260784 GCAATTCCACGACTAATAAGCCAG 60.261 45.833 0.00 0.00 0.00 4.85
5807 5869 5.116180 CAATTCCACGACTAATAAGCCAGA 58.884 41.667 0.00 0.00 0.00 3.86
5808 5870 3.795623 TCCACGACTAATAAGCCAGAC 57.204 47.619 0.00 0.00 0.00 3.51
5809 5871 3.093814 TCCACGACTAATAAGCCAGACA 58.906 45.455 0.00 0.00 0.00 3.41
5810 5872 3.704566 TCCACGACTAATAAGCCAGACAT 59.295 43.478 0.00 0.00 0.00 3.06
5811 5873 4.161565 TCCACGACTAATAAGCCAGACATT 59.838 41.667 0.00 0.00 0.00 2.71
5812 5874 5.361571 TCCACGACTAATAAGCCAGACATTA 59.638 40.000 0.00 0.00 0.00 1.90
5813 5875 6.046593 CCACGACTAATAAGCCAGACATTAA 58.953 40.000 0.00 0.00 0.00 1.40
5814 5876 6.706270 CCACGACTAATAAGCCAGACATTAAT 59.294 38.462 0.00 0.00 0.00 1.40
5815 5877 7.095607 CCACGACTAATAAGCCAGACATTAATC 60.096 40.741 0.00 0.00 0.00 1.75
5816 5878 6.929606 ACGACTAATAAGCCAGACATTAATCC 59.070 38.462 0.00 0.00 0.00 3.01
5817 5879 6.929049 CGACTAATAAGCCAGACATTAATCCA 59.071 38.462 0.00 0.00 0.00 3.41
5818 5880 7.441157 CGACTAATAAGCCAGACATTAATCCAA 59.559 37.037 0.00 0.00 0.00 3.53
5819 5881 9.289782 GACTAATAAGCCAGACATTAATCCAAT 57.710 33.333 0.00 0.00 0.00 3.16
5820 5882 9.646522 ACTAATAAGCCAGACATTAATCCAATT 57.353 29.630 0.00 0.00 0.00 2.32
5824 5886 9.812347 ATAAGCCAGACATTAATCCAATTATCA 57.188 29.630 0.00 0.00 0.00 2.15
5825 5887 7.516198 AGCCAGACATTAATCCAATTATCAC 57.484 36.000 0.00 0.00 0.00 3.06
5826 5888 6.491403 AGCCAGACATTAATCCAATTATCACC 59.509 38.462 0.00 0.00 0.00 4.02
5827 5889 6.265196 GCCAGACATTAATCCAATTATCACCA 59.735 38.462 0.00 0.00 0.00 4.17
5828 5890 7.201902 GCCAGACATTAATCCAATTATCACCAA 60.202 37.037 0.00 0.00 0.00 3.67
5829 5891 8.863086 CCAGACATTAATCCAATTATCACCAAT 58.137 33.333 0.00 0.00 0.00 3.16
5830 5892 9.903682 CAGACATTAATCCAATTATCACCAATC 57.096 33.333 0.00 0.00 0.00 2.67
5831 5893 9.645128 AGACATTAATCCAATTATCACCAATCA 57.355 29.630 0.00 0.00 0.00 2.57
5841 5903 8.694540 CCAATTATCACCAATCATTTAGTTGGA 58.305 33.333 10.80 0.00 46.15 3.53
5844 5906 9.645128 ATTATCACCAATCATTTAGTTGGATCA 57.355 29.630 10.80 0.00 46.15 2.92
5845 5907 7.578310 ATCACCAATCATTTAGTTGGATCAG 57.422 36.000 10.80 0.00 46.15 2.90
5846 5908 5.887598 TCACCAATCATTTAGTTGGATCAGG 59.112 40.000 10.80 0.00 46.15 3.86
5847 5909 5.887598 CACCAATCATTTAGTTGGATCAGGA 59.112 40.000 10.80 0.00 46.15 3.86
5848 5910 5.888161 ACCAATCATTTAGTTGGATCAGGAC 59.112 40.000 10.80 0.00 46.15 3.85
5849 5911 5.887598 CCAATCATTTAGTTGGATCAGGACA 59.112 40.000 0.00 0.00 46.15 4.02
5850 5912 6.183360 CCAATCATTTAGTTGGATCAGGACAC 60.183 42.308 0.00 0.00 46.15 3.67
5851 5913 4.843728 TCATTTAGTTGGATCAGGACACC 58.156 43.478 0.00 0.00 0.00 4.16
5852 5914 4.536090 TCATTTAGTTGGATCAGGACACCT 59.464 41.667 0.00 0.00 0.00 4.00
5853 5915 4.993705 TTTAGTTGGATCAGGACACCTT 57.006 40.909 0.00 0.00 0.00 3.50
5854 5916 2.867109 AGTTGGATCAGGACACCTTG 57.133 50.000 0.00 0.00 0.00 3.61
5855 5917 2.057922 AGTTGGATCAGGACACCTTGT 58.942 47.619 0.00 0.00 0.00 3.16
5856 5918 2.154462 GTTGGATCAGGACACCTTGTG 58.846 52.381 0.00 0.00 39.75 3.33
5857 5919 0.692476 TGGATCAGGACACCTTGTGG 59.308 55.000 0.00 0.00 37.94 4.17
5858 5920 0.678048 GGATCAGGACACCTTGTGGC 60.678 60.000 0.00 0.00 41.56 5.01
5859 5921 0.036732 GATCAGGACACCTTGTGGCA 59.963 55.000 2.04 0.00 44.59 4.92
5860 5922 0.700564 ATCAGGACACCTTGTGGCAT 59.299 50.000 2.04 0.00 44.59 4.40
5861 5923 0.036732 TCAGGACACCTTGTGGCATC 59.963 55.000 2.04 0.00 44.59 3.91
5862 5924 0.037303 CAGGACACCTTGTGGCATCT 59.963 55.000 2.04 0.00 44.59 2.90
5863 5925 0.326264 AGGACACCTTGTGGCATCTC 59.674 55.000 2.04 0.00 44.59 2.75
5864 5926 0.036732 GGACACCTTGTGGCATCTCA 59.963 55.000 2.04 0.00 44.59 3.27
5865 5927 1.160137 GACACCTTGTGGCATCTCAC 58.840 55.000 0.00 0.00 41.94 3.51
5866 5928 0.250901 ACACCTTGTGGCATCTCACC 60.251 55.000 0.00 0.00 37.94 4.02
5867 5929 0.037303 CACCTTGTGGCATCTCACCT 59.963 55.000 0.00 0.00 36.87 4.00
5868 5930 1.278985 CACCTTGTGGCATCTCACCTA 59.721 52.381 0.00 0.00 36.87 3.08
