Multiple sequence alignment - TraesCS6B01G002400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G002400 chr6B 100.000 2411 0 0 1 2411 1673460 1671050 0.000000e+00 4453
1 TraesCS6B01G002400 chr6B 96.923 195 6 0 659 853 701610122 701609928 6.430000e-86 327
2 TraesCS6B01G002400 chr1B 98.982 393 4 0 1 393 642935685 642936077 0.000000e+00 704
3 TraesCS6B01G002400 chr1B 96.923 195 6 0 657 851 71190206 71190012 6.430000e-86 327
4 TraesCS6B01G002400 chr1B 96.923 195 6 0 657 851 588495262 588495068 6.430000e-86 327
5 TraesCS6B01G002400 chr1B 84.211 247 20 11 1661 1897 173596630 173596393 3.120000e-54 222
6 TraesCS6B01G002400 chr5A 98.977 391 4 0 4 394 6158173 6157783 0.000000e+00 701
7 TraesCS6B01G002400 chr5A 96.939 196 6 0 657 852 548626997 548627192 1.790000e-86 329
8 TraesCS6B01G002400 chr4B 98.489 397 6 0 1 397 410904043 410904439 0.000000e+00 701
9 TraesCS6B01G002400 chr4B 98.780 246 3 0 148 393 410899256 410899501 2.850000e-119 438
10 TraesCS6B01G002400 chr4B 93.233 133 5 4 1657 1788 644578054 644578183 2.450000e-45 193
11 TraesCS6B01G002400 chr2A 98.728 393 5 0 1 393 213240885 213240493 0.000000e+00 699
12 TraesCS6B01G002400 chr2A 80.112 538 80 18 1659 2184 103366420 103366942 2.260000e-100 375
13 TraesCS6B01G002400 chr2A 82.317 164 22 7 1659 1820 179269654 179269496 4.180000e-28 135
14 TraesCS6B01G002400 chr3B 96.305 406 6 2 1 398 682168979 682169383 0.000000e+00 658
15 TraesCS6B01G002400 chr3B 85.958 527 64 8 1659 2184 225459289 225458772 2.710000e-154 555
16 TraesCS6B01G002400 chr3B 85.451 543 60 13 1659 2184 536413507 536412967 4.530000e-152 547
17 TraesCS6B01G002400 chr2B 86.220 537 56 12 1658 2184 664409303 664409831 1.250000e-157 566
18 TraesCS6B01G002400 chr5B 85.448 536 60 10 1659 2184 425712427 425712954 2.110000e-150 542
19 TraesCS6B01G002400 chr5B 83.613 537 64 15 1658 2184 640427416 640427938 1.300000e-132 483
20 TraesCS6B01G002400 chr5B 86.260 393 52 1 1 393 110110509 110110899 2.220000e-115 425
21 TraesCS6B01G002400 chr5B 93.925 214 13 0 1443 1656 356335347 356335134 8.310000e-85 324
22 TraesCS6B01G002400 chr5B 92.174 230 15 1 2185 2411 356335131 356334902 2.990000e-84 322
23 TraesCS6B01G002400 chr7A 87.310 394 47 2 1 394 726495205 726494815 4.730000e-122 448
24 TraesCS6B01G002400 chr1D 82.243 535 78 15 1658 2184 314430061 314429536 1.700000e-121 446
25 TraesCS6B01G002400 chr1D 96.244 213 8 0 1444 1656 14294189 14294401 1.370000e-92 350
26 TraesCS6B01G002400 chr1D 91.189 227 20 0 2185 2411 14294404 14294630 2.330000e-80 309
27 TraesCS6B01G002400 chr7B 82.123 537 75 13 1658 2184 449508749 449508224 7.910000e-120 440
28 TraesCS6B01G002400 chr7B 97.449 196 5 0 656 851 691275946 691275751 3.840000e-88 335
29 TraesCS6B01G002400 chr7B 96.923 195 6 0 659 853 617834105 617834299 6.430000e-86 327
30 TraesCS6B01G002400 chr3D 86.294 394 49 4 1 393 599666944 599667333 7.970000e-115 424
31 TraesCS6B01G002400 chr3D 79.006 543 94 13 1657 2184 83706332 83706869 1.060000e-93 353
32 TraesCS6B01G002400 chr4A 81.192 537 79 18 1658 2182 615001333 615000807 1.720000e-111 412
33 TraesCS6B01G002400 chr4A 94.366 213 12 0 1444 1656 153641614 153641402 6.430000e-86 327
34 TraesCS6B01G002400 chr4A 92.708 192 14 0 2185 2376 153641399 153641208 6.560000e-71 278
35 TraesCS6B01G002400 chr3A 96.916 227 6 1 2185 2411 725449831 725450056 1.750000e-101 379
36 TraesCS6B01G002400 chr3A 98.131 214 4 0 1443 1656 725449615 725449828 8.140000e-100 374
37 TraesCS6B01G002400 chr3A 96.954 197 6 0 656 852 740692110 740691914 4.970000e-87 331
38 TraesCS6B01G002400 chr3A 96.954 197 6 0 656 852 740723704 740723508 4.970000e-87 331
39 TraesCS6B01G002400 chr4D 95.775 213 9 0 1444 1656 3911320 3911108 6.380000e-91 344
40 TraesCS6B01G002400 chr4D 93.833 227 14 0 2185 2411 3911105 3910879 2.300000e-90 342
41 TraesCS6B01G002400 chrUn 96.939 196 6 0 658 853 159075965 159076160 1.790000e-86 329
42 TraesCS6B01G002400 chr6D 89.447 199 21 0 1 199 61437638 61437440 3.980000e-63 252


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G002400 chr6B 1671050 1673460 2410 True 4453 4453 100.000 1 2411 1 chr6B.!!$R1 2410
1 TraesCS6B01G002400 chr2A 103366420 103366942 522 False 375 375 80.112 1659 2184 1 chr2A.!!$F1 525
2 TraesCS6B01G002400 chr3B 225458772 225459289 517 True 555 555 85.958 1659 2184 1 chr3B.!!$R1 525
3 TraesCS6B01G002400 chr3B 536412967 536413507 540 True 547 547 85.451 1659 2184 1 chr3B.!!$R2 525
4 TraesCS6B01G002400 chr2B 664409303 664409831 528 False 566 566 86.220 1658 2184 1 chr2B.!!$F1 526
5 TraesCS6B01G002400 chr5B 425712427 425712954 527 False 542 542 85.448 1659 2184 1 chr5B.!!$F2 525
6 TraesCS6B01G002400 chr5B 640427416 640427938 522 False 483 483 83.613 1658 2184 1 chr5B.!!$F3 526
7 TraesCS6B01G002400 chr1D 314429536 314430061 525 True 446 446 82.243 1658 2184 1 chr1D.!!$R1 526
8 TraesCS6B01G002400 chr7B 449508224 449508749 525 True 440 440 82.123 1658 2184 1 chr7B.!!$R1 526
9 TraesCS6B01G002400 chr3D 83706332 83706869 537 False 353 353 79.006 1657 2184 1 chr3D.!!$F1 527
10 TraesCS6B01G002400 chr4A 615000807 615001333 526 True 412 412 81.192 1658 2182 1 chr4A.!!$R1 524


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
123 124 0.031721 GTCCAGTCTCAACGTTCGGT 59.968 55.0 0.00 0.0 0.00 4.69 F
696 697 0.032130 CTAAGCATCTTAGCGCCGGA 59.968 55.0 5.05 0.0 40.15 5.14 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1325 1326 0.034896 AACGGCTGTTCTGGGTACAG 59.965 55.0 4.68 0.0 46.30 2.74 R
1575 1576 0.035630 AGATGACTTGCTCAGGCACC 60.036 55.0 0.00 0.0 46.55 5.01 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.432262 AAGGTTTCGTTGGGGGAAG 57.568 52.632 0.00 0.00 0.00 3.46
19 20 0.554305 AAGGTTTCGTTGGGGGAAGT 59.446 50.000 0.00 0.00 0.00 3.01
20 21 0.179001 AGGTTTCGTTGGGGGAAGTG 60.179 55.000 0.00 0.00 0.00 3.16
21 22 1.658114 GTTTCGTTGGGGGAAGTGC 59.342 57.895 0.00 0.00 0.00 4.40
22 23 1.894756 TTTCGTTGGGGGAAGTGCG 60.895 57.895 0.00 0.00 0.00 5.34
29 30 4.025401 GGGGAAGTGCGCGTGTTG 62.025 66.667 8.43 0.00 0.00 3.33
30 31 4.683334 GGGAAGTGCGCGTGTTGC 62.683 66.667 8.43 4.01 41.47 4.17
31 32 3.947841 GGAAGTGCGCGTGTTGCA 61.948 61.111 8.43 0.00 46.97 4.08
32 33 2.252260 GAAGTGCGCGTGTTGCAT 59.748 55.556 8.43 0.00 46.97 3.96
33 34 2.051076 AAGTGCGCGTGTTGCATG 60.051 55.556 8.43 0.00 46.97 4.06
34 35 2.715864 GAAGTGCGCGTGTTGCATGT 62.716 55.000 8.43 0.00 46.97 3.21
35 36 2.335052 AAGTGCGCGTGTTGCATGTT 62.335 50.000 8.43 0.00 46.97 2.71
36 37 2.051435 TGCGCGTGTTGCATGTTC 60.051 55.556 8.43 0.00 46.97 3.18
37 38 2.800746 GCGCGTGTTGCATGTTCC 60.801 61.111 8.43 0.00 46.97 3.62
38 39 2.945984 CGCGTGTTGCATGTTCCT 59.054 55.556 0.00 0.00 46.97 3.36
39 40 1.906994 GCGCGTGTTGCATGTTCCTA 61.907 55.000 8.43 0.00 46.97 2.94
40 41 0.179225 CGCGTGTTGCATGTTCCTAC 60.179 55.000 0.00 0.00 46.97 3.18
41 42 1.156736 GCGTGTTGCATGTTCCTACT 58.843 50.000 0.00 0.00 45.45 2.57
42 43 1.535462 GCGTGTTGCATGTTCCTACTT 59.465 47.619 0.00 0.00 45.45 2.24
43 44 2.412847 GCGTGTTGCATGTTCCTACTTC 60.413 50.000 0.00 0.00 45.45 3.01
44 45 2.159627 CGTGTTGCATGTTCCTACTTCC 59.840 50.000 0.00 0.00 0.00 3.46
45 46 3.412386 GTGTTGCATGTTCCTACTTCCT 58.588 45.455 0.00 0.00 0.00 3.36
46 47 3.437049 GTGTTGCATGTTCCTACTTCCTC 59.563 47.826 0.00 0.00 0.00 3.71
47 48 3.010420 GTTGCATGTTCCTACTTCCTCC 58.990 50.000 0.00 0.00 0.00 4.30
48 49 1.559682 TGCATGTTCCTACTTCCTCCC 59.440 52.381 0.00 0.00 0.00 4.30
49 50 1.559682 GCATGTTCCTACTTCCTCCCA 59.440 52.381 0.00 0.00 0.00 4.37
50 51 2.420687 GCATGTTCCTACTTCCTCCCAG 60.421 54.545 0.00 0.00 0.00 4.45
51 52 2.715763 TGTTCCTACTTCCTCCCAGT 57.284 50.000 0.00 0.00 0.00 4.00
52 53 3.839323 TGTTCCTACTTCCTCCCAGTA 57.161 47.619 0.00 0.00 0.00 2.74
53 54 4.348020 TGTTCCTACTTCCTCCCAGTAT 57.652 45.455 0.00 0.00 0.00 2.12
54 55 4.030913 TGTTCCTACTTCCTCCCAGTATG 58.969 47.826 0.00 0.00 0.00 2.39