5869 5931 2.092753 CACCTTGTGGCATCTCACCTAT 60.093 50.000 0.00 0.00 36.87 2.57
5870 5932 3.134623 CACCTTGTGGCATCTCACCTATA 59.865 47.826 0.00 0.00 36.87 1.31
5871 5933 3.780294 ACCTTGTGGCATCTCACCTATAA 59.220 43.478 0.00 0.00 36.87 0.98
5872 5934 4.413520 ACCTTGTGGCATCTCACCTATAAT 59.586 41.667 0.00 0.00 36.87 1.28
5873 5935 4.758674 CCTTGTGGCATCTCACCTATAATG 59.241 45.833 0.00 0.00 36.87 1.90
5874 5936 3.743521 TGTGGCATCTCACCTATAATGC 58.256 45.455 0.00 0.00 42.92 3.56
5875 5937 3.136260 TGTGGCATCTCACCTATAATGCA 59.864 43.478 8.28 0.00 44.90 3.96
5876 5938 3.750130 GTGGCATCTCACCTATAATGCAG 59.250 47.826 8.28 0.00 44.90 4.41
5877 5939 3.392285 TGGCATCTCACCTATAATGCAGT 59.608 43.478 8.28 0.00 44.90 4.40
5878 5940 3.999663 GGCATCTCACCTATAATGCAGTC 59.000 47.826 8.28 0.00 44.90 3.51
5879 5941 4.503817 GGCATCTCACCTATAATGCAGTCA 60.504 45.833 8.28 0.00 44.90 3.41
5880 5942 5.059161 GCATCTCACCTATAATGCAGTCAA 58.941 41.667 0.00 0.00 43.10 3.18
5881 5943 5.049818 GCATCTCACCTATAATGCAGTCAAC 60.050 44.000 0.00 0.00 43.10 3.18
5882 5944 5.675684 TCTCACCTATAATGCAGTCAACA 57.324 39.130 0.00 0.00 0.00 3.33
5883 5945 6.239217 TCTCACCTATAATGCAGTCAACAT 57.761 37.500 0.00 0.00 0.00 2.71
5884 5946 6.283694 TCTCACCTATAATGCAGTCAACATC 58.716 40.000 0.00 0.00 0.00 3.06
5885 5947 5.988287 TCACCTATAATGCAGTCAACATCA 58.012 37.500 0.00 0.00 0.00 3.07
5886 5948 6.594744 TCACCTATAATGCAGTCAACATCAT 58.405 36.000 0.00 0.00 0.00 2.45
5887 5949 7.056006 TCACCTATAATGCAGTCAACATCATT 58.944 34.615 0.00 0.00 34.08 2.57
5888 5950 7.557358 TCACCTATAATGCAGTCAACATCATTT 59.443 33.333 0.00 0.00 32.20 2.32
5889 5951 7.646526 CACCTATAATGCAGTCAACATCATTTG 59.353 37.037 0.00 0.00 32.20 2.32
5890 5952 7.340232 ACCTATAATGCAGTCAACATCATTTGT 59.660 33.333 0.00 0.00 41.53 2.83
5891 5953 7.859377 CCTATAATGCAGTCAACATCATTTGTC 59.141 37.037 0.00 0.00 37.68 3.18
5892 5954 5.717078 AATGCAGTCAACATCATTTGTCT 57.283 34.783 0.00 0.00 37.68 3.41
5893 5955 4.754372 TGCAGTCAACATCATTTGTCTC 57.246 40.909 0.00 0.00 37.68 3.36
5894 5956 3.187022 TGCAGTCAACATCATTTGTCTCG 59.813 43.478 0.00 0.00 37.68 4.04
5895 5957 3.187227 GCAGTCAACATCATTTGTCTCGT 59.813 43.478 0.00 0.00 37.68 4.18
5896 5958 4.319766 GCAGTCAACATCATTTGTCTCGTT 60.320 41.667 0.00 0.00 37.68 3.85
5897 5959 5.377358 CAGTCAACATCATTTGTCTCGTTC 58.623 41.667 0.00 0.00 37.68 3.95
5898 5960 4.150627 AGTCAACATCATTTGTCTCGTTCG 59.849 41.667 0.00 0.00 37.68 3.95
5899 5961 4.149922 GTCAACATCATTTGTCTCGTTCGA 59.850 41.667 0.00 0.00 37.68 3.71
5900 5962 4.929211 TCAACATCATTTGTCTCGTTCGAT 59.071 37.500 0.00 0.00 37.68 3.59
5901 5963 4.847365 ACATCATTTGTCTCGTTCGATG 57.153 40.909 0.00 0.00 30.89 3.84
5902 5964 4.245660 ACATCATTTGTCTCGTTCGATGT 58.754 39.130 0.00 0.00 37.70 3.06
5903 5965 4.327357 ACATCATTTGTCTCGTTCGATGTC 59.673 41.667 0.00 0.00 37.97 3.06
5904 5966 4.174411 TCATTTGTCTCGTTCGATGTCT 57.826 40.909 0.00 0.00 0.00 3.41
5905 5967 3.920412 TCATTTGTCTCGTTCGATGTCTG 59.080 43.478 0.00 0.00 0.00 3.51
5906 5968 1.698165 TTGTCTCGTTCGATGTCTGC 58.302 50.000 0.00 0.00 0.00 4.26
5907 5969 0.109272 TGTCTCGTTCGATGTCTGCC 60.109 55.000 0.00 0.00 0.00 4.85
5908 5970 0.171455 GTCTCGTTCGATGTCTGCCT 59.829 55.000 0.00 0.00 0.00 4.75
5909 5971 0.171231 TCTCGTTCGATGTCTGCCTG 59.829 55.000 0.00 0.00 0.00 4.85
5910 5972 1.416813 CTCGTTCGATGTCTGCCTGC 61.417 60.000 0.00 0.00 0.00 4.85
5911 5973 2.456119 CGTTCGATGTCTGCCTGCC 61.456 63.158 0.00 0.00 0.00 4.85
5912 5974 1.078848 GTTCGATGTCTGCCTGCCT 60.079 57.895 0.00 0.00 0.00 4.75
5913 5975 0.175760 GTTCGATGTCTGCCTGCCTA 59.824 55.000 0.00 0.00 0.00 3.93
5914 5976 0.175760 TTCGATGTCTGCCTGCCTAC 59.824 55.000 0.00 0.00 0.00 3.18
5915 5977 0.970427 TCGATGTCTGCCTGCCTACA 60.970 55.000 0.00 0.00 0.00 2.74
5916 5978 0.108186 CGATGTCTGCCTGCCTACAA 60.108 55.000 0.00 0.00 0.00 2.41
5917 5979 1.675714 CGATGTCTGCCTGCCTACAAA 60.676 52.381 0.00 0.00 0.00 2.83
5918 5980 2.436417 GATGTCTGCCTGCCTACAAAA 58.564 47.619 0.00 0.00 0.00 2.44
5919 5981 1.604604 TGTCTGCCTGCCTACAAAAC 58.395 50.000 0.00 0.00 0.00 2.43
5920 5982 1.133945 TGTCTGCCTGCCTACAAAACA 60.134 47.619 0.00 0.00 0.00 2.83
5921 5983 2.162681 GTCTGCCTGCCTACAAAACAT 58.837 47.619 0.00 0.00 0.00 2.71
5922 5984 2.558359 GTCTGCCTGCCTACAAAACATT 59.442 45.455 0.00 0.00 0.00 2.71
5923 5985 3.005791 GTCTGCCTGCCTACAAAACATTT 59.994 43.478 0.00 0.00 0.00 2.32
5924 5986 4.217550 GTCTGCCTGCCTACAAAACATTTA 59.782 41.667 0.00 0.00 0.00 1.40
5925 5987 4.217550 TCTGCCTGCCTACAAAACATTTAC 59.782 41.667 0.00 0.00 0.00 2.01
5926 5988 3.891977 TGCCTGCCTACAAAACATTTACA 59.108 39.130 0.00 0.00 0.00 2.41
5927 5989 4.234574 GCCTGCCTACAAAACATTTACAC 58.765 43.478 0.00 0.00 0.00 2.90
5928 5990 4.022329 GCCTGCCTACAAAACATTTACACT 60.022 41.667 0.00 0.00 0.00 3.55
5929 5991 5.460646 CCTGCCTACAAAACATTTACACTG 58.539 41.667 0.00 0.00 0.00 3.66
5930 5992 5.009610 CCTGCCTACAAAACATTTACACTGT 59.990 40.000 0.00 0.00 0.00 3.55
5931 5993 6.458232 TGCCTACAAAACATTTACACTGTT 57.542 33.333 0.00 0.00 38.44 3.16
5932 5994 6.868622 TGCCTACAAAACATTTACACTGTTT 58.131 32.000 0.00 0.00 46.03 2.83
5933 5995 7.997482 TGCCTACAAAACATTTACACTGTTTA 58.003 30.769 2.21 0.00 43.96 2.01
5934 5996 8.634444 TGCCTACAAAACATTTACACTGTTTAT 58.366 29.630 2.21 0.00 43.96 1.40
5944 6006 9.638239 ACATTTACACTGTTTATATTTTGCAGG 57.362 29.630 0.00 0.00 0.00 4.85
5945 6007 9.853555 CATTTACACTGTTTATATTTTGCAGGA 57.146 29.630 0.00 0.00 0.00 3.86
5947 6009 9.906660 TTTACACTGTTTATATTTTGCAGGAAG 57.093 29.630 0.00 0.00 0.00 3.46
5948 6010 6.389906 ACACTGTTTATATTTTGCAGGAAGC 58.610 36.000 0.00 0.00 45.96 3.86
5949 6011 5.807011 CACTGTTTATATTTTGCAGGAAGCC 59.193 40.000 0.00 0.00 44.83 4.35
5950 6012 5.480073 ACTGTTTATATTTTGCAGGAAGCCA 59.520 36.000 0.00 0.00 44.83 4.75
5951 6013 5.719173 TGTTTATATTTTGCAGGAAGCCAC 58.281 37.500 0.00 0.00 44.83 5.01
5952 6014 5.480073 TGTTTATATTTTGCAGGAAGCCACT 59.520 36.000 0.00 0.00 44.83 4.00
5953 6015 6.661377 TGTTTATATTTTGCAGGAAGCCACTA 59.339 34.615 0.00 0.00 44.83 2.74
5954 6016 6.942532 TTATATTTTGCAGGAAGCCACTAG 57.057 37.500 0.00 0.00 44.83 2.57
5955 6017 2.656947 TTTTGCAGGAAGCCACTAGT 57.343 45.000 0.00 0.00 44.83 2.57
5956 6018 2.656947 TTTGCAGGAAGCCACTAGTT 57.343 45.000 0.00 0.00 44.83 2.24
5957 6019 3.780804 TTTGCAGGAAGCCACTAGTTA 57.219 42.857 0.00 0.00 44.83 2.24
5958 6020 3.780804 TTGCAGGAAGCCACTAGTTAA 57.219 42.857 0.00 0.00 44.83 2.01
5959 6021 4.301072 TTGCAGGAAGCCACTAGTTAAT 57.699 40.909 0.00 0.00 44.83 1.40
5960 6022 3.609853 TGCAGGAAGCCACTAGTTAATG 58.390 45.455 0.00 0.00 44.83 1.90
5961 6023 3.263170 TGCAGGAAGCCACTAGTTAATGA 59.737 43.478 0.00 0.00 44.83 2.57
5962 6024 4.080356 TGCAGGAAGCCACTAGTTAATGAT 60.080 41.667 0.00 0.00 44.83 2.45
5963 6025 5.130311 TGCAGGAAGCCACTAGTTAATGATA 59.870 40.000 0.00 0.00 44.83 2.15
5964 6026 6.055588 GCAGGAAGCCACTAGTTAATGATAA 58.944 40.000 0.00 0.00 37.23 1.75
5965 6027 6.712547 GCAGGAAGCCACTAGTTAATGATAAT 59.287 38.462 0.00 0.00 37.23 1.28
5966 6028 7.308229 GCAGGAAGCCACTAGTTAATGATAATG 60.308 40.741 0.00 0.00 37.23 1.90
5967 6029 7.933577 CAGGAAGCCACTAGTTAATGATAATGA 59.066 37.037 0.00 0.00 0.00 2.57
5968 6030 8.664079 AGGAAGCCACTAGTTAATGATAATGAT 58.336 33.333 0.00 0.00 0.00 2.45
5969 6031 8.725148 GGAAGCCACTAGTTAATGATAATGATG 58.275 37.037 0.00 0.00 0.00 3.07
5970 6032 9.277783 GAAGCCACTAGTTAATGATAATGATGT 57.722 33.333 0.00 0.00 0.00 3.06
5972 6034 9.935241 AGCCACTAGTTAATGATAATGATGTAG 57.065 33.333 0.00 0.00 0.00 2.74
5973 6035 9.929180 GCCACTAGTTAATGATAATGATGTAGA 57.071 33.333 0.00 0.00 0.00 2.59
6051 6113 8.321650 AGAAATTTCTCAAAAGCTCACTCTAG 57.678 34.615 15.11 0.00 29.94 2.43
6052 6114 7.390162 AGAAATTTCTCAAAAGCTCACTCTAGG 59.610 37.037 15.11 0.00 29.94 3.02
6053 6115 5.552870 TTTCTCAAAAGCTCACTCTAGGT 57.447 39.130 0.00 0.00 0.00 3.08
6054 6116 4.527509 TCTCAAAAGCTCACTCTAGGTG 57.472 45.455 5.31 5.31 46.60 4.00