55 56 2.679082 TCCTACTTCCTCCCAGTATGC 58.321 52.381 0.00 0.00 31.97 3.14
56 57 2.023404 TCCTACTTCCTCCCAGTATGCA 60.023 50.000 0.00 0.00 31.97 3.96
57 58 2.366916 CCTACTTCCTCCCAGTATGCAG 59.633 54.545 0.00 0.00 31.97 4.41
58 59 2.254152 ACTTCCTCCCAGTATGCAGA 57.746 50.000 0.00 0.00 31.97 4.26
59 60 1.834263 ACTTCCTCCCAGTATGCAGAC 59.166 52.381 2.46 2.46 31.97 3.51
60 61 1.833630 CTTCCTCCCAGTATGCAGACA 59.166 52.381 14.90 0.00 31.97 3.41
61 62 2.180946 TCCTCCCAGTATGCAGACAT 57.819 50.000 14.90 0.00 40.49 3.06
62 63 2.042464 TCCTCCCAGTATGCAGACATC 58.958 52.381 14.90 0.00 37.74 3.06
63 64 2.045524 CCTCCCAGTATGCAGACATCT 58.954 52.381 14.90 0.00 37.74 2.90
64 65 2.437281 CCTCCCAGTATGCAGACATCTT 59.563 50.000 14.90 0.00 37.74 2.40
65 66 3.494048 CCTCCCAGTATGCAGACATCTTC 60.494 52.174 14.90 0.00 37.74 2.87
66 67 3.106827 TCCCAGTATGCAGACATCTTCA 58.893 45.455 14.90 0.00 37.74 3.02
67 68 3.118629 TCCCAGTATGCAGACATCTTCAC 60.119 47.826 14.90 0.00 37.74 3.18
68 69 3.201290 CCAGTATGCAGACATCTTCACC 58.799 50.000 14.90 0.00 37.74 4.02
69 70 3.369787 CCAGTATGCAGACATCTTCACCA 60.370 47.826 14.90 0.00 37.74 4.17
70 71 4.256110 CAGTATGCAGACATCTTCACCAA 58.744 43.478 14.90 0.00 37.74 3.67
71 72 4.696877 CAGTATGCAGACATCTTCACCAAA 59.303 41.667 14.90 0.00 37.74 3.28
72 73 4.940046 AGTATGCAGACATCTTCACCAAAG 59.060 41.667 14.90 0.00 37.74 2.77
73 74 2.507484 TGCAGACATCTTCACCAAAGG 58.493 47.619 0.00 0.00 35.54 3.11
74 75 2.106338 TGCAGACATCTTCACCAAAGGA 59.894 45.455 0.00 0.00 35.54 3.36
75 76 2.485814 GCAGACATCTTCACCAAAGGAC 59.514 50.000 0.00 0.00 35.54 3.85
76 77 3.808618 GCAGACATCTTCACCAAAGGACT 60.809 47.826 0.00 0.00 35.54 3.85
77 78 3.750130 CAGACATCTTCACCAAAGGACTG 59.250 47.826 0.00 0.00 35.54 3.51
78 79 2.485814 GACATCTTCACCAAAGGACTGC 59.514 50.000 0.00 0.00 35.54 4.40
79 80 1.815003 CATCTTCACCAAAGGACTGCC 59.185 52.381 0.00 0.00 35.54 4.85
81 82 2.334977 TCTTCACCAAAGGACTGCCTA 58.665 47.619 0.00 0.00 46.28 3.93
82 83 2.038557 TCTTCACCAAAGGACTGCCTAC 59.961 50.000 0.00 0.00 46.28 3.18
83 84 1.729586 TCACCAAAGGACTGCCTACT 58.270 50.000 0.00 0.00 46.28 2.57
84 85 1.347707 TCACCAAAGGACTGCCTACTG 59.652 52.381 0.00 0.00 46.28 2.74
85 86 0.036875 ACCAAAGGACTGCCTACTGC 59.963 55.000 0.00 0.00 46.28 4.40
86 87 0.678048 CCAAAGGACTGCCTACTGCC 60.678 60.000 0.00 0.00 46.28 4.85
87 88 0.036732 CAAAGGACTGCCTACTGCCA 59.963 55.000 0.00 0.00 46.28 4.92
88 89 0.036875 AAAGGACTGCCTACTGCCAC 59.963 55.000 0.00 0.00 46.28 5.01
89 90 0.838122 AAGGACTGCCTACTGCCACT 60.838 55.000 0.00 0.00 46.28 4.00
90 91 0.838122 AGGACTGCCTACTGCCACTT 60.838 55.000 0.00 0.00 44.74 3.16
91 92 0.036875 GGACTGCCTACTGCCACTTT 59.963 55.000 0.00 0.00 40.16 2.66
92 93 1.443802 GACTGCCTACTGCCACTTTC 58.556 55.000 0.00 0.00 40.16 2.62
93 94 0.764890 ACTGCCTACTGCCACTTTCA 59.235 50.000 0.00 0.00 40.16 2.69
94 95 1.160137 CTGCCTACTGCCACTTTCAC 58.840 55.000 0.00 0.00 40.16 3.18
95 96 0.472044 TGCCTACTGCCACTTTCACA 59.528 50.000 0.00 0.00 40.16 3.58
96 97 0.875059 GCCTACTGCCACTTTCACAC 59.125 55.000 0.00 0.00 0.00 3.82
97 98 1.813862 GCCTACTGCCACTTTCACACA 60.814 52.381 0.00 0.00 0.00 3.72
98 99 2.571212 CCTACTGCCACTTTCACACAA 58.429 47.619 0.00 0.00 0.00 3.33
99 100 3.149196 CCTACTGCCACTTTCACACAAT 58.851 45.455 0.00 0.00 0.00 2.71
100 101 3.569701 CCTACTGCCACTTTCACACAATT 59.430 43.478 0.00 0.00 0.00 2.32
101 102 3.715628 ACTGCCACTTTCACACAATTC 57.284 42.857 0.00 0.00 0.00 2.17
102 103 3.023119 ACTGCCACTTTCACACAATTCA 58.977 40.909 0.00 0.00 0.00 2.57
103 104 3.067180 ACTGCCACTTTCACACAATTCAG 59.933 43.478 0.00 0.00 0.00 3.02
104 105 2.361757 TGCCACTTTCACACAATTCAGG 59.638 45.455 0.00 0.00 0.00 3.86
105 106 2.362077 GCCACTTTCACACAATTCAGGT 59.638 45.455 0.00 0.00 0.00 4.00
106 107 3.550842 GCCACTTTCACACAATTCAGGTC 60.551 47.826 0.00 0.00 0.00 3.85
107 108 3.004734 CCACTTTCACACAATTCAGGTCC 59.995 47.826 0.00 0.00 0.00 4.46
108 109 3.631686 CACTTTCACACAATTCAGGTCCA 59.368 43.478 0.00 0.00 0.00 4.02
109 110 3.885297 ACTTTCACACAATTCAGGTCCAG 59.115 43.478 0.00 0.00 0.00 3.86
110 111 3.576078 TTCACACAATTCAGGTCCAGT 57.424 42.857 0.00 0.00 0.00 4.00
111 112 3.126001 TCACACAATTCAGGTCCAGTC 57.874 47.619 0.00 0.00 0.00 3.51
112 113 2.705658 TCACACAATTCAGGTCCAGTCT 59.294 45.455 0.00 0.00 0.00 3.24
113 114 3.070018 CACACAATTCAGGTCCAGTCTC 58.930 50.000 0.00 0.00 0.00 3.36
114 115 2.705658 ACACAATTCAGGTCCAGTCTCA 59.294 45.455 0.00 0.00 0.00 3.27
115 116 3.136443 ACACAATTCAGGTCCAGTCTCAA 59.864 43.478 0.00 0.00 0.00 3.02
116 117 3.499918 CACAATTCAGGTCCAGTCTCAAC 59.500 47.826 0.00 0.00 0.00 3.18
117 118 2.738846 CAATTCAGGTCCAGTCTCAACG 59.261 50.000 0.00 0.00 0.00 4.10
118 119 1.410004 TTCAGGTCCAGTCTCAACGT 58.590 50.000 0.00 0.00 0.00 3.99
119 120 1.410004 TCAGGTCCAGTCTCAACGTT 58.590 50.000 0.00 0.00 0.00 3.99
120 121 1.340248 TCAGGTCCAGTCTCAACGTTC 59.660 52.381 0.00 0.00 0.00 3.95
121 122 0.314302 AGGTCCAGTCTCAACGTTCG 59.686 55.000 0.00 0.00 0.00 3.95
122 123 0.666577 GGTCCAGTCTCAACGTTCGG 60.667 60.000 0.00 0.00 0.00 4.30
123 124 0.031721 GTCCAGTCTCAACGTTCGGT 59.968 55.000 0.00 0.00 0.00 4.69
124 125 0.313043 TCCAGTCTCAACGTTCGGTC 59.687 55.000 0.00 0.00 0.00 4.79
125 126 0.666577 CCAGTCTCAACGTTCGGTCC 60.667 60.000 0.00 0.00 0.00 4.46
126 127 0.314302 CAGTCTCAACGTTCGGTCCT 59.686 55.000 0.00 0.00 0.00 3.85
127 128 0.597072 AGTCTCAACGTTCGGTCCTC 59.403 55.000 0.00 0.00 0.00 3.71
128 129 0.388263 GTCTCAACGTTCGGTCCTCC 60.388 60.000 0.00 0.00 0.00 4.30
129 130 1.080025 CTCAACGTTCGGTCCTCCC 60.080 63.158 0.00 0.00 0.00 4.30
130 131 1.812686 CTCAACGTTCGGTCCTCCCA 61.813 60.000 0.00 0.00 0.00 4.37
131 132 1.666872 CAACGTTCGGTCCTCCCAC 60.667 63.158 0.00 0.00 0.00 4.61
132 133 3.216944 AACGTTCGGTCCTCCCACG 62.217 63.158 0.00 0.00 40.58 4.94
133 134 3.367743 CGTTCGGTCCTCCCACGA 61.368 66.667 0.00 0.00 38.46 4.35
134 135 2.707849 CGTTCGGTCCTCCCACGAT 61.708 63.158 0.00 0.00 38.46 3.73
135 136 1.153628 GTTCGGTCCTCCCACGATG 60.154 63.158 0.00 0.00 36.43 3.84
136 137 1.304630 TTCGGTCCTCCCACGATGA 60.305 57.895 0.00 0.00 36.43 2.92
137 138 1.320344 TTCGGTCCTCCCACGATGAG 61.320 60.000 0.00 0.00 36.43 2.90
138 139 1.753078 CGGTCCTCCCACGATGAGA 60.753 63.158 0.00 0.00 31.26 3.27
139 140 1.817209 GGTCCTCCCACGATGAGAC 59.183 63.158 0.00 0.00 31.26 3.36
140 141 0.684805 GGTCCTCCCACGATGAGACT 60.685 60.000 0.00 0.00 31.26 3.24
141 142 0.457851 GTCCTCCCACGATGAGACTG 59.542 60.000 0.00 0.00 31.26 3.51
142 143 1.142748 CCTCCCACGATGAGACTGC 59.857 63.158 0.00 0.00 31.26 4.40
143 144 1.226802 CTCCCACGATGAGACTGCG 60.227 63.158 0.00 0.00 31.26 5.18
144 145 2.202797 CCCACGATGAGACTGCGG 60.203 66.667 0.00 0.00 0.00 5.69
145 146 2.202797 CCACGATGAGACTGCGGG 60.203 66.667 0.00 0.00 0.00 6.13
146 147 2.202797 CACGATGAGACTGCGGGG 60.203 66.667 0.00 0.00 0.00 5.73
147 148 3.461773 ACGATGAGACTGCGGGGG 61.462 66.667 0.00 0.00 0.00 5.40
163 164 2.693267 GGGGGCTGTTAGACTACTTG 57.307 55.000 0.00 0.00 0.00 3.16
164 165 1.907255 GGGGGCTGTTAGACTACTTGT 59.093 52.381 0.00 0.00 0.00 3.16
165 166 3.102204 GGGGGCTGTTAGACTACTTGTA 58.898 50.000 0.00 0.00 0.00 2.41
166 167 3.710165 GGGGGCTGTTAGACTACTTGTAT 59.290 47.826 0.00 0.00 0.00 2.29
167 168 4.163649 GGGGGCTGTTAGACTACTTGTATT 59.836 45.833 0.00 0.00 0.00 1.89
168 169 5.116882 GGGGCTGTTAGACTACTTGTATTG 58.883 45.833 0.00 0.00 0.00 1.90
169 170 5.116882 GGGCTGTTAGACTACTTGTATTGG 58.883 45.833 0.00 0.00 0.00 3.16
170 171 5.338137 GGGCTGTTAGACTACTTGTATTGGT 60.338 44.000 0.00 0.00 0.00 3.67
171 172 5.811100 GGCTGTTAGACTACTTGTATTGGTC 59.189 44.000 0.00 0.00 0.00 4.02
172 173 6.351117 GGCTGTTAGACTACTTGTATTGGTCT 60.351 42.308 0.00 0.00 39.95 3.85
173 174 6.752815 GCTGTTAGACTACTTGTATTGGTCTC 59.247 42.308 0.00 0.00 38.13 3.36
174 175 7.166691 TGTTAGACTACTTGTATTGGTCTCC 57.833 40.000 0.00 0.00 38.13 3.71
175 176 6.952358 TGTTAGACTACTTGTATTGGTCTCCT 59.048 38.462 0.00 0.00 38.13 3.69
176 177 8.111545 TGTTAGACTACTTGTATTGGTCTCCTA 58.888 37.037 0.00 0.00 38.13 2.94
177 178 8.404765 GTTAGACTACTTGTATTGGTCTCCTAC 58.595 40.741 0.00 0.00 38.13 3.18
178 179 5.589452 AGACTACTTGTATTGGTCTCCTACG 59.411 44.000 0.00 0.00 32.66 3.51
179 180 3.521947 ACTTGTATTGGTCTCCTACGC 57.478 47.619 0.00 0.00 0.00 4.42
180 181 3.097614 ACTTGTATTGGTCTCCTACGCT 58.902 45.455 0.00 0.00 0.00 5.07
181 182 4.275810 ACTTGTATTGGTCTCCTACGCTA 58.724 43.478 0.00 0.00 0.00 4.26
182 183 4.894114 ACTTGTATTGGTCTCCTACGCTAT 59.106 41.667 0.00 0.00 0.00 2.97
183 184 5.009811 ACTTGTATTGGTCTCCTACGCTATC 59.990 44.000 0.00 0.00 0.00 2.08
184 185 3.501062 TGTATTGGTCTCCTACGCTATCG 59.499 47.826 0.00 0.00 42.43 2.92
185 186 1.315690 TTGGTCTCCTACGCTATCGG 58.684 55.000 0.00 0.00 40.69 4.18
186 187 1.170919 TGGTCTCCTACGCTATCGGC 61.171 60.000 0.00 0.00 40.69 5.54
187 188 0.890090 GGTCTCCTACGCTATCGGCT 60.890 60.000 0.00 0.00 40.69 5.52
188 189 0.953003 GTCTCCTACGCTATCGGCTT 59.047 55.000 0.00 0.00 40.69 4.35
189 190 0.952280 TCTCCTACGCTATCGGCTTG 59.048 55.000 0.00 0.00 40.69 4.01
190 191 0.952280 CTCCTACGCTATCGGCTTGA 59.048 55.000 0.00 0.00 40.69 3.02
191 192 0.952280 TCCTACGCTATCGGCTTGAG 59.048 55.000 0.00 0.00 40.69 3.02
192 193 0.664767 CCTACGCTATCGGCTTGAGC 60.665 60.000 0.00 0.00 40.69 4.26
193 194 0.312416 CTACGCTATCGGCTTGAGCT 59.688 55.000 2.66 0.00 41.70 4.09
195 196 1.953138 CGCTATCGGCTTGAGCTGG 60.953 63.158 11.63 0.73 46.99 4.85
196 197 1.144936 GCTATCGGCTTGAGCTGGT 59.855 57.895 11.63 7.38 46.99 4.00
197 198 0.878086 GCTATCGGCTTGAGCTGGTC 60.878 60.000 11.63 0.00 46.99 4.02
198 199 0.461548 CTATCGGCTTGAGCTGGTCA 59.538 55.000 11.63 5.28 46.99 4.02
199 200 0.901827 TATCGGCTTGAGCTGGTCAA 59.098 50.000 19.85 19.85 46.99 3.18
205 206 2.706636 TTGAGCTGGTCAAGTGTGC 58.293 52.632 17.52 0.00 40.45 4.57
206 207 0.819259 TTGAGCTGGTCAAGTGTGCC 60.819 55.000 17.52 0.00 40.45 5.01
207 208 1.072159 GAGCTGGTCAAGTGTGCCT 59.928 57.895 1.28 0.00 0.00 4.75
208 209 0.536006 GAGCTGGTCAAGTGTGCCTT 60.536 55.000 1.28 0.00 0.00 4.35
209 210 0.764890 AGCTGGTCAAGTGTGCCTTA 59.235 50.000 0.00 0.00 0.00 2.69
210 211 1.352352 AGCTGGTCAAGTGTGCCTTAT 59.648 47.619 0.00 0.00 0.00 1.73
211 212 1.740025 GCTGGTCAAGTGTGCCTTATC 59.260 52.381 0.00 0.00 0.00 1.75
212 213 2.359900 CTGGTCAAGTGTGCCTTATCC 58.640 52.381 0.00 0.00 0.00 2.59
213 214 1.004277 TGGTCAAGTGTGCCTTATCCC 59.996 52.381 0.00 0.00 0.00 3.85
214 215 1.369625 GTCAAGTGTGCCTTATCCCG 58.630 55.000 0.00 0.00 0.00 5.14
215 216 0.392461 TCAAGTGTGCCTTATCCCGC 60.392 55.000 0.00 0.00 0.00 6.13
216 217 1.077716 AAGTGTGCCTTATCCCGCC 60.078 57.895 0.00 0.00 0.00 6.13
217 218 2.869503 AAGTGTGCCTTATCCCGCCG 62.870 60.000 0.00 0.00 0.00 6.46
218 219 3.078196 TGTGCCTTATCCCGCCGA 61.078 61.111 0.00 0.00 0.00 5.54
219 220 2.588034 GTGCCTTATCCCGCCGAC 60.588 66.667 0.00 0.00 0.00 4.79
220 221 4.215742 TGCCTTATCCCGCCGACG 62.216 66.667 0.00 0.00 39.67 5.12
221 222 4.217159 GCCTTATCCCGCCGACGT 62.217 66.667 0.00 0.00 37.70 4.34
222 223 2.497770 CCTTATCCCGCCGACGTT 59.502 61.111 0.00 0.00 37.70 3.99
223 224 1.881252 CCTTATCCCGCCGACGTTG 60.881 63.158 0.00 0.00 37.70 4.10
224 225 2.509786 TTATCCCGCCGACGTTGC 60.510 61.111 0.00 0.00 37.70 4.17
225 226 3.298115 TTATCCCGCCGACGTTGCA 62.298 57.895 10.97 0.00 37.70 4.08
226 227 2.581208 TTATCCCGCCGACGTTGCAT 62.581 55.000 10.97 1.01 37.70 3.96
247 248 2.100991 GCATGCAGCGCAACTACC 59.899 61.111 14.21 0.00 43.62 3.18
248 249 2.793946 CATGCAGCGCAACTACCC 59.206 61.111 11.47 0.00 43.62 3.69
249 250 2.039974 CATGCAGCGCAACTACCCA 61.040 57.895 11.47 0.00 43.62 4.51
250 251 1.077501 ATGCAGCGCAACTACCCAT 60.078 52.632 11.47 0.00 43.62 4.00
251 252 1.097547 ATGCAGCGCAACTACCCATC 61.098 55.000 11.47 0.00 43.62 3.51
252 253 2.813179 GCAGCGCAACTACCCATCG 61.813 63.158 11.47 0.00 0.00 3.84
253 254 1.153647 CAGCGCAACTACCCATCGA 60.154 57.895 11.47 0.00 0.00 3.59
254 255 0.530650 CAGCGCAACTACCCATCGAT 60.531 55.000 11.47 0.00 0.00 3.59
255 256 0.249489 AGCGCAACTACCCATCGATC 60.249 55.000 11.47 0.00 0.00 3.69
256 257 0.249489 GCGCAACTACCCATCGATCT 60.249 55.000 0.30 0.00 0.00 2.75
257 258 1.000607 GCGCAACTACCCATCGATCTA 60.001 52.381 0.30 0.00 0.00 1.98
258 259 2.922758 GCGCAACTACCCATCGATCTAG 60.923 54.545 0.30 0.00 0.00 2.43
259 260 2.351835 CGCAACTACCCATCGATCTAGG 60.352 54.545 0.00 0.00 0.00 3.02
260 261 2.891580 GCAACTACCCATCGATCTAGGA 59.108 50.000 11.64 0.00 0.00 2.94
261 262 3.511934 GCAACTACCCATCGATCTAGGAT 59.488 47.826 11.64 0.00 0.00 3.24
262 263 4.381079 GCAACTACCCATCGATCTAGGATC 60.381 50.000 11.64 0.00 0.00 3.36
263 264 3.611970 ACTACCCATCGATCTAGGATCG 58.388 50.000 19.74 19.74 42.38 3.69
273 274 6.819397 TCGATCTAGGATCGATTGTTGTAT 57.181 37.500 23.02 0.00 44.42 2.29
274 275 7.215719 TCGATCTAGGATCGATTGTTGTATT 57.784 36.000 23.02 0.00 44.42 1.89
275 276 7.306213 TCGATCTAGGATCGATTGTTGTATTC 58.694 38.462 23.02 0.00 44.42 1.75
276 277 7.040686 TCGATCTAGGATCGATTGTTGTATTCA 60.041 37.037 23.02 2.81 44.42 2.57
277 278 7.272299 CGATCTAGGATCGATTGTTGTATTCAG 59.728 40.741 20.77 0.00 43.59 3.02
278 279 7.348080 TCTAGGATCGATTGTTGTATTCAGT 57.652 36.000 0.00 0.00 0.00 3.41
279 280 7.782049 TCTAGGATCGATTGTTGTATTCAGTT 58.218 34.615 0.00 0.00 0.00 3.16
280 281 8.909923 TCTAGGATCGATTGTTGTATTCAGTTA 58.090 33.333 0.00 0.00 0.00 2.24
281 282 9.186323 CTAGGATCGATTGTTGTATTCAGTTAG 57.814 37.037 0.00 0.00 0.00 2.34
282 283 7.782049 AGGATCGATTGTTGTATTCAGTTAGA 58.218 34.615 0.00 0.00 0.00 2.10
283 284 7.923344 AGGATCGATTGTTGTATTCAGTTAGAG 59.077 37.037 0.00 0.00 0.00 2.43
284 285 7.921214 GGATCGATTGTTGTATTCAGTTAGAGA 59.079 37.037 0.00 0.00 0.00 3.10
285 286 8.864069 ATCGATTGTTGTATTCAGTTAGAGAG 57.136 34.615 0.00 0.00 0.00 3.20
286 287 7.827701 TCGATTGTTGTATTCAGTTAGAGAGT 58.172 34.615 0.00 0.00 0.00 3.24
287 288 7.755373 TCGATTGTTGTATTCAGTTAGAGAGTG 59.245 37.037 0.00 0.00 0.00 3.51
288 289 7.463383 CGATTGTTGTATTCAGTTAGAGAGTGC 60.463 40.741 0.00 0.00 0.00 4.40
289 290 6.096673 TGTTGTATTCAGTTAGAGAGTGCA 57.903 37.500 0.00 0.00 0.00 4.57
290 291 6.701340 TGTTGTATTCAGTTAGAGAGTGCAT 58.299 36.000 0.00 0.00 0.00 3.96
291 292 6.591448 TGTTGTATTCAGTTAGAGAGTGCATG 59.409 38.462 0.00 0.00 0.00 4.06
292 293 6.286240 TGTATTCAGTTAGAGAGTGCATGT 57.714 37.500 0.00 0.00 0.00 3.21
293 294 6.101997 TGTATTCAGTTAGAGAGTGCATGTG 58.898 40.000 0.00 0.00 0.00 3.21
294 295 4.607293 TTCAGTTAGAGAGTGCATGTGT 57.393 40.909 0.00 0.00 0.00 3.72
295 296 5.722021 TTCAGTTAGAGAGTGCATGTGTA 57.278 39.130 0.00 0.00 0.00 2.90
296 297 5.921962 TCAGTTAGAGAGTGCATGTGTAT 57.078 39.130 0.00 0.00 0.00 2.29
297 298 5.895928 TCAGTTAGAGAGTGCATGTGTATC 58.104 41.667 0.00 0.00 0.00 2.24
298 299 5.654209 TCAGTTAGAGAGTGCATGTGTATCT 59.346 40.000 0.00 0.00 0.00 1.98
299 300 6.153510 TCAGTTAGAGAGTGCATGTGTATCTT 59.846 38.462 0.00 0.00 0.00 2.40
300 301 6.475076 CAGTTAGAGAGTGCATGTGTATCTTC 59.525 42.308 0.00 0.00 0.00 2.87
301 302 6.379703 AGTTAGAGAGTGCATGTGTATCTTCT 59.620 38.462 0.00 0.00 0.00 2.85
302 303 5.674052 AGAGAGTGCATGTGTATCTTCTT 57.326 39.130 0.00 0.00 0.00 2.52
303 304 5.659463 AGAGAGTGCATGTGTATCTTCTTC 58.341 41.667 0.00 0.00 0.00 2.87
304 305 5.421693 AGAGAGTGCATGTGTATCTTCTTCT 59.578 40.000 0.00 0.00 0.00 2.85
305 306 5.659463 AGAGTGCATGTGTATCTTCTTCTC 58.341 41.667 0.00 0.00 0.00 2.87
306 307 4.764172 AGTGCATGTGTATCTTCTTCTCC 58.236 43.478 0.00 0.00 0.00 3.71
307 308 4.469227 AGTGCATGTGTATCTTCTTCTCCT 59.531 41.667 0.00 0.00 0.00 3.69
308 309 4.808364 GTGCATGTGTATCTTCTTCTCCTC 59.192 45.833 0.00 0.00 0.00 3.71
309 310 4.713814 TGCATGTGTATCTTCTTCTCCTCT 59.286 41.667 0.00 0.00 0.00 3.69
310 311 5.163468 TGCATGTGTATCTTCTTCTCCTCTC 60.163 44.000 0.00 0.00 0.00 3.20
311 312 5.068987 GCATGTGTATCTTCTTCTCCTCTCT 59.931 44.000 0.00 0.00 0.00 3.10
312 313 6.735694 GCATGTGTATCTTCTTCTCCTCTCTC 60.736 46.154 0.00 0.00 0.00 3.20