6055 6117 2.999355 CTCAAAAGCTCACTCTAGGTGC 59.001 50.000 6.51 0.00 44.98 5.01
6056 6118 2.368548 TCAAAAGCTCACTCTAGGTGCA 59.631 45.455 6.51 0.00 44.98 4.57
6057 6119 3.141398 CAAAAGCTCACTCTAGGTGCAA 58.859 45.455 0.00 0.00 44.98 4.08
6058 6120 2.464157 AAGCTCACTCTAGGTGCAAC 57.536 50.000 0.00 0.00 44.98 4.17
6059 6121 1.638529 AGCTCACTCTAGGTGCAACT 58.361 50.000 10.34 10.34 44.98 3.16
6060 6122 1.974236 AGCTCACTCTAGGTGCAACTT 59.026 47.619 10.94 0.00 44.98 2.66
6061 6123 2.072298 GCTCACTCTAGGTGCAACTTG 58.928 52.381 10.94 8.63 44.98 3.16
6062 6124 2.072298 CTCACTCTAGGTGCAACTTGC 58.928 52.381 10.94 6.82 44.98 4.01
6063 6125 1.694150 TCACTCTAGGTGCAACTTGCT 59.306 47.619 10.94 0.00 45.31 3.91
6064 6126 2.072298 CACTCTAGGTGCAACTTGCTC 58.928 52.381 10.94 10.89 45.31 4.26
6072 6134 3.258971 GTGCAACTTGCTCCTCTATCT 57.741 47.619 14.78 0.00 45.31 1.98
6073 6135 4.392921 GTGCAACTTGCTCCTCTATCTA 57.607 45.455 14.78 0.00 45.31 1.98
6074 6136 4.759782 GTGCAACTTGCTCCTCTATCTAA 58.240 43.478 14.78 0.00 45.31 2.10
6075 6137 4.568760 GTGCAACTTGCTCCTCTATCTAAC 59.431 45.833 14.78 0.00 45.31 2.34
6076 6138 4.123506 GCAACTTGCTCCTCTATCTAACC 58.876 47.826 6.50 0.00 40.96 2.85
6077 6139 4.383118 GCAACTTGCTCCTCTATCTAACCA 60.383 45.833 6.50 0.00 40.96 3.67
6078 6140 5.734720 CAACTTGCTCCTCTATCTAACCAA 58.265 41.667 0.00 0.00 0.00 3.67
6079 6141 5.346181 ACTTGCTCCTCTATCTAACCAAC 57.654 43.478 0.00 0.00 0.00 3.77
6080 6142 5.026790 ACTTGCTCCTCTATCTAACCAACT 58.973 41.667 0.00 0.00 0.00 3.16
6081 6143 6.195700 ACTTGCTCCTCTATCTAACCAACTA 58.804 40.000 0.00 0.00 0.00 2.24
6082 6144 6.668283 ACTTGCTCCTCTATCTAACCAACTAA 59.332 38.462 0.00 0.00 0.00 2.24
6083 6145 7.180408 ACTTGCTCCTCTATCTAACCAACTAAA 59.820 37.037 0.00 0.00 0.00 1.85
6084 6146 7.113658 TGCTCCTCTATCTAACCAACTAAAG 57.886 40.000 0.00 0.00 0.00 1.85
6085 6147 5.986741 GCTCCTCTATCTAACCAACTAAAGC 59.013 44.000 0.00 0.00 0.00 3.51
6086 6148 6.481434 TCCTCTATCTAACCAACTAAAGCC 57.519 41.667 0.00 0.00 0.00 4.35
6087 6149 5.365895 TCCTCTATCTAACCAACTAAAGCCC 59.634 44.000 0.00 0.00 0.00 5.19
6088 6150 5.130477 CCTCTATCTAACCAACTAAAGCCCA 59.870 44.000 0.00 0.00 0.00 5.36
6089 6151 5.985911 TCTATCTAACCAACTAAAGCCCAC 58.014 41.667 0.00 0.00 0.00 4.61
6090 6152 4.650972 ATCTAACCAACTAAAGCCCACA 57.349 40.909 0.00 0.00 0.00 4.17
6091 6153 4.650972 TCTAACCAACTAAAGCCCACAT 57.349 40.909 0.00 0.00 0.00 3.21
6092 6154 4.993028 TCTAACCAACTAAAGCCCACATT 58.007 39.130 0.00 0.00 0.00 2.71
6093 6155 4.764823 TCTAACCAACTAAAGCCCACATTG 59.235 41.667 0.00 0.00 0.00 2.82
6094 6156 3.237268 ACCAACTAAAGCCCACATTGA 57.763 42.857 0.00 0.00 0.00 2.57
6095 6157 2.890945 ACCAACTAAAGCCCACATTGAC 59.109 45.455 0.00 0.00 0.00 3.18
6096 6158 2.231235 CCAACTAAAGCCCACATTGACC 59.769 50.000 0.00 0.00 0.00 4.02
6097 6159 2.890311 CAACTAAAGCCCACATTGACCA 59.110 45.455 0.00 0.00 0.00 4.02
6098 6160 2.795329 ACTAAAGCCCACATTGACCAG 58.205 47.619 0.00 0.00 0.00 4.00
6099 6161 2.375174 ACTAAAGCCCACATTGACCAGA 59.625 45.455 0.00 0.00 0.00 3.86
6100 6162 2.610438 AAAGCCCACATTGACCAGAT 57.390 45.000 0.00 0.00 0.00 2.90
6101 6163 1.843368 AAGCCCACATTGACCAGATG 58.157 50.000 0.00 0.00 0.00 2.90
6102 6164 0.994247 AGCCCACATTGACCAGATGA 59.006 50.000 0.00 0.00 0.00 2.92
6103 6165 1.567649 AGCCCACATTGACCAGATGAT 59.432 47.619 0.00 0.00 0.00 2.45
6104 6166 2.024655 AGCCCACATTGACCAGATGATT 60.025 45.455 0.00 0.00 0.00 2.57
6105 6167 3.202818 AGCCCACATTGACCAGATGATTA 59.797 43.478 0.00 0.00 0.00 1.75
6106 6168 4.141088 AGCCCACATTGACCAGATGATTAT 60.141 41.667 0.00 0.00 0.00 1.28
6107 6169 5.073554 AGCCCACATTGACCAGATGATTATA 59.926 40.000 0.00 0.00 0.00 0.98
6108 6170 5.769662 GCCCACATTGACCAGATGATTATAA 59.230 40.000 0.00 0.00 0.00 0.98
6109 6171 6.435277 GCCCACATTGACCAGATGATTATAAT 59.565 38.462 0.00 0.00 0.00 1.28
6110 6172 7.039504 GCCCACATTGACCAGATGATTATAATT 60.040 37.037 0.00 0.00 0.00 1.40
6111 6173 9.519191 CCCACATTGACCAGATGATTATAATTA 57.481 33.333 0.00 0.00 0.00 1.40
6133 6195 8.854614 ATTATAGGCTCATGAGTTATGGAAAC 57.145 34.615 23.38 3.79 37.39 2.78
6148 6210 4.640771 TGGAAACAAGCCTCATAGAGTT 57.359 40.909 0.00 0.00 37.44 3.01
6149 6211 5.755409 TGGAAACAAGCCTCATAGAGTTA 57.245 39.130 0.00 0.00 37.44 2.24
6150 6212 6.313519 TGGAAACAAGCCTCATAGAGTTAT 57.686 37.500 0.00 0.00 37.44 1.89
6151 6213 7.432148 TGGAAACAAGCCTCATAGAGTTATA 57.568 36.000 0.00 0.00 37.44 0.98
6152 6214 7.857456 TGGAAACAAGCCTCATAGAGTTATAA 58.143 34.615 0.00 0.00 37.44 0.98
6153 6215 8.494433 TGGAAACAAGCCTCATAGAGTTATAAT 58.506 33.333 0.00 0.00 37.44 1.28
6154 6216 8.994170 GGAAACAAGCCTCATAGAGTTATAATC 58.006 37.037 0.00 0.00 0.00 1.75
6155 6217 8.594881 AAACAAGCCTCATAGAGTTATAATCG 57.405 34.615 0.00 0.00 0.00 3.34
6156 6218 6.159988 ACAAGCCTCATAGAGTTATAATCGC 58.840 40.000 0.00 0.00 0.00 4.58
6157 6219 5.984695 AGCCTCATAGAGTTATAATCGCA 57.015 39.130 0.00 0.00 0.00 5.10
6158 6220 6.346477 AGCCTCATAGAGTTATAATCGCAA 57.654 37.500 0.00 0.00 0.00 4.85
6159 6221 6.759272 AGCCTCATAGAGTTATAATCGCAAA 58.241 36.000 0.00 0.00 0.00 3.68
6160 6222 7.217200 AGCCTCATAGAGTTATAATCGCAAAA 58.783 34.615 0.00 0.00 0.00 2.44
6161 6223 7.715249 AGCCTCATAGAGTTATAATCGCAAAAA 59.285 33.333 0.00 0.00 0.00 1.94
6178 6240 3.990318 AAAAAGAGGGTCGCAGAAAAG 57.010 42.857 0.00 0.00 39.69 2.27
6179 6241 1.239347 AAAGAGGGTCGCAGAAAAGC 58.761 50.000 0.00 0.00 39.69 3.51
6180 6242 0.606673 AAGAGGGTCGCAGAAAAGCC 60.607 55.000 0.00 0.00 39.69 4.35
6181 6243 1.003233 GAGGGTCGCAGAAAAGCCT 60.003 57.895 0.00 0.00 45.78 4.58
6182 6244 0.606673 GAGGGTCGCAGAAAAGCCTT 60.607 55.000 0.00 0.00 43.24 4.35
6183 6245 0.690762 AGGGTCGCAGAAAAGCCTTA 59.309 50.000 0.00 0.00 40.41 2.69
6184 6246 1.073284 AGGGTCGCAGAAAAGCCTTAA 59.927 47.619 0.00 0.00 40.41 1.85
6185 6247 2.092323 GGGTCGCAGAAAAGCCTTAAT 58.908 47.619 0.00 0.00 39.69 1.40
6186 6248 3.054655 AGGGTCGCAGAAAAGCCTTAATA 60.055 43.478 0.00 0.00 40.41 0.98
6187 6249 3.692593 GGGTCGCAGAAAAGCCTTAATAA 59.307 43.478 0.00 0.00 39.69 1.40
6188 6250 4.157105 GGGTCGCAGAAAAGCCTTAATAAA 59.843 41.667 0.00 0.00 39.69 1.40
6189 6251 5.163550 GGGTCGCAGAAAAGCCTTAATAAAT 60.164 40.000 0.00 0.00 39.69 1.40
6190 6252 6.038936 GGGTCGCAGAAAAGCCTTAATAAATA 59.961 38.462 0.00 0.00 39.69 1.40
6191 6253 7.415877 GGGTCGCAGAAAAGCCTTAATAAATAA 60.416 37.037 0.00 0.00 39.69 1.40
6192 6254 7.971722 GGTCGCAGAAAAGCCTTAATAAATAAA 59.028 33.333 0.00 0.00 39.69 1.40
6193 6255 9.349145 GTCGCAGAAAAGCCTTAATAAATAAAA 57.651 29.630 0.00 0.00 39.69 1.52
6217 6279 9.740710 AAATAAGCCTCAATAAAGTAAGTGTCT 57.259 29.630 0.00 0.00 0.00 3.41
6218 6280 8.950208 ATAAGCCTCAATAAAGTAAGTGTCTC 57.050 34.615 0.00 0.00 0.00 3.36
6219 6281 6.360370 AGCCTCAATAAAGTAAGTGTCTCA 57.640 37.500 0.00 0.00 0.00 3.27
6220 6282 6.769512 AGCCTCAATAAAGTAAGTGTCTCAA 58.230 36.000 0.00 0.00 0.00 3.02
6221 6283 7.224297 AGCCTCAATAAAGTAAGTGTCTCAAA 58.776 34.615 0.00 0.00 0.00 2.69
6222 6284 7.885399 AGCCTCAATAAAGTAAGTGTCTCAAAT 59.115 33.333 0.00 0.00 0.00 2.32
6223 6285 9.162764 GCCTCAATAAAGTAAGTGTCTCAAATA 57.837 33.333 0.00 0.00 0.00 1.40
6257 6319 8.042944 ACAATTTGAATTTGGCATTATTCACC 57.957 30.769 19.21 1.08 39.69 4.02
6258 6320 7.121020 ACAATTTGAATTTGGCATTATTCACCC 59.879 33.333 19.21 0.81 39.69 4.61
6259 6321 5.752036 TTGAATTTGGCATTATTCACCCA 57.248 34.783 19.21 7.80 39.69 4.51
6260 6322 5.341872 TGAATTTGGCATTATTCACCCAG 57.658 39.130 16.85 0.00 36.22 4.45
6261 6323 4.776837 TGAATTTGGCATTATTCACCCAGT 59.223 37.500 16.85 0.00 36.22 4.00
6262 6324 5.248020 TGAATTTGGCATTATTCACCCAGTT 59.752 36.000 16.85 0.00 36.22 3.16
6263 6325 5.760484 ATTTGGCATTATTCACCCAGTTT 57.240 34.783 0.00 0.00 0.00 2.66
6264 6326 5.559148 TTTGGCATTATTCACCCAGTTTT 57.441 34.783 0.00 0.00 0.00 2.43
6265 6327 5.559148 TTGGCATTATTCACCCAGTTTTT 57.441 34.783 0.00 0.00 0.00 1.94
6284 6346 4.630894 TTTTGTTTCTCAATGCACGACT 57.369 36.364 0.00 0.00 35.84 4.18