313 314 5.821097 TGTGTATCTTCTTCTCCTCTCTCA 58.179 41.667 0.00 0.00 0.00 3.27
314 315 5.650266 TGTGTATCTTCTTCTCCTCTCTCAC 59.350 44.000 0.00 0.00 0.00 3.51
315 316 5.885912 GTGTATCTTCTTCTCCTCTCTCACT 59.114 44.000 0.00 0.00 0.00 3.41
316 317 5.885352 TGTATCTTCTTCTCCTCTCTCACTG 59.115 44.000 0.00 0.00 0.00 3.66
317 318 4.649267 TCTTCTTCTCCTCTCTCACTGA 57.351 45.455 0.00 0.00 0.00 3.41
318 319 5.191727 TCTTCTTCTCCTCTCTCACTGAT 57.808 43.478 0.00 0.00 0.00 2.90
319 320 4.949238 TCTTCTTCTCCTCTCTCACTGATG 59.051 45.833 0.00 0.00 0.00 3.07
320 321 4.314522 TCTTCTCCTCTCTCACTGATGT 57.685 45.455 0.00 0.00 0.00 3.06
321 322 5.443230 TCTTCTCCTCTCTCACTGATGTA 57.557 43.478 0.00 0.00 0.00 2.29
322 323 5.821097 TCTTCTCCTCTCTCACTGATGTAA 58.179 41.667 0.00 0.00 0.00 2.41
323 324 6.430864 TCTTCTCCTCTCTCACTGATGTAAT 58.569 40.000 0.00 0.00 0.00 1.89
324 325 6.545666 TCTTCTCCTCTCTCACTGATGTAATC 59.454 42.308 0.00 0.00 45.83 1.75
325 326 6.012337 TCTCCTCTCTCACTGATGTAATCT 57.988 41.667 0.00 0.00 45.81 2.40
326 327 7.142995 TCTCCTCTCTCACTGATGTAATCTA 57.857 40.000 0.00 0.00 45.81 1.98
327 328 7.754624 TCTCCTCTCTCACTGATGTAATCTAT 58.245 38.462 0.00 0.00 45.81 1.98
328 329 8.885346 TCTCCTCTCTCACTGATGTAATCTATA 58.115 37.037 0.00 0.00 45.81 1.31
329 330 9.685276 CTCCTCTCTCACTGATGTAATCTATAT 57.315 37.037 0.00 0.00 45.81 0.86
347 348 9.574577 AATCTATATATCATTACCCCTTGTGGA 57.425 33.333 0.00 0.00 35.39 4.02
348 349 9.749996 ATCTATATATCATTACCCCTTGTGGAT 57.250 33.333 0.00 0.00 35.39 3.41
349 350 8.992349 TCTATATATCATTACCCCTTGTGGATG 58.008 37.037 0.00 0.00 35.39 3.51
350 351 7.829224 ATATATCATTACCCCTTGTGGATGA 57.171 36.000 0.00 0.00 36.17 2.92
351 352 4.879295 ATCATTACCCCTTGTGGATGAA 57.121 40.909 0.00 0.00 35.69 2.57
352 353 4.879295 TCATTACCCCTTGTGGATGAAT 57.121 40.909 0.00 0.00 35.39 2.57
353 354 5.985175 TCATTACCCCTTGTGGATGAATA 57.015 39.130 0.00 0.00 35.39 1.75
354 355 5.690865 TCATTACCCCTTGTGGATGAATAC 58.309 41.667 0.00 0.00 35.39 1.89
355 356 5.192722 TCATTACCCCTTGTGGATGAATACA 59.807 40.000 0.00 0.00 35.39 2.29
356 357 5.522315 TTACCCCTTGTGGATGAATACAA 57.478 39.130 0.00 0.00 35.39 2.41
361 362 4.007282 CTTGTGGATGAATACAAGCGTG 57.993 45.455 0.00 0.00 44.81 5.34
362 363 3.326836 TGTGGATGAATACAAGCGTGA 57.673 42.857 6.65 0.00 0.00 4.35
363 364 3.872696 TGTGGATGAATACAAGCGTGAT 58.127 40.909 6.65 0.00 0.00 3.06
364 365 3.622612 TGTGGATGAATACAAGCGTGATG 59.377 43.478 6.65 0.00 0.00 3.07
365 366 2.613595 TGGATGAATACAAGCGTGATGC 59.386 45.455 6.65 0.00 46.98 3.91
374 375 4.792106 GCGTGATGCATCCCAAAC 57.208 55.556 23.67 13.75 45.45 2.93
375 376 2.183409 GCGTGATGCATCCCAAACT 58.817 52.632 23.67 0.00 45.45 2.66
376 377 0.099436 GCGTGATGCATCCCAAACTC 59.901 55.000 23.67 6.67 45.45 3.01
377 378 1.452110 CGTGATGCATCCCAAACTCA 58.548 50.000 23.67 0.80 0.00 3.41
378 379 2.019249 CGTGATGCATCCCAAACTCAT 58.981 47.619 23.67 0.00 0.00 2.90
379 380 2.032550 CGTGATGCATCCCAAACTCATC 59.967 50.000 23.67 0.00 35.40 2.92
380 381 3.285484 GTGATGCATCCCAAACTCATCT 58.715 45.455 23.67 0.00 35.74 2.90
381 382 3.314635 GTGATGCATCCCAAACTCATCTC 59.685 47.826 23.67 0.00 35.74 2.75
382 383 3.054213 TGATGCATCCCAAACTCATCTCA 60.054 43.478 23.67 0.00 35.74 3.27
383 384 3.438216 TGCATCCCAAACTCATCTCAA 57.562 42.857 0.00 0.00 0.00 3.02
384 385 3.972133 TGCATCCCAAACTCATCTCAAT 58.028 40.909 0.00 0.00 0.00 2.57
385 386 4.346730 TGCATCCCAAACTCATCTCAATT 58.653 39.130 0.00 0.00 0.00 2.32
386 387 4.400251 TGCATCCCAAACTCATCTCAATTC 59.600 41.667 0.00 0.00 0.00 2.17
387 388 4.643784 GCATCCCAAACTCATCTCAATTCT 59.356 41.667 0.00 0.00 0.00 2.40
388 389 5.126707 GCATCCCAAACTCATCTCAATTCTT 59.873 40.000 0.00 0.00 0.00 2.52
389 390 6.319658 GCATCCCAAACTCATCTCAATTCTTA 59.680 38.462 0.00 0.00 0.00 2.10
390 391 7.148018 GCATCCCAAACTCATCTCAATTCTTAA 60.148 37.037 0.00 0.00 0.00 1.85
391 392 7.687941 TCCCAAACTCATCTCAATTCTTAAC 57.312 36.000 0.00 0.00 0.00 2.01
392 393 7.230747 TCCCAAACTCATCTCAATTCTTAACA 58.769 34.615 0.00 0.00 0.00 2.41
393 394 7.391554 TCCCAAACTCATCTCAATTCTTAACAG 59.608 37.037 0.00 0.00 0.00 3.16
394 395 7.025963 CCAAACTCATCTCAATTCTTAACAGC 58.974 38.462 0.00 0.00 0.00 4.40
395 396 6.749923 AACTCATCTCAATTCTTAACAGCC 57.250 37.500 0.00 0.00 0.00 4.85
396 397 4.872691 ACTCATCTCAATTCTTAACAGCCG 59.127 41.667 0.00 0.00 0.00 5.52
397 398 5.084818 TCATCTCAATTCTTAACAGCCGA 57.915 39.130 0.00 0.00 0.00 5.54
398 399 5.487433 TCATCTCAATTCTTAACAGCCGAA 58.513 37.500 0.00 0.00 0.00 4.30
399 400 5.937540 TCATCTCAATTCTTAACAGCCGAAA 59.062 36.000 0.00 0.00 0.00 3.46
400 401 5.862924 TCTCAATTCTTAACAGCCGAAAG 57.137 39.130 0.00 0.00 0.00 2.62
401 402 5.305585 TCTCAATTCTTAACAGCCGAAAGT 58.694 37.500 0.00 0.00 0.00 2.66
402 403 5.179368 TCTCAATTCTTAACAGCCGAAAGTG 59.821 40.000 0.00 0.00 0.00 3.16
403 404 4.215399 TCAATTCTTAACAGCCGAAAGTGG 59.785 41.667 0.00 0.00 0.00 4.00
404 405 3.478857 TTCTTAACAGCCGAAAGTGGA 57.521 42.857 0.00 0.00 0.00 4.02
405 406 3.040147 TCTTAACAGCCGAAAGTGGAG 57.960 47.619 0.00 0.00 0.00 3.86
406 407 2.631062 TCTTAACAGCCGAAAGTGGAGA 59.369 45.455 0.00 0.00 0.00 3.71
407 408 3.070446 TCTTAACAGCCGAAAGTGGAGAA 59.930 43.478 0.00 0.00 0.00 2.87
408 409 1.594331 AACAGCCGAAAGTGGAGAAC 58.406 50.000 0.00 0.00 0.00 3.01
409 410 0.468226 ACAGCCGAAAGTGGAGAACA 59.532 50.000 0.00 0.00 0.00 3.18
410 411 1.072331 ACAGCCGAAAGTGGAGAACAT 59.928 47.619 0.00 0.00 0.00 2.71
411 412 1.734465 CAGCCGAAAGTGGAGAACATC 59.266 52.381 0.00 0.00 0.00 3.06
412 413 1.347707 AGCCGAAAGTGGAGAACATCA 59.652 47.619 0.00 0.00 0.00 3.07
413 414 2.026822 AGCCGAAAGTGGAGAACATCAT 60.027 45.455 0.00 0.00 0.00 2.45
414 415 2.352960 GCCGAAAGTGGAGAACATCATC 59.647 50.000 0.00 0.00 0.00 2.92
415 416 3.599343 CCGAAAGTGGAGAACATCATCA 58.401 45.455 0.00 0.00 0.00 3.07
416 417 4.002982 CCGAAAGTGGAGAACATCATCAA 58.997 43.478 0.00 0.00 0.00 2.57
417 418 4.142816 CCGAAAGTGGAGAACATCATCAAC 60.143 45.833 0.00 0.00 0.00 3.18
418 419 4.452114 CGAAAGTGGAGAACATCATCAACA 59.548 41.667 0.00 0.00 0.00 3.33
419 420 5.615544 CGAAAGTGGAGAACATCATCAACAC 60.616 44.000 0.00 0.00 0.00 3.32
420 421 4.630644 AGTGGAGAACATCATCAACACT 57.369 40.909 0.00 0.00 35.26 3.55
421 422 4.321718 AGTGGAGAACATCATCAACACTG 58.678 43.478 0.00 0.00 37.25 3.66
422 423 3.438087 GTGGAGAACATCATCAACACTGG 59.562 47.826 0.00 0.00 0.00 4.00
423 424 3.072915 TGGAGAACATCATCAACACTGGT 59.927 43.478 0.00 0.00 0.00 4.00
424 425 3.686726 GGAGAACATCATCAACACTGGTC 59.313 47.826 0.00 0.00 0.00 4.02
425 426 3.679389 AGAACATCATCAACACTGGTCC 58.321 45.455 0.00 0.00 0.00 4.46
426 427 3.328931 AGAACATCATCAACACTGGTCCT 59.671 43.478 0.00 0.00 0.00 3.85
427 428 3.063510 ACATCATCAACACTGGTCCTG 57.936 47.619 0.00 0.00 0.00 3.86
428 429 2.639347 ACATCATCAACACTGGTCCTGA 59.361 45.455 2.23 0.00 0.00 3.86
429 430 3.072915 ACATCATCAACACTGGTCCTGAA 59.927 43.478 2.23 0.00 0.00 3.02
430 431 4.263639 ACATCATCAACACTGGTCCTGAAT 60.264 41.667 2.23 0.00 0.00 2.57
431 432 3.678289 TCATCAACACTGGTCCTGAATG 58.322 45.455 2.23 0.00 0.00 2.67
432 433 2.566833 TCAACACTGGTCCTGAATGG 57.433 50.000 2.23 0.00 37.10 3.16
433 434 2.054021 TCAACACTGGTCCTGAATGGA 58.946 47.619 2.23 0.00 43.86 3.41
450 451 6.069684 GAATGGATAATTCACCTGCTTGAG 57.930 41.667 0.00 0.00 43.68 3.02
451 452 5.009410 GAATGGATAATTCACCTGCTTGAGG 59.991 44.000 0.00 0.00 43.68 3.86
452 453 7.909322 GAATGGATAATTCACCTGCTTGAGGG 61.909 46.154 0.00 0.00 43.68 4.30
453 454 9.967715 GAATGGATAATTCACCTGCTTGAGGGA 62.968 44.444 0.00 0.00 43.68 4.20
458 459 3.915575 CCTGCTTGAGGGATGCAC 58.084 61.111 0.00 0.00 38.36 4.57
459 460 1.302285 CCTGCTTGAGGGATGCACT 59.698 57.895 0.00 0.00 38.36 4.40
460 461 0.747283 CCTGCTTGAGGGATGCACTC 60.747 60.000 0.00 0.00 38.36 3.51
461 462 0.035725 CTGCTTGAGGGATGCACTCA 60.036 55.000 1.56 1.56 42.81 3.41
462 463 0.622136 TGCTTGAGGGATGCACTCAT 59.378 50.000 6.36 0.00 43.82 2.90
463 464 1.022735 GCTTGAGGGATGCACTCATG 58.977 55.000 6.36 9.56 43.82 3.07