6285 6347 3.607422 TTGTTTCTCAATGCACGACTG 57.393 42.857 0.00 0.00 0.00 3.51
6286 6348 2.560504 TGTTTCTCAATGCACGACTGT 58.439 42.857 0.00 0.00 0.00 3.55
6287 6349 3.723260 TGTTTCTCAATGCACGACTGTA 58.277 40.909 0.00 0.00 0.00 2.74
6288 6350 4.314961 TGTTTCTCAATGCACGACTGTAT 58.685 39.130 0.00 0.00 0.00 2.29
6289 6351 4.754618 TGTTTCTCAATGCACGACTGTATT 59.245 37.500 0.00 0.00 33.33 1.89
6290 6352 5.238432 TGTTTCTCAATGCACGACTGTATTT 59.762 36.000 0.00 0.00 30.89 1.40
6291 6353 4.926860 TCTCAATGCACGACTGTATTTG 57.073 40.909 0.00 0.00 30.89 2.32
6292 6354 3.684305 TCTCAATGCACGACTGTATTTGG 59.316 43.478 0.00 0.00 30.89 3.28
6293 6355 3.407698 TCAATGCACGACTGTATTTGGT 58.592 40.909 0.00 0.00 30.89 3.67
6294 6356 3.818210 TCAATGCACGACTGTATTTGGTT 59.182 39.130 0.00 0.00 30.89 3.67
6295 6357 4.277174 TCAATGCACGACTGTATTTGGTTT 59.723 37.500 0.00 0.00 30.89 3.27
6296 6358 4.846779 ATGCACGACTGTATTTGGTTTT 57.153 36.364 0.00 0.00 0.00 2.43
6297 6359 3.958704 TGCACGACTGTATTTGGTTTTG 58.041 40.909 0.00 0.00 0.00 2.44
6298 6360 3.628032 TGCACGACTGTATTTGGTTTTGA 59.372 39.130 0.00 0.00 0.00 2.69
6299 6361 4.096532 TGCACGACTGTATTTGGTTTTGAA 59.903 37.500 0.00 0.00 0.00 2.69
6300 6362 5.038033 GCACGACTGTATTTGGTTTTGAAA 58.962 37.500 0.00 0.00 0.00 2.69
6301 6363 5.051973 GCACGACTGTATTTGGTTTTGAAAC 60.052 40.000 0.00 0.00 38.17 2.78
6302 6364 6.262601 CACGACTGTATTTGGTTTTGAAACT 58.737 36.000 6.57 0.00 38.89 2.66
6303 6365 6.750039 CACGACTGTATTTGGTTTTGAAACTT 59.250 34.615 6.57 0.00 38.89 2.66
6304 6366 7.911205 CACGACTGTATTTGGTTTTGAAACTTA 59.089 33.333 6.57 0.00 38.89 2.24
6305 6367 8.460428 ACGACTGTATTTGGTTTTGAAACTTAA 58.540 29.630 6.57 2.58 38.89 1.85
6306 6368 9.458374 CGACTGTATTTGGTTTTGAAACTTAAT 57.542 29.630 6.57 8.49 38.89 1.40
6314 6376 9.883142 TTTGGTTTTGAAACTTAATGACAGATT 57.117 25.926 6.57 0.00 38.89 2.40
6341 6403 9.807649 AATATTCTTGCTTGAATATCCACAAAC 57.192 29.630 18.21 0.00 44.29 2.93
6342 6404 6.899393 TTCTTGCTTGAATATCCACAAACT 57.101 33.333 0.00 0.00 0.00 2.66
6343 6405 6.258230 TCTTGCTTGAATATCCACAAACTG 57.742 37.500 0.00 0.00 0.00 3.16
6344 6406 5.769662 TCTTGCTTGAATATCCACAAACTGT 59.230 36.000 0.00 0.00 0.00 3.55
6345 6407 5.627499 TGCTTGAATATCCACAAACTGTC 57.373 39.130 0.00 0.00 0.00 3.51
6346 6408 5.316167 TGCTTGAATATCCACAAACTGTCT 58.684 37.500 0.00 0.00 0.00 3.41
6347 6409 6.472016 TGCTTGAATATCCACAAACTGTCTA 58.528 36.000 0.00 0.00 0.00 2.59
6348 6410 7.112122 TGCTTGAATATCCACAAACTGTCTAT 58.888 34.615 0.00 0.00 0.00 1.98
6349 6411 7.066163 TGCTTGAATATCCACAAACTGTCTATG 59.934 37.037 0.00 0.00 0.00 2.23
6350 6412 7.280876 GCTTGAATATCCACAAACTGTCTATGA 59.719 37.037 0.00 0.00 0.00 2.15
6351 6413 9.166173 CTTGAATATCCACAAACTGTCTATGAA 57.834 33.333 0.00 0.00 0.00 2.57
6352 6414 9.685276 TTGAATATCCACAAACTGTCTATGAAT 57.315 29.630 0.00 0.00 0.00 2.57
6353 6415 9.685276 TGAATATCCACAAACTGTCTATGAATT 57.315 29.630 0.00 0.00 0.00 2.17
6357 6419 6.446318 TCCACAAACTGTCTATGAATTTTGC 58.554 36.000 0.00 0.00 0.00 3.68
6358 6420 6.040278 TCCACAAACTGTCTATGAATTTTGCA 59.960 34.615 0.00 0.00 0.00 4.08
6359 6421 6.869913 CCACAAACTGTCTATGAATTTTGCAT 59.130 34.615 0.00 0.00 0.00 3.96
6360 6422 7.062605 CCACAAACTGTCTATGAATTTTGCATC 59.937 37.037 0.00 0.00 0.00 3.91
6361 6423 6.803320 ACAAACTGTCTATGAATTTTGCATCG 59.197 34.615 0.00 0.00 0.00 3.84
6362 6424 4.913376 ACTGTCTATGAATTTTGCATCGC 58.087 39.130 0.00 0.00 0.00 4.58
6363 6425 4.201950 ACTGTCTATGAATTTTGCATCGCC 60.202 41.667 0.00 0.00 0.00 5.54
6364 6426 3.947196 TGTCTATGAATTTTGCATCGCCT 59.053 39.130 0.00 0.00 0.00 5.52
6365 6427 4.398988 TGTCTATGAATTTTGCATCGCCTT 59.601 37.500 0.00 0.00 0.00 4.35
6366 6428 5.105797 TGTCTATGAATTTTGCATCGCCTTT 60.106 36.000 0.00 0.00 0.00 3.11
6367 6429 5.807011 GTCTATGAATTTTGCATCGCCTTTT 59.193 36.000 0.00 0.00 0.00 2.27
6368 6430 6.972328 GTCTATGAATTTTGCATCGCCTTTTA 59.028 34.615 0.00 0.00 0.00 1.52
6369 6431 7.166473 GTCTATGAATTTTGCATCGCCTTTTAG 59.834 37.037 0.00 0.00 0.00 1.85