464 465 1.407851 GCTTGAGGGATGCACTCATGA 60.408 52.381 17.67 0.00 43.82 3.07
465 466 2.942752 GCTTGAGGGATGCACTCATGAA 60.943 50.000 17.67 0.17 43.82 2.57
466 467 2.704464 TGAGGGATGCACTCATGAAG 57.296 50.000 1.56 0.00 39.87 3.02
467 468 2.190538 TGAGGGATGCACTCATGAAGA 58.809 47.619 1.56 0.00 39.87 2.87
481 482 2.450619 GAAGAGCGTCTTCCAGTGC 58.549 57.895 13.53 0.00 45.34 4.40
482 483 0.037790 GAAGAGCGTCTTCCAGTGCT 60.038 55.000 13.53 0.00 45.34 4.40
483 484 1.202582 GAAGAGCGTCTTCCAGTGCTA 59.797 52.381 13.53 0.00 45.34 3.49
484 485 1.257743 AGAGCGTCTTCCAGTGCTAA 58.742 50.000 0.00 0.00 37.91 3.09
485 486 1.827969 AGAGCGTCTTCCAGTGCTAAT 59.172 47.619 0.00 0.00 37.91 1.73
486 487 1.929836 GAGCGTCTTCCAGTGCTAATG 59.070 52.381 0.00 0.00 37.91 1.90
487 488 1.550524 AGCGTCTTCCAGTGCTAATGA 59.449 47.619 0.00 0.00 35.56 2.57
488 489 1.661112 GCGTCTTCCAGTGCTAATGAC 59.339 52.381 0.00 0.00 0.00 3.06
489 490 1.920574 CGTCTTCCAGTGCTAATGACG 59.079 52.381 0.00 0.00 39.43 4.35
490 491 1.661112 GTCTTCCAGTGCTAATGACGC 59.339 52.381 0.00 0.00 0.00 5.19
491 492 1.550524 TCTTCCAGTGCTAATGACGCT 59.449 47.619 0.00 0.00 0.00 5.07
492 493 2.758423 TCTTCCAGTGCTAATGACGCTA 59.242 45.455 0.00 0.00 0.00 4.26
493 494 3.384789 TCTTCCAGTGCTAATGACGCTAT 59.615 43.478 0.00 0.00 0.00 2.97
494 495 3.097877 TCCAGTGCTAATGACGCTATG 57.902 47.619 0.00 0.00 0.00 2.23
495 496 2.138320 CCAGTGCTAATGACGCTATGG 58.862 52.381 0.00 0.00 0.00 2.74
496 497 2.224042 CCAGTGCTAATGACGCTATGGA 60.224 50.000 0.00 0.00 36.46 3.41
497 498 3.055591 CAGTGCTAATGACGCTATGGAG 58.944 50.000 0.00 0.00 0.00 3.86
498 499 2.036475 AGTGCTAATGACGCTATGGAGG 59.964 50.000 0.00 0.00 0.00 4.30
499 500 2.035961 GTGCTAATGACGCTATGGAGGA 59.964 50.000 0.00 0.00 0.00 3.71
500 501 2.698274 TGCTAATGACGCTATGGAGGAA 59.302 45.455 0.00 0.00 0.00 3.36
501 502 3.324846 TGCTAATGACGCTATGGAGGAAT 59.675 43.478 0.00 0.00 0.00 3.01
502 503 4.202357 TGCTAATGACGCTATGGAGGAATT 60.202 41.667 0.00 0.00 0.00 2.17
503 504 4.153117 GCTAATGACGCTATGGAGGAATTG 59.847 45.833 0.00 0.00 0.00 2.32
504 505 2.620251 TGACGCTATGGAGGAATTGG 57.380 50.000 0.00 0.00 0.00 3.16
505 506 1.837439 TGACGCTATGGAGGAATTGGT 59.163 47.619 0.00 0.00 0.00 3.67
506 507 3.035363 TGACGCTATGGAGGAATTGGTA 58.965 45.455 0.00 0.00 0.00 3.25
507 508 3.181469 TGACGCTATGGAGGAATTGGTAC 60.181 47.826 0.00 0.00 0.00 3.34
508 509 2.223971 ACGCTATGGAGGAATTGGTACG 60.224 50.000 0.00 0.00 0.00 3.67
509 510 2.223971 CGCTATGGAGGAATTGGTACGT 60.224 50.000 0.00 0.00 0.00 3.57
510 511 3.391049 GCTATGGAGGAATTGGTACGTC 58.609 50.000 0.00 0.00 0.00 4.34
511 512 3.802675 GCTATGGAGGAATTGGTACGTCC 60.803 52.174 0.00 0.00 40.22 4.79
512 513 0.533491 TGGAGGAATTGGTACGTCCG 59.467 55.000 0.00 0.00 41.93 4.79
513 514 0.819582 GGAGGAATTGGTACGTCCGA 59.180 55.000 0.00 0.00 39.52 4.55
514 515 1.205417 GGAGGAATTGGTACGTCCGAA 59.795 52.381 0.00 0.00 39.52 4.30
515 516 2.354003 GGAGGAATTGGTACGTCCGAAA 60.354 50.000 0.00 0.00 39.52 3.46
516 517 3.528532 GAGGAATTGGTACGTCCGAAAT 58.471 45.455 0.00 0.00 39.52 2.17
517 518 3.267483 AGGAATTGGTACGTCCGAAATG 58.733 45.455 0.00 0.00 39.52 2.32
518 519 3.055675 AGGAATTGGTACGTCCGAAATGA 60.056 43.478 0.00 0.00 39.52 2.57
519 520 3.685756 GGAATTGGTACGTCCGAAATGAA 59.314 43.478 0.00 0.00 39.52 2.57
520 521 4.154556 GGAATTGGTACGTCCGAAATGAAA 59.845 41.667 0.00 0.00 39.52 2.69
521 522 5.163693 GGAATTGGTACGTCCGAAATGAAAT 60.164 40.000 0.00 0.00 39.52 2.17
522 523 6.037391 GGAATTGGTACGTCCGAAATGAAATA 59.963 38.462 0.00 0.00 39.52 1.40
523 524 5.783100 TTGGTACGTCCGAAATGAAATAC 57.217 39.130 0.00 0.00 39.52 1.89
524 525 4.818642 TGGTACGTCCGAAATGAAATACA 58.181 39.130 0.00 0.00 39.52 2.29
525 526 4.626604 TGGTACGTCCGAAATGAAATACAC 59.373 41.667 0.00 0.00 39.52 2.90
526 527 4.033243 GGTACGTCCGAAATGAAATACACC 59.967 45.833 0.00 0.00 0.00 4.16
527 528 3.666274 ACGTCCGAAATGAAATACACCA 58.334 40.909 0.00 0.00 0.00 4.17
528 529 3.434299 ACGTCCGAAATGAAATACACCAC 59.566 43.478 0.00 0.00 0.00 4.16
529 530 3.482923 CGTCCGAAATGAAATACACCACG 60.483 47.826 0.00 0.00 0.00 4.94
530 531 3.680937 GTCCGAAATGAAATACACCACGA 59.319 43.478 0.00 0.00 0.00 4.35
531 532 3.930229 TCCGAAATGAAATACACCACGAG 59.070 43.478 0.00 0.00 0.00 4.18
532 533 3.930229 CCGAAATGAAATACACCACGAGA 59.070 43.478 0.00 0.00 0.00 4.04
533 534 4.390603 CCGAAATGAAATACACCACGAGAA 59.609 41.667 0.00 0.00 0.00 2.87
534 535 5.445939 CCGAAATGAAATACACCACGAGAAG 60.446 44.000 0.00 0.00 0.00 2.85
535 536 4.946784 AATGAAATACACCACGAGAAGC 57.053 40.909 0.00 0.00 0.00 3.86
536 537 2.695359 TGAAATACACCACGAGAAGCC 58.305 47.619 0.00 0.00 0.00 4.35
537 538 1.659098 GAAATACACCACGAGAAGCCG 59.341 52.381 0.00 0.00 0.00 5.52
538 539 0.108329 AATACACCACGAGAAGCCGG 60.108 55.000 0.00 0.00 0.00 6.13
539 540 2.573609 ATACACCACGAGAAGCCGGC 62.574 60.000 21.89 21.89 0.00 6.13
540 541 4.680237 CACCACGAGAAGCCGGCA 62.680 66.667 31.54 0.00 0.00 5.69
541 542 4.681978 ACCACGAGAAGCCGGCAC 62.682 66.667 31.54 21.95 0.00 5.01
543 544 4.379243 CACGAGAAGCCGGCACCT 62.379 66.667 31.54 24.41 0.00 4.00
544 545 4.070552 ACGAGAAGCCGGCACCTC 62.071 66.667 31.54 29.32 0.00 3.85
545 546 4.821589 CGAGAAGCCGGCACCTCC 62.822 72.222 31.54 16.04 0.00 4.30
554 555 3.502572 GGCACCTCCGATTGAAGC 58.497 61.111 0.00 0.00 0.00 3.86
555 556 1.377202 GGCACCTCCGATTGAAGCA 60.377 57.895 0.00 0.00 0.00 3.91
556 557 0.749454 GGCACCTCCGATTGAAGCAT 60.749 55.000 0.00 0.00 0.00 3.79
557 558 0.659957 GCACCTCCGATTGAAGCATC 59.340 55.000 0.00 0.00 0.00 3.91
558 559 1.303309 CACCTCCGATTGAAGCATCC 58.697 55.000 0.00 0.00 0.00 3.51
559 560 0.911769 ACCTCCGATTGAAGCATCCA 59.088 50.000 0.00 0.00 0.00 3.41
560 561 1.134280 ACCTCCGATTGAAGCATCCAG 60.134 52.381 0.00 0.00 0.00 3.86
561 562 1.139654 CCTCCGATTGAAGCATCCAGA 59.860 52.381 0.00 0.00 0.00 3.86
562 563 2.420547 CCTCCGATTGAAGCATCCAGAA 60.421 50.000 0.00 0.00 0.00 3.02
563 564 2.871022 CTCCGATTGAAGCATCCAGAAG 59.129 50.000 0.00 0.00 0.00 2.85
564 565 1.945394 CCGATTGAAGCATCCAGAAGG 59.055 52.381 0.00 0.00 0.00 3.46
565 566 2.636830 CGATTGAAGCATCCAGAAGGT 58.363 47.619 0.00 0.00 35.89 3.50
566 567 3.012518 CGATTGAAGCATCCAGAAGGTT 58.987 45.455 0.00 0.00 35.89 3.50
567 568 3.064545 CGATTGAAGCATCCAGAAGGTTC 59.935 47.826 7.64 7.64 41.32 3.62
568 569 2.496899 TGAAGCATCCAGAAGGTTCC 57.503 50.000 11.08 0.00 40.50 3.62
569 570 1.988107 TGAAGCATCCAGAAGGTTCCT 59.012 47.619 11.08 0.00 40.50 3.36
570 571 2.376518 TGAAGCATCCAGAAGGTTCCTT 59.623 45.455 11.08 3.55 40.50 3.36
571 572 3.181429 TGAAGCATCCAGAAGGTTCCTTT 60.181 43.478 11.08 0.00 40.50 3.11
572 573 2.800250 AGCATCCAGAAGGTTCCTTTG 58.200 47.619 5.53 6.27 35.89 2.77
573 574 1.203287 GCATCCAGAAGGTTCCTTTGC 59.797 52.381 5.53 7.37 35.89 3.68
574 575 1.470098 CATCCAGAAGGTTCCTTTGCG 59.530 52.381 5.53 0.00 35.89 4.85
575 576 0.250727 TCCAGAAGGTTCCTTTGCGG 60.251 55.000 5.53 6.96 35.89 5.69
576 577 0.537371 CCAGAAGGTTCCTTTGCGGT 60.537 55.000 5.53 0.00 0.00 5.68
577 578 1.318576 CAGAAGGTTCCTTTGCGGTT 58.681 50.000 5.53 0.00 0.00 4.44
578 579 2.500229 CAGAAGGTTCCTTTGCGGTTA 58.500 47.619 5.53 0.00 0.00 2.85
579 580 3.081804 CAGAAGGTTCCTTTGCGGTTAT 58.918 45.455 5.53 0.00 0.00 1.89
580 581 4.258543 CAGAAGGTTCCTTTGCGGTTATA 58.741 43.478 5.53 0.00 0.00 0.98
581 582 4.881850 CAGAAGGTTCCTTTGCGGTTATAT 59.118 41.667 5.53 0.00 0.00 0.86
582 583 5.357032 CAGAAGGTTCCTTTGCGGTTATATT 59.643 40.000 5.53 0.00 0.00 1.28
583 584 5.357032 AGAAGGTTCCTTTGCGGTTATATTG 59.643 40.000 5.53 0.00 0.00 1.90
584 585 4.850680 AGGTTCCTTTGCGGTTATATTGA 58.149 39.130 0.00 0.00 0.00 2.57
585 586 5.445964 AGGTTCCTTTGCGGTTATATTGAT 58.554 37.500 0.00 0.00 0.00 2.57
586 587 6.597562 AGGTTCCTTTGCGGTTATATTGATA 58.402 36.000 0.00 0.00 0.00 2.15
587 588 6.710744 AGGTTCCTTTGCGGTTATATTGATAG 59.289 38.462 0.00 0.00 0.00 2.08
588 589 6.485648 GGTTCCTTTGCGGTTATATTGATAGT 59.514 38.462 0.00 0.00 0.00 2.12
589 590 7.307811 GGTTCCTTTGCGGTTATATTGATAGTC 60.308 40.741 0.00 0.00 0.00 2.59
590 591 7.062749 TCCTTTGCGGTTATATTGATAGTCT 57.937 36.000 0.00 0.00 0.00 3.24
591 592 6.929049 TCCTTTGCGGTTATATTGATAGTCTG 59.071 38.462 0.00 0.00 0.00 3.51
592 593 6.347725 CCTTTGCGGTTATATTGATAGTCTGC 60.348 42.308 0.00 0.00 0.00 4.26
593 594 5.468540 TGCGGTTATATTGATAGTCTGCT 57.531 39.130 0.00 0.00 32.02 4.24
594 595 5.470368 TGCGGTTATATTGATAGTCTGCTC 58.530 41.667 0.00 0.00 32.02 4.26
595 596 5.010617 TGCGGTTATATTGATAGTCTGCTCA 59.989 40.000 0.00 0.00 32.02 4.26
596 597 5.346281 GCGGTTATATTGATAGTCTGCTCAC 59.654 44.000 0.00 0.00 0.00 3.51
597 598 6.682746 CGGTTATATTGATAGTCTGCTCACT 58.317 40.000 0.00 0.00 0.00 3.41
598 599 7.575155 GCGGTTATATTGATAGTCTGCTCACTA 60.575 40.741 0.00 0.00 33.32 2.74
599 600 8.462811 CGGTTATATTGATAGTCTGCTCACTAT 58.537 37.037 7.60 7.60 41.48 2.12
604 605 5.193663 TGATAGTCTGCTCACTATTCAGC 57.806 43.478 8.88 0.00 39.31 4.26
605 606 4.646492 TGATAGTCTGCTCACTATTCAGCA 59.354 41.667 8.88 0.00 43.49 4.41
606 607 3.969287 AGTCTGCTCACTATTCAGCAA 57.031 42.857 0.00 0.00 44.98 3.91
607 608 4.484537 AGTCTGCTCACTATTCAGCAAT 57.515 40.909 0.00 0.00 44.98 3.56
608 609 5.604758 AGTCTGCTCACTATTCAGCAATA 57.395 39.130 0.00 0.00 44.98 1.90
609 610 5.355596 AGTCTGCTCACTATTCAGCAATAC 58.644 41.667 0.00 0.00 44.98 1.89
610 611 4.509600 GTCTGCTCACTATTCAGCAATACC 59.490 45.833 0.00 0.00 44.98 2.73
611 612 3.808728 TGCTCACTATTCAGCAATACCC 58.191 45.455 0.00 0.00 42.74 3.69
612 613 3.142174 GCTCACTATTCAGCAATACCCC 58.858 50.000 0.00 0.00 35.56 4.95
613 614 3.433598 GCTCACTATTCAGCAATACCCCA 60.434 47.826 0.00 0.00 35.56 4.96
614 615 4.130118 CTCACTATTCAGCAATACCCCAC 58.870 47.826 0.00 0.00 0.00 4.61
615 616 3.780294 TCACTATTCAGCAATACCCCACT 59.220 43.478 0.00 0.00 0.00 4.00
616 617 4.227300 TCACTATTCAGCAATACCCCACTT 59.773 41.667 0.00 0.00 0.00 3.16
617 618 4.576463 CACTATTCAGCAATACCCCACTTC 59.424 45.833 0.00 0.00 0.00 3.01
618 619 2.507407 TTCAGCAATACCCCACTTCC 57.493 50.000 0.00 0.00 0.00 3.46
619 620 0.251916 TCAGCAATACCCCACTTCCG 59.748 55.000 0.00 0.00 0.00 4.30
620 621 0.251916 CAGCAATACCCCACTTCCGA 59.748 55.000 0.00 0.00 0.00 4.55
621 622 1.134098 CAGCAATACCCCACTTCCGAT 60.134 52.381 0.00 0.00 0.00 4.18
622 623 2.104111 CAGCAATACCCCACTTCCGATA 59.896 50.000 0.00 0.00 0.00 2.92
623 624 2.979678 AGCAATACCCCACTTCCGATAT 59.020 45.455 0.00 0.00 0.00 1.63
624 625 4.020573 CAGCAATACCCCACTTCCGATATA 60.021 45.833 0.00 0.00 0.00 0.86
625 626 4.223032 AGCAATACCCCACTTCCGATATAG 59.777 45.833 0.00 0.00 0.00 1.31
626 627 4.504858 CAATACCCCACTTCCGATATAGC 58.495 47.826 0.00 0.00 0.00 2.97
627 628 2.400467 ACCCCACTTCCGATATAGCT 57.600 50.000 0.00 0.00 0.00 3.32
628 629 3.537795 ACCCCACTTCCGATATAGCTA 57.462 47.619 0.00 0.00 0.00 3.32
629 630 3.853207 ACCCCACTTCCGATATAGCTAA 58.147 45.455 0.00 0.00 0.00 3.09
630 631 4.228824 ACCCCACTTCCGATATAGCTAAA 58.771 43.478 0.00 0.00 0.00 1.85
631 632 4.283722 ACCCCACTTCCGATATAGCTAAAG 59.716 45.833 0.00 0.00 0.00 1.85
632 633 4.322801 CCCCACTTCCGATATAGCTAAAGG 60.323 50.000 0.00 0.00 0.00 3.11
633 634 4.322801 CCCACTTCCGATATAGCTAAAGGG 60.323 50.000 0.00 0.00 0.00 3.95
634 635 4.527038 CCACTTCCGATATAGCTAAAGGGA 59.473 45.833 0.00 0.00 0.00 4.20
635 636 5.011738 CCACTTCCGATATAGCTAAAGGGAA 59.988 44.000 14.43 14.43 0.00 3.97
639 640 6.531503 TCCGATATAGCTAAAGGGAAGATG 57.468 41.667 0.00 0.00 0.00 2.90
640 641 5.422331 TCCGATATAGCTAAAGGGAAGATGG 59.578 44.000 0.00 0.00 0.00 3.51
641 642 5.187967 CCGATATAGCTAAAGGGAAGATGGT 59.812 44.000 0.00 0.00 0.00 3.55
642 643 6.295916 CCGATATAGCTAAAGGGAAGATGGTT 60.296 42.308 0.00 0.00 0.00 3.67
643 644 7.093465 CCGATATAGCTAAAGGGAAGATGGTTA 60.093 40.741 0.00 0.00 0.00 2.85
644 645 8.478877 CGATATAGCTAAAGGGAAGATGGTTAT 58.521 37.037 0.00 0.00 0.00 1.89
645 646 9.825109 GATATAGCTAAAGGGAAGATGGTTATC 57.175 37.037 0.00 0.00 0.00 1.75
646 647 7.880265 ATAGCTAAAGGGAAGATGGTTATCT 57.120 36.000 0.00 0.00 45.51 1.98
647 648 6.181206 AGCTAAAGGGAAGATGGTTATCTC 57.819 41.667 0.00 0.00 42.80 2.75
648 649 5.072464 AGCTAAAGGGAAGATGGTTATCTCC 59.928 44.000 0.00 0.00 42.80 3.71
649 650 5.072464 GCTAAAGGGAAGATGGTTATCTCCT 59.928 44.000 0.00 0.00 42.80 3.69
650 651 6.270231 GCTAAAGGGAAGATGGTTATCTCCTA 59.730 42.308 0.00 0.00 42.80 2.94
651 652 7.037945 GCTAAAGGGAAGATGGTTATCTCCTAT 60.038 40.741 0.00 0.00 42.80 2.57
652 653 6.694445 AAGGGAAGATGGTTATCTCCTATG 57.306 41.667 0.00 0.00 42.80 2.23
653 654 5.097234 AGGGAAGATGGTTATCTCCTATGG 58.903 45.833 0.00 0.00 42.80 2.74
654 655 4.846940 GGGAAGATGGTTATCTCCTATGGT 59.153 45.833 0.00 0.00 42.80 3.55
655 656 5.280215 GGGAAGATGGTTATCTCCTATGGTG 60.280 48.000 0.00 0.00 42.80 4.17
656 657 5.544176 GGAAGATGGTTATCTCCTATGGTGA 59.456 44.000 0.00 0.00 42.80 4.02
657 658 6.214412 GGAAGATGGTTATCTCCTATGGTGAT 59.786 42.308 6.44 6.44 42.80 3.06
658 659 6.865834 AGATGGTTATCTCCTATGGTGATC 57.134 41.667 4.68 0.00 39.46 2.92
659 660 6.326161 AGATGGTTATCTCCTATGGTGATCA 58.674 40.000 4.68 0.00 39.46 2.92
660 661 6.789457 AGATGGTTATCTCCTATGGTGATCAA 59.211 38.462 0.00 0.00 39.46 2.57
661 662 6.823286 TGGTTATCTCCTATGGTGATCAAA 57.177 37.500 0.00 0.00 37.20 2.69
662 663 6.830912 TGGTTATCTCCTATGGTGATCAAAG 58.169 40.000 0.00 0.00 37.20 2.77
663 664 6.386927 TGGTTATCTCCTATGGTGATCAAAGT 59.613 38.462 0.00 0.00 37.20 2.66
664 665 7.092444 TGGTTATCTCCTATGGTGATCAAAGTT 60.092 37.037 0.00 0.00 37.20 2.66
665 666 7.775561 GGTTATCTCCTATGGTGATCAAAGTTT 59.224 37.037 0.00 0.00 37.20 2.66
666 667 9.178758 GTTATCTCCTATGGTGATCAAAGTTTT 57.821 33.333 0.00 0.00 37.20 2.43
669 670 9.753674 ATCTCCTATGGTGATCAAAGTTTTAAA 57.246 29.630 0.00 0.00 31.25 1.52
670 671 9.753674 TCTCCTATGGTGATCAAAGTTTTAAAT 57.246 29.630 0.00 0.00 0.00 1.40
673 674 9.736023 CCTATGGTGATCAAAGTTTTAAATAGC 57.264 33.333 0.00 0.00 0.00 2.97
674 675 9.438291 CTATGGTGATCAAAGTTTTAAATAGCG 57.562 33.333 0.00 0.00 0.00 4.26
675 676 6.090129 TGGTGATCAAAGTTTTAAATAGCGC 58.910 36.000 0.00 0.00 0.00 5.92
676 677 5.227184 GGTGATCAAAGTTTTAAATAGCGCG 59.773 40.000 0.00 0.00 0.00 6.86
677 678 4.791163 TGATCAAAGTTTTAAATAGCGCGC 59.209 37.500 26.66 26.66 0.00 6.86
678 679 4.413495 TCAAAGTTTTAAATAGCGCGCT 57.587 36.364 38.01 38.01 0.00 5.92
679 680 5.533533 TCAAAGTTTTAAATAGCGCGCTA 57.466 34.783 39.72 39.72 0.00 4.26
680 681 5.929278 TCAAAGTTTTAAATAGCGCGCTAA 58.071 33.333 40.90 26.03 31.73 3.09
681 682 6.019152 TCAAAGTTTTAAATAGCGCGCTAAG 58.981 36.000 40.90 16.07 31.73 2.18
682 683 3.936661 AGTTTTAAATAGCGCGCTAAGC 58.063 40.909 40.90 27.92 43.95 3.09
694 695 1.856012 GCTAAGCATCTTAGCGCCG 59.144 57.895 18.95 0.00 38.12 6.46
695 696 1.560860 GCTAAGCATCTTAGCGCCGG 61.561 60.000 18.95 0.00 38.12 6.13
696 697 0.032130 CTAAGCATCTTAGCGCCGGA 59.968 55.000 5.05 0.00 40.15 5.14
697 698 0.249322 TAAGCATCTTAGCGCCGGAC 60.249 55.000 5.05 0.00 40.15 4.79
698 699 1.961180 AAGCATCTTAGCGCCGGACT 61.961 55.000 5.05 3.61 40.15 3.85
699 700 1.521681 GCATCTTAGCGCCGGACTT 60.522 57.895 5.05 0.00 0.00 3.01
700 701 1.491505 GCATCTTAGCGCCGGACTTC 61.492 60.000 5.05 0.00 0.00 3.01
701 702 0.103208 CATCTTAGCGCCGGACTTCT 59.897 55.000 5.05 0.00 0.00 2.85
702 703 0.824759 ATCTTAGCGCCGGACTTCTT 59.175 50.000 5.05 0.00 0.00 2.52
703 704 0.606604 TCTTAGCGCCGGACTTCTTT 59.393 50.000 5.05 0.00 0.00 2.52
704 705 1.000145 CTTAGCGCCGGACTTCTTTC 59.000 55.000 5.05 0.00 0.00 2.62
705 706 0.319083 TTAGCGCCGGACTTCTTTCA 59.681 50.000 5.05 0.00 0.00 2.69
706 707 0.319083 TAGCGCCGGACTTCTTTCAA 59.681 50.000 5.05 0.00 0.00 2.69
707 708 0.534203 AGCGCCGGACTTCTTTCAAA 60.534 50.000 5.05 0.00 0.00 2.69
708 709 0.521735 GCGCCGGACTTCTTTCAAAT 59.478 50.000 5.05 0.00 0.00 2.32
709 710 1.729149 GCGCCGGACTTCTTTCAAATG 60.729 52.381 5.05 0.00 0.00 2.32
710 711 1.729149 CGCCGGACTTCTTTCAAATGC 60.729 52.381 5.05 0.00 0.00 3.56
711 712 1.541588 GCCGGACTTCTTTCAAATGCT 59.458 47.619 5.05 0.00 0.00 3.79