6370 6432 5.384063 TGAATTTTGCATCGCCTTTTAGA 57.616 34.783 0.00 0.00 0.00 2.10
6371 6433 5.964758 TGAATTTTGCATCGCCTTTTAGAT 58.035 33.333 0.00 0.00 0.00 1.98
6372 6434 5.806502 TGAATTTTGCATCGCCTTTTAGATG 59.193 36.000 0.00 1.47 45.06 2.90
6373 6435 5.581126 ATTTTGCATCGCCTTTTAGATGA 57.419 34.783 9.32 0.00 45.08 2.92
6374 6436 5.581126 TTTTGCATCGCCTTTTAGATGAT 57.419 34.783 9.32 0.00 45.08 2.45
6375 6437 4.818534 TTGCATCGCCTTTTAGATGATC 57.181 40.909 9.32 0.00 45.08 2.92
6376 6438 3.807553 TGCATCGCCTTTTAGATGATCA 58.192 40.909 0.00 0.00 45.08 2.92
6377 6439 4.392047 TGCATCGCCTTTTAGATGATCAT 58.608 39.130 8.25 8.25 45.08 2.45
6378 6440 4.823442 TGCATCGCCTTTTAGATGATCATT 59.177 37.500 10.14 2.85 45.08 2.57
6379 6441 5.049198 TGCATCGCCTTTTAGATGATCATTC 60.049 40.000 10.14 3.48 45.08 2.67
6380 6442 5.049198 GCATCGCCTTTTAGATGATCATTCA 60.049 40.000 10.14 0.00 45.08 2.57
6381 6443 6.513884 GCATCGCCTTTTAGATGATCATTCAA 60.514 38.462 10.14 4.32 45.08 2.69
6382 6444 7.591165 CATCGCCTTTTAGATGATCATTCAAT 58.409 34.615 10.14 0.00 45.08 2.57
6383 6445 7.194607 TCGCCTTTTAGATGATCATTCAATC 57.805 36.000 10.14 0.00 34.96 2.67
6384 6446 6.205464 TCGCCTTTTAGATGATCATTCAATCC 59.795 38.462 10.14 0.00 34.96 3.01
6385 6447 6.206243 CGCCTTTTAGATGATCATTCAATCCT 59.794 38.462 10.14 3.66 34.96 3.24
6386 6448 7.255381 CGCCTTTTAGATGATCATTCAATCCTT 60.255 37.037 10.14 0.00 34.96 3.36
6387 6449 8.419442 GCCTTTTAGATGATCATTCAATCCTTT 58.581 33.333 10.14 0.00 34.96 3.11
6417 6479 9.650539 AGAGATTACATGCTATAGCTGTTTATG 57.349 33.333 24.61 20.01 42.66 1.90
6418 6480 9.429359 GAGATTACATGCTATAGCTGTTTATGT 57.571 33.333 24.61 23.87 42.66 2.29
6424 6486 7.815068 ACATGCTATAGCTGTTTATGTACTAGC 59.185 37.037 24.61 0.00 42.66 3.42
6425 6487 7.526142 TGCTATAGCTGTTTATGTACTAGCT 57.474 36.000 24.61 0.00 45.74 3.32
6426 6488 7.371159 TGCTATAGCTGTTTATGTACTAGCTG 58.629 38.462 24.61 0.00 43.87 4.24
6427 6489 6.309251 GCTATAGCTGTTTATGTACTAGCTGC 59.691 42.308 17.75 0.00 43.87 5.25
6428 6490 4.744795 AGCTGTTTATGTACTAGCTGCT 57.255 40.909 7.57 7.57 42.63 4.24
6429 6491 4.688021 AGCTGTTTATGTACTAGCTGCTC 58.312 43.478 4.91 0.00 42.63 4.26
6430 6492 4.404073 AGCTGTTTATGTACTAGCTGCTCT 59.596 41.667 4.91 0.00 42.63 4.09
6431 6493 4.505922 GCTGTTTATGTACTAGCTGCTCTG 59.494 45.833 4.91 2.95 0.00 3.35
6432 6494 4.433615 TGTTTATGTACTAGCTGCTCTGC 58.566 43.478 4.91 0.00 0.00 4.26
6433 6495 4.081697 TGTTTATGTACTAGCTGCTCTGCA 60.082 41.667 4.91 2.76 36.92 4.41
6434 6496 4.944619 TTATGTACTAGCTGCTCTGCAT 57.055 40.909 4.91 10.42 38.13 3.96
6435 6497 6.183360 TGTTTATGTACTAGCTGCTCTGCATA 60.183 38.462 4.91 9.42 38.13 3.14
6436 6498 3.717400 TGTACTAGCTGCTCTGCATAC 57.283 47.619 4.91 3.79 38.13 2.39
6437 6499 2.033424 TGTACTAGCTGCTCTGCATACG 59.967 50.000 4.91 0.00 38.13 3.06
6438 6500 1.107114 ACTAGCTGCTCTGCATACGT 58.893 50.000 4.91 0.00 38.13 3.57
6439 6501 1.478510 ACTAGCTGCTCTGCATACGTT 59.521 47.619 4.91 0.00 38.13 3.99
6440 6502 2.093973 ACTAGCTGCTCTGCATACGTTT 60.094 45.455 4.91 0.00 38.13 3.60
6441 6503 1.813513 AGCTGCTCTGCATACGTTTT 58.186 45.000 0.00 0.00 38.13 2.43
6442 6504 2.154462 AGCTGCTCTGCATACGTTTTT 58.846 42.857 0.00 0.00 38.13 1.94
6463 6525 6.969993 TTTTTGTGCCAATAAGTCCTTACT 57.030 33.333 0.00 0.00 37.65 2.24
6464 6526 6.569179 TTTTGTGCCAATAAGTCCTTACTC 57.431 37.500 0.00 0.00 33.75 2.59
6465 6527 5.499004 TTGTGCCAATAAGTCCTTACTCT 57.501 39.130 0.00 0.00 33.75 3.24
6466 6528 4.832248 TGTGCCAATAAGTCCTTACTCTG 58.168 43.478 0.00 0.00 33.75 3.35
6467 6529 4.286032 TGTGCCAATAAGTCCTTACTCTGT 59.714 41.667 0.00 0.00 33.75 3.41
6468 6530 5.221843 TGTGCCAATAAGTCCTTACTCTGTT 60.222 40.000 0.00 0.00 33.75 3.16
6469 6531 5.351740 GTGCCAATAAGTCCTTACTCTGTTC 59.648 44.000 0.00 0.00 33.75 3.18
6470 6532 5.248477 TGCCAATAAGTCCTTACTCTGTTCT 59.752 40.000 0.00 0.00 33.75 3.01
6471 6533 5.582665 GCCAATAAGTCCTTACTCTGTTCTG 59.417 44.000 0.00 0.00 33.75 3.02