712 713 2.747446 GCCGGACTTCTTTCAAATGCTA 59.253 45.455 5.05 0.00 0.00 3.49
713 714 3.378427 GCCGGACTTCTTTCAAATGCTAT 59.622 43.478 5.05 0.00 0.00 2.97
714 715 4.574828 GCCGGACTTCTTTCAAATGCTATA 59.425 41.667 5.05 0.00 0.00 1.31
715 716 5.277538 GCCGGACTTCTTTCAAATGCTATAG 60.278 44.000 5.05 0.00 0.00 1.31
716 717 5.277538 CCGGACTTCTTTCAAATGCTATAGC 60.278 44.000 18.18 18.18 42.50 2.97
717 718 5.557136 CGGACTTCTTTCAAATGCTATAGCG 60.557 44.000 19.55 5.67 45.83 4.26
718 719 5.294552 GGACTTCTTTCAAATGCTATAGCGT 59.705 40.000 19.55 16.84 45.83 5.07
719 720 6.111768 ACTTCTTTCAAATGCTATAGCGTG 57.888 37.500 20.02 16.47 45.83 5.34
720 721 4.536364 TCTTTCAAATGCTATAGCGTGC 57.464 40.909 20.02 0.00 45.83 5.34
721 722 4.191544 TCTTTCAAATGCTATAGCGTGCT 58.808 39.130 20.02 7.98 45.83 4.40
722 723 5.356426 TCTTTCAAATGCTATAGCGTGCTA 58.644 37.500 20.02 3.73 45.83 3.49
723 724 5.991606 TCTTTCAAATGCTATAGCGTGCTAT 59.008 36.000 20.02 17.65 45.83 2.97
724 725 7.151976 TCTTTCAAATGCTATAGCGTGCTATA 58.848 34.615 20.02 17.96 45.83 1.31
730 731 3.326733 CTATAGCGTGCTATAGCGGAG 57.673 52.381 27.04 13.65 46.26 4.63
731 732 0.171455 ATAGCGTGCTATAGCGGAGC 59.829 55.000 22.98 22.98 45.83 4.70
753 754 5.618561 GCTATAGCGCGCTATTTAAAATGT 58.381 37.500 46.76 28.88 39.65 2.71
754 755 6.077838 GCTATAGCGCGCTATTTAAAATGTT 58.922 36.000 46.76 28.22 39.65 2.71
755 756 6.577427 GCTATAGCGCGCTATTTAAAATGTTT 59.423 34.615 46.76 27.75 39.65 2.83
756 757 6.732181 ATAGCGCGCTATTTAAAATGTTTG 57.268 33.333 40.32 0.00 35.92 2.93
757 758 4.481463 AGCGCGCTATTTAAAATGTTTGT 58.519 34.783 35.79 0.63 0.00 2.83
758 759 4.920927 AGCGCGCTATTTAAAATGTTTGTT 59.079 33.333 35.79 0.18 0.00 2.83
759 760 5.060446 AGCGCGCTATTTAAAATGTTTGTTC 59.940 36.000 35.79 0.00 0.00 3.18
760 761 5.164138 GCGCGCTATTTAAAATGTTTGTTCA 60.164 36.000 26.67 0.00 0.00 3.18
761 762 6.453659 GCGCGCTATTTAAAATGTTTGTTCAT 60.454 34.615 26.67 0.00 0.00 2.57
762 763 7.444245 CGCGCTATTTAAAATGTTTGTTCATT 58.556 30.769 5.56 0.00 39.35 2.57
763 764 7.626815 CGCGCTATTTAAAATGTTTGTTCATTC 59.373 33.333 5.56 0.00 37.09 2.67
764 765 7.626815 GCGCTATTTAAAATGTTTGTTCATTCG 59.373 33.333 0.00 0.00 37.09 3.34
765 766 8.635124 CGCTATTTAAAATGTTTGTTCATTCGT 58.365 29.630 0.00 0.00 37.09 3.85
769 770 9.928236 ATTTAAAATGTTTGTTCATTCGTTTGG 57.072 25.926 0.00 0.00 37.09 3.28
770 771 8.703604 TTAAAATGTTTGTTCATTCGTTTGGA 57.296 26.923 0.00 0.00 37.09 3.53
771 772 6.582437 AAATGTTTGTTCATTCGTTTGGAC 57.418 33.333 0.00 0.00 37.09 4.02
772 773 4.035278 TGTTTGTTCATTCGTTTGGACC 57.965 40.909 0.00 0.00 0.00 4.46
773 774 3.444034 TGTTTGTTCATTCGTTTGGACCA 59.556 39.130 0.00 0.00 0.00 4.02
774 775 4.082190 TGTTTGTTCATTCGTTTGGACCAA 60.082 37.500 1.69 1.69 0.00 3.67
775 776 4.927978 TTGTTCATTCGTTTGGACCAAT 57.072 36.364 7.99 0.00 0.00 3.16
776 777 4.235939 TGTTCATTCGTTTGGACCAATG 57.764 40.909 7.99 2.95 36.19 2.82
777 778 3.634448 TGTTCATTCGTTTGGACCAATGT 59.366 39.130 7.99 0.00 36.26 2.71
778 779 4.226761 GTTCATTCGTTTGGACCAATGTC 58.773 43.478 7.99 1.41 36.26 3.06
779 780 3.750371 TCATTCGTTTGGACCAATGTCT 58.250 40.909 7.99 0.00 41.47 3.41
780 781 3.751175 TCATTCGTTTGGACCAATGTCTC 59.249 43.478 7.99 0.00 41.47 3.36
781 782 3.485463 TTCGTTTGGACCAATGTCTCT 57.515 42.857 7.99 0.00 41.47 3.10
782 783 3.485463 TCGTTTGGACCAATGTCTCTT 57.515 42.857 7.99 0.00 41.47 2.85
783 784 4.610605 TCGTTTGGACCAATGTCTCTTA 57.389 40.909 7.99 0.00 41.47 2.10
784 785 4.566004 TCGTTTGGACCAATGTCTCTTAG 58.434 43.478 7.99 0.00 41.47 2.18
785 786 3.125316 CGTTTGGACCAATGTCTCTTAGC 59.875 47.826 7.99 0.00 41.47 3.09
786 787 2.672961 TGGACCAATGTCTCTTAGCG 57.327 50.000 0.00 0.00 41.47 4.26
787 788 1.291132 GGACCAATGTCTCTTAGCGC 58.709 55.000 0.00 0.00 41.47 5.92
788 789 1.405526 GGACCAATGTCTCTTAGCGCA 60.406 52.381 11.47 0.00 41.47 6.09
789 790 2.346803 GACCAATGTCTCTTAGCGCAA 58.653 47.619 11.47 0.50 38.53 4.85
790 791 2.349886 GACCAATGTCTCTTAGCGCAAG 59.650 50.000 11.47 11.67 38.53 4.01
791 792 2.028112 ACCAATGTCTCTTAGCGCAAGA 60.028 45.455 11.47 15.40 41.10 3.02
792 793 2.349886 CCAATGTCTCTTAGCGCAAGAC 59.650 50.000 11.47 16.64 38.39 3.01
793 794 2.301577 ATGTCTCTTAGCGCAAGACC 57.698 50.000 21.57 14.10 38.39 3.85
794 795 1.257743 TGTCTCTTAGCGCAAGACCT 58.742 50.000 21.57 0.46 38.39 3.85
795 796 1.618837 TGTCTCTTAGCGCAAGACCTT 59.381 47.619 21.57 0.00 38.39 3.50
796 797 2.037251 TGTCTCTTAGCGCAAGACCTTT 59.963 45.455 21.57 0.00 38.39 3.11
797 798 3.067833 GTCTCTTAGCGCAAGACCTTTT 58.932 45.455 11.47 0.00 38.39 2.27
798 799 3.067106 TCTCTTAGCGCAAGACCTTTTG 58.933 45.455 11.47 4.34 38.39 2.44
799 800 2.808543 CTCTTAGCGCAAGACCTTTTGT 59.191 45.455 11.47 0.00 38.39 2.83
800 801 3.994392 CTCTTAGCGCAAGACCTTTTGTA 59.006 43.478 11.47 0.00 38.39 2.41
801 802 4.382291 TCTTAGCGCAAGACCTTTTGTAA 58.618 39.130 11.47 0.00 38.39 2.41
802 803 4.817464 TCTTAGCGCAAGACCTTTTGTAAA 59.183 37.500 11.47 0.00 38.39 2.01
803 804 3.349488 AGCGCAAGACCTTTTGTAAAC 57.651 42.857 11.47 0.00 43.02 2.01
804 805 2.041244 GCGCAAGACCTTTTGTAAACG 58.959 47.619 0.30 0.00 43.02 3.60
805 806 2.540157 GCGCAAGACCTTTTGTAAACGT 60.540 45.455 0.30 0.00 43.02 3.99
806 807 3.687200 CGCAAGACCTTTTGTAAACGTT 58.313 40.909 0.00 0.00 43.02 3.99
807 808 3.480668 CGCAAGACCTTTTGTAAACGTTG 59.519 43.478 0.00 0.00 43.02 4.10
808 809 4.417506 GCAAGACCTTTTGTAAACGTTGT 58.582 39.130 0.00 0.00 0.00 3.32
809 810 5.571277 GCAAGACCTTTTGTAAACGTTGTA 58.429 37.500 0.00 0.00 0.00 2.41
810 811 5.679792 GCAAGACCTTTTGTAAACGTTGTAG 59.320 40.000 0.00 0.00 0.00 2.74
811 812 5.413969 AGACCTTTTGTAAACGTTGTAGC 57.586 39.130 0.00 0.00 0.00 3.58
812 813 4.025480 AGACCTTTTGTAAACGTTGTAGCG 60.025 41.667 0.00 0.00 37.94 4.26
814 815 3.963724 CCTTTTGTAAACGTTGTAGCGTG 59.036 43.478 0.00 0.00 45.00 5.34
815 816 2.649140 TTGTAAACGTTGTAGCGTGC 57.351 45.000 0.00 0.00 45.00 5.34
816 817 1.855513 TGTAAACGTTGTAGCGTGCT 58.144 45.000 0.00 0.00 45.00 4.40
817 818 3.010624 TGTAAACGTTGTAGCGTGCTA 57.989 42.857 0.00 0.00 45.00 3.49
818 819 3.577667 TGTAAACGTTGTAGCGTGCTAT 58.422 40.909 0.00 0.00 45.00 2.97
819 820 4.731720 TGTAAACGTTGTAGCGTGCTATA 58.268 39.130 0.00 0.00 45.00 1.31
820 821 4.794762 TGTAAACGTTGTAGCGTGCTATAG 59.205 41.667 0.00 0.00 45.00 1.31
821 822 1.836383 ACGTTGTAGCGTGCTATAGC 58.164 50.000 18.18 18.18 43.99 2.97
822 823 0.770590 CGTTGTAGCGTGCTATAGCG 59.229 55.000 19.55 17.15 45.83 4.26
823 824 1.129326 GTTGTAGCGTGCTATAGCGG 58.871 55.000 19.55 14.62 45.83 5.52
824 825 1.026584 TTGTAGCGTGCTATAGCGGA 58.973 50.000 19.55 0.03 45.83 5.54
825 826 0.591659 TGTAGCGTGCTATAGCGGAG 59.408 55.000 19.55 13.65 45.83 4.63
846 847 4.406001 GCTATAGCGGGCTATTTGAAAC 57.594 45.455 17.49 0.05 39.65 2.78
847 848 3.813166 GCTATAGCGGGCTATTTGAAACA 59.187 43.478 17.49 0.00 39.65 2.83
848 849 4.083802 GCTATAGCGGGCTATTTGAAACAG 60.084 45.833 17.49 8.76 39.65 3.16
849 850 2.200373 AGCGGGCTATTTGAAACAGT 57.800 45.000 0.00 0.00 0.00 3.55
850 851 1.812571 AGCGGGCTATTTGAAACAGTG 59.187 47.619 0.00 0.00 0.00 3.66
851 852 1.810151 GCGGGCTATTTGAAACAGTGA 59.190 47.619 0.00 0.00 0.00 3.41
852 853 2.423538 GCGGGCTATTTGAAACAGTGAT 59.576 45.455 0.00 0.00 0.00 3.06
853 854 3.731867 GCGGGCTATTTGAAACAGTGATG 60.732 47.826 0.00 0.00 0.00 3.07
854 855 3.181497 CGGGCTATTTGAAACAGTGATGG 60.181 47.826 0.00 0.00 0.00 3.51
855 856 3.763897 GGGCTATTTGAAACAGTGATGGT 59.236 43.478 0.00 0.00 0.00 3.55
856 857 4.380867 GGGCTATTTGAAACAGTGATGGTG 60.381 45.833 0.00 0.00 0.00 4.17
857 858 4.458989 GGCTATTTGAAACAGTGATGGTGA 59.541 41.667 0.00 0.00 0.00 4.02
858 859 5.126061 GGCTATTTGAAACAGTGATGGTGAT 59.874 40.000 0.00 0.00 0.00 3.06
859 860 6.261118 GCTATTTGAAACAGTGATGGTGATC 58.739 40.000 0.00 0.00 0.00 2.92
860 861 6.094603 GCTATTTGAAACAGTGATGGTGATCT 59.905 38.462 0.00 0.00 0.00 2.75
861 862 7.280876 GCTATTTGAAACAGTGATGGTGATCTA 59.719 37.037 0.00 0.00 0.00 1.98