6472 6534 5.582665 CCAATAAGTCCTTACTCTGTTCTGC 59.417 44.000 0.00 0.00 33.75 4.26
6473 6535 6.166279 CAATAAGTCCTTACTCTGTTCTGCA 58.834 40.000 0.00 0.00 33.75 4.41
6474 6536 3.951775 AGTCCTTACTCTGTTCTGCAG 57.048 47.619 7.63 7.63 46.34 4.41
6475 6537 2.564947 AGTCCTTACTCTGTTCTGCAGG 59.435 50.000 15.13 0.00 45.08 4.85
6476 6538 2.300437 GTCCTTACTCTGTTCTGCAGGT 59.700 50.000 15.13 5.02 45.08 4.00
6477 6539 2.972713 TCCTTACTCTGTTCTGCAGGTT 59.027 45.455 15.13 0.00 45.08 3.50
6478 6540 3.391296 TCCTTACTCTGTTCTGCAGGTTT 59.609 43.478 15.13 0.00 45.08 3.27
6479 6541 4.137543 CCTTACTCTGTTCTGCAGGTTTT 58.862 43.478 15.13 0.00 45.08 2.43
6480 6542 4.580580 CCTTACTCTGTTCTGCAGGTTTTT 59.419 41.667 15.13 0.00 45.08 1.94
6497 6559 1.714541 TTTTTGGGCCAGCAGATTCA 58.285 45.000 6.23 0.00 0.00 2.57
6498 6560 1.714541 TTTTGGGCCAGCAGATTCAA 58.285 45.000 6.23 0.00 0.00 2.69
6499 6561 1.259609 TTTGGGCCAGCAGATTCAAG 58.740 50.000 6.23 0.00 0.00 3.02
6500 6562 0.405198 TTGGGCCAGCAGATTCAAGA 59.595 50.000 6.23 0.00 0.00 3.02
6501 6563 0.405198 TGGGCCAGCAGATTCAAGAA 59.595 50.000 0.00 0.00 0.00 2.52
6502 6564 1.203038 TGGGCCAGCAGATTCAAGAAA 60.203 47.619 0.00 0.00 0.00 2.52
6503 6565 1.203287 GGGCCAGCAGATTCAAGAAAC 59.797 52.381 4.39 0.00 0.00 2.78
6504 6566 1.888512 GGCCAGCAGATTCAAGAAACA 59.111 47.619 0.00 0.00 0.00 2.83
6505 6567 2.352127 GGCCAGCAGATTCAAGAAACAC 60.352 50.000 0.00 0.00 0.00 3.32
6506 6568 2.352127 GCCAGCAGATTCAAGAAACACC 60.352 50.000 0.00 0.00 0.00 4.16
6507 6569 2.886523 CCAGCAGATTCAAGAAACACCA 59.113 45.455 0.00 0.00 0.00 4.17
6508 6570 3.057736 CCAGCAGATTCAAGAAACACCAG 60.058 47.826 0.00 0.00 0.00 4.00
6509 6571 3.057736 CAGCAGATTCAAGAAACACCAGG 60.058 47.826 0.00 0.00 0.00 4.45
6510 6572 2.352127 GCAGATTCAAGAAACACCAGGC 60.352 50.000 0.00 0.00 0.00 4.85
6511 6573 2.095567 CAGATTCAAGAAACACCAGGCG 60.096 50.000 0.00 0.00 0.00 5.52
6512 6574 0.598065 ATTCAAGAAACACCAGGCGC 59.402 50.000 0.00 0.00 0.00 6.53
6513 6575 0.465460 TTCAAGAAACACCAGGCGCT 60.465 50.000 7.64 0.00 0.00 5.92
6514 6576 0.465460 TCAAGAAACACCAGGCGCTT 60.465 50.000 7.64 0.00 0.00 4.68
6515 6577 0.040067 CAAGAAACACCAGGCGCTTC 60.040 55.000 7.64 0.53 0.00 3.86
6516 6578 1.172812 AAGAAACACCAGGCGCTTCC 61.173 55.000 7.64 0.00 0.00 3.46
6517 6579 1.896660 GAAACACCAGGCGCTTCCA 60.897 57.895 7.64 0.00 37.29 3.53
6518 6580 1.452145 GAAACACCAGGCGCTTCCAA 61.452 55.000 7.64 0.00 37.29 3.53
6519 6581 0.827507 AAACACCAGGCGCTTCCAAT 60.828 50.000 7.64 0.00 37.29 3.16
6520 6582 1.526575 AACACCAGGCGCTTCCAATG 61.527 55.000 7.64 1.16 37.29 2.82
6521 6583 3.064324 ACCAGGCGCTTCCAATGC 61.064 61.111 7.64 0.00 37.29 3.56
6522 6584 3.063704 CCAGGCGCTTCCAATGCA 61.064 61.111 7.64 0.00 37.29 3.96
6523 6585 2.638354 CCAGGCGCTTCCAATGCAA 61.638 57.895 7.64 0.00 37.29 4.08
6524 6586 1.514087 CAGGCGCTTCCAATGCAAT 59.486 52.632 7.64 0.00 37.29 3.56
6525 6587 0.526954 CAGGCGCTTCCAATGCAATC 60.527 55.000 7.64 0.00 37.29 2.67
6526 6588 0.966875 AGGCGCTTCCAATGCAATCA 60.967 50.000 7.64 0.00 37.29 2.57
6527 6589 0.803380 GGCGCTTCCAATGCAATCAC 60.803 55.000 7.64 0.00 34.01 3.06
6528 6590 1.135699 GCGCTTCCAATGCAATCACG 61.136 55.000 0.00 0.00 0.00 4.35
6529 6591 0.447406 CGCTTCCAATGCAATCACGA 59.553 50.000 0.00 0.00 0.00 4.35
6530 6592 1.791555 CGCTTCCAATGCAATCACGAC 60.792 52.381 0.00 0.00 0.00 4.34
6531 6593 1.199789 GCTTCCAATGCAATCACGACA 59.800 47.619 0.00 0.00 0.00 4.35
6532 6594 2.855180 CTTCCAATGCAATCACGACAC 58.145 47.619 0.00 0.00 0.00 3.67
6533 6595 1.164411 TCCAATGCAATCACGACACC 58.836 50.000 0.00 0.00 0.00 4.16
6534 6596 0.171007 CCAATGCAATCACGACACCC 59.829 55.000 0.00 0.00 0.00 4.61
6535 6597 1.167851 CAATGCAATCACGACACCCT 58.832 50.000 0.00 0.00 0.00 4.34
6536 6598 1.131126 CAATGCAATCACGACACCCTC 59.869 52.381 0.00 0.00 0.00 4.30
6538 6600 1.080093 GCAATCACGACACCCTCGA 60.080 57.895 0.00 0.00 46.14 4.04
6539 6601 1.078759 GCAATCACGACACCCTCGAG 61.079 60.000 5.13 5.13 46.14