862 863 9.166173 CTATTTGAAACAGTGATGGTGATCTAA 57.834 33.333 0.00 0.00 0.00 2.10
863 864 7.815840 TTTGAAACAGTGATGGTGATCTAAA 57.184 32.000 0.00 0.00 0.00 1.85
864 865 7.439157 TTGAAACAGTGATGGTGATCTAAAG 57.561 36.000 0.00 0.00 0.00 1.85
865 866 6.768483 TGAAACAGTGATGGTGATCTAAAGA 58.232 36.000 0.00 0.00 0.00 2.52
866 867 7.223584 TGAAACAGTGATGGTGATCTAAAGAA 58.776 34.615 0.00 0.00 0.00 2.52
867 868 7.173218 TGAAACAGTGATGGTGATCTAAAGAAC 59.827 37.037 0.00 0.00 0.00 3.01
868 869 6.114187 ACAGTGATGGTGATCTAAAGAACA 57.886 37.500 0.00 0.00 0.00 3.18
869 870 6.169094 ACAGTGATGGTGATCTAAAGAACAG 58.831 40.000 0.00 0.00 0.00 3.16
870 871 5.583854 CAGTGATGGTGATCTAAAGAACAGG 59.416 44.000 0.00 0.00 0.00 4.00
871 872 5.485353 AGTGATGGTGATCTAAAGAACAGGA 59.515 40.000 0.00 0.00 0.00 3.86
872 873 6.013379 AGTGATGGTGATCTAAAGAACAGGAA 60.013 38.462 0.00 0.00 0.00 3.36
873 874 6.314896 GTGATGGTGATCTAAAGAACAGGAAG 59.685 42.308 0.00 0.00 0.00 3.46
874 875 6.213397 TGATGGTGATCTAAAGAACAGGAAGA 59.787 38.462 0.00 0.00 0.00 2.87
875 876 6.433847 TGGTGATCTAAAGAACAGGAAGAA 57.566 37.500 0.00 0.00 0.00 2.52
876 877 6.467677 TGGTGATCTAAAGAACAGGAAGAAG 58.532 40.000 0.00 0.00 0.00 2.85
877 878 6.043243 TGGTGATCTAAAGAACAGGAAGAAGT 59.957 38.462 0.00 0.00 0.00 3.01
878 879 6.592220 GGTGATCTAAAGAACAGGAAGAAGTC 59.408 42.308 0.00 0.00 0.00 3.01
879 880 7.382898 GTGATCTAAAGAACAGGAAGAAGTCT 58.617 38.462 0.00 0.00 0.00 3.24
880 881 7.330700 GTGATCTAAAGAACAGGAAGAAGTCTG 59.669 40.741 0.00 0.00 37.07 3.51
881 882 6.978674 TCTAAAGAACAGGAAGAAGTCTGA 57.021 37.500 0.00 0.00 35.20 3.27
882 883 7.546250 TCTAAAGAACAGGAAGAAGTCTGAT 57.454 36.000 0.00 0.00 35.20 2.90
883 884 7.382110 TCTAAAGAACAGGAAGAAGTCTGATG 58.618 38.462 0.00 0.00 35.20 3.07
884 885 3.936564 AGAACAGGAAGAAGTCTGATGC 58.063 45.455 0.00 0.00 35.20 3.91
885 886 3.326006 AGAACAGGAAGAAGTCTGATGCA 59.674 43.478 0.00 0.00 35.20 3.96
886 887 3.777106 ACAGGAAGAAGTCTGATGCAA 57.223 42.857 0.00 0.00 35.20 4.08
887 888 3.406764 ACAGGAAGAAGTCTGATGCAAC 58.593 45.455 0.00 0.00 35.20 4.17
888 889 3.181451 ACAGGAAGAAGTCTGATGCAACA 60.181 43.478 0.00 0.00 35.20 3.33
889 890 3.436015 CAGGAAGAAGTCTGATGCAACAG 59.564 47.826 17.32 17.32 39.02 3.16
890 891 2.161211 GGAAGAAGTCTGATGCAACAGC 59.839 50.000 18.49 13.36 37.75 4.40
891 892 1.436600 AGAAGTCTGATGCAACAGCG 58.563 50.000 18.49 0.00 37.75 5.18
892 893 0.445436 GAAGTCTGATGCAACAGCGG 59.555 55.000 18.49 0.00 37.75 5.52
893 894 1.580845 AAGTCTGATGCAACAGCGGC 61.581 55.000 18.49 11.03 37.75 6.53
894 895 2.032376 TCTGATGCAACAGCGGCA 59.968 55.556 18.49 0.00 46.66 5.69
895 896 1.600356 TCTGATGCAACAGCGGCAA 60.600 52.632 18.49 0.00 45.60 4.52
896 897 1.171549 TCTGATGCAACAGCGGCAAA 61.172 50.000 18.49 0.00 45.60 3.68
897 898 1.005294 CTGATGCAACAGCGGCAAAC 61.005 55.000 11.33 0.00 45.60 2.93
898 899 1.286880 GATGCAACAGCGGCAAACT 59.713 52.632 1.45 0.00 45.60 2.66
899 900 1.005294 GATGCAACAGCGGCAAACTG 61.005 55.000 1.45 0.00 45.60 3.16
910 911 3.736581 GCAAACTGCAGTCGAACTC 57.263 52.632 21.95 2.89 44.26 3.01
911 912 0.235926 GCAAACTGCAGTCGAACTCC 59.764 55.000 21.95 0.96 44.26 3.85
912 913 1.581934 CAAACTGCAGTCGAACTCCA 58.418 50.000 21.95 0.00 0.00 3.86
913 914 1.528586 CAAACTGCAGTCGAACTCCAG 59.471 52.381 21.95 4.90 39.85 3.86
914 915 1.040646 AACTGCAGTCGAACTCCAGA 58.959 50.000 21.95 0.00 36.08 3.86
915 916 0.600557 ACTGCAGTCGAACTCCAGAG 59.399 55.000 15.25 0.00 36.08 3.35
916 917 0.735632 CTGCAGTCGAACTCCAGAGC 60.736 60.000 5.25 0.00 36.08 4.09
917 918 1.803519 GCAGTCGAACTCCAGAGCG 60.804 63.158 0.00 0.00 0.00 5.03
918 919 1.803519 CAGTCGAACTCCAGAGCGC 60.804 63.158 0.00 0.00 0.00 5.92
919 920 1.974343 AGTCGAACTCCAGAGCGCT 60.974 57.895 11.27 11.27 0.00 5.92
920 921 1.803519 GTCGAACTCCAGAGCGCTG 60.804 63.158 18.48 10.92 41.93 5.18
928 929 3.497932 CAGAGCGCTGGAGCAAGC 61.498 66.667 18.48 0.00 42.21 4.01
929 930 4.774503 AGAGCGCTGGAGCAAGCC 62.775 66.667 18.48 0.00 40.23 4.35
935 936 4.845580 CTGGAGCAAGCCGCCGAT 62.846 66.667 0.00 0.00 44.04 4.18
948 949 4.418328 CCGATGGGGTGGGCGAAA 62.418 66.667 0.00 0.00 0.00 3.46
949 950 3.131478 CGATGGGGTGGGCGAAAC 61.131 66.667 0.00 0.00 0.00 2.78
950 951 2.355115 GATGGGGTGGGCGAAACT 59.645 61.111 0.00 0.00 0.00 2.66
951 952 1.749258 GATGGGGTGGGCGAAACTC 60.749 63.158 0.00 0.00 0.00 3.01
952 953 2.478335 GATGGGGTGGGCGAAACTCA 62.478 60.000 0.00 0.00 0.00 3.41
953 954 2.075355 ATGGGGTGGGCGAAACTCAA 62.075 55.000 0.00 0.00 0.00 3.02
954 955 1.304134 GGGGTGGGCGAAACTCAAT 60.304 57.895 0.00 0.00 0.00 2.57
955 956 1.595093 GGGGTGGGCGAAACTCAATG 61.595 60.000 0.00 0.00 0.00 2.82
956 957 0.893727 GGGTGGGCGAAACTCAATGT 60.894 55.000 0.00 0.00 0.00 2.71
957 958 1.612199 GGGTGGGCGAAACTCAATGTA 60.612 52.381 0.00 0.00 0.00 2.29
958 959 1.737793 GGTGGGCGAAACTCAATGTAG 59.262 52.381 0.00 0.00 0.00 2.74
959 960 2.614481 GGTGGGCGAAACTCAATGTAGA 60.614 50.000 0.00 0.00 0.00 2.59
960 961 2.415512 GTGGGCGAAACTCAATGTAGAC 59.584 50.000 0.00 0.00 0.00 2.59
961 962 1.659098 GGGCGAAACTCAATGTAGACG 59.341 52.381 0.00 0.00 0.00 4.18
962 963 1.659098 GGCGAAACTCAATGTAGACGG 59.341 52.381 0.00 0.00 0.00 4.79
963 964 2.602878 GCGAAACTCAATGTAGACGGA 58.397 47.619 0.00 0.00 0.00 4.69
964 965 2.599082 GCGAAACTCAATGTAGACGGAG 59.401 50.000 0.00 0.00 0.00 4.63
965 966 2.599082 CGAAACTCAATGTAGACGGAGC 59.401 50.000 0.00 0.00 0.00 4.70
966 967 3.673594 CGAAACTCAATGTAGACGGAGCT 60.674 47.826 0.00 0.00 0.00 4.09
967 968 3.963428 AACTCAATGTAGACGGAGCTT 57.037 42.857 0.00 0.00 0.00 3.74
968 969 3.238108 ACTCAATGTAGACGGAGCTTG 57.762 47.619 0.00 0.00 0.00 4.01
969 970 2.093973 ACTCAATGTAGACGGAGCTTGG 60.094 50.000 0.00 0.00 0.00 3.61
970 971 1.009829 CAATGTAGACGGAGCTTGGC 58.990 55.000 0.00 0.00 0.00 4.52
971 972 0.460284 AATGTAGACGGAGCTTGGCG 60.460 55.000 0.00 0.00 0.00 5.69
972 973 1.320344 ATGTAGACGGAGCTTGGCGA 61.320 55.000 0.00 0.00 0.00 5.54
973 974 1.226717 GTAGACGGAGCTTGGCGAG 60.227 63.158 0.00 0.00 0.00 5.03
974 975 1.378119 TAGACGGAGCTTGGCGAGA 60.378 57.895 5.76 0.00 0.00 4.04
975 976 0.963856 TAGACGGAGCTTGGCGAGAA 60.964 55.000 5.76 0.00 0.00 2.87
976 977 1.807573 GACGGAGCTTGGCGAGAAG 60.808 63.158 5.76 0.00 0.00 2.85
977 978 2.214181 GACGGAGCTTGGCGAGAAGA 62.214 60.000 5.76 0.00 0.00 2.87
978 979 1.079819 CGGAGCTTGGCGAGAAGAA 60.080 57.895 5.76 0.00 0.00 2.52
979 980 1.080995 CGGAGCTTGGCGAGAAGAAG 61.081 60.000 5.76 0.00 0.00 2.85
980 981 0.247736 GGAGCTTGGCGAGAAGAAGA 59.752 55.000 5.76 0.00 0.00 2.87
981 982 1.355005 GAGCTTGGCGAGAAGAAGAC 58.645 55.000 5.76 0.00 0.00 3.01
982 983 0.389166 AGCTTGGCGAGAAGAAGACG 60.389 55.000 5.76 0.00 0.00 4.18
983 984 1.355066 GCTTGGCGAGAAGAAGACGG 61.355 60.000 5.76 0.00 0.00 4.79
986 987 3.464628 GCGAGAAGAAGACGGCAC 58.535 61.111 0.00 0.00 0.00 5.01
1001 1002 3.470888 CACGGGAGGAGCCGGAAT 61.471 66.667 5.05 0.00 40.07 3.01
1002 1003 3.470888 ACGGGAGGAGCCGGAATG 61.471 66.667 5.05 0.00 40.07 2.67
1003 1004 3.154473 CGGGAGGAGCCGGAATGA 61.154 66.667 5.05 0.00 39.22 2.57
1004 1005 2.511452 CGGGAGGAGCCGGAATGAT 61.511 63.158 5.05 0.00 39.22 2.45
1005 1006 1.185618 CGGGAGGAGCCGGAATGATA 61.186 60.000 5.05 0.00 39.22 2.15
1006 1007 0.321996 GGGAGGAGCCGGAATGATAC 59.678 60.000 5.05 0.00 37.63 2.24
1007 1008 1.343069 GGAGGAGCCGGAATGATACT 58.657 55.000 5.05 0.00 0.00 2.12
1008 1009 1.001406 GGAGGAGCCGGAATGATACTG 59.999 57.143 5.05 0.00 0.00 2.74
1009 1010 0.394565 AGGAGCCGGAATGATACTGC 59.605 55.000 5.05 0.00 0.00 4.40
1010 1011 0.946221 GGAGCCGGAATGATACTGCG 60.946 60.000 5.05 0.00 0.00 5.18
1011 1012 0.032130 GAGCCGGAATGATACTGCGA 59.968 55.000 5.05 0.00 0.00 5.10
1012 1013 0.032678 AGCCGGAATGATACTGCGAG 59.967 55.000 5.05 0.00 0.00 5.03
1013 1014 0.032130 GCCGGAATGATACTGCGAGA 59.968 55.000 5.05 0.00 0.00 4.04
1014 1015 1.772182 CCGGAATGATACTGCGAGAC 58.228 55.000 0.00 0.00 0.00 3.36
1015 1016 1.603172 CCGGAATGATACTGCGAGACC 60.603 57.143 0.00 0.00 0.00 3.85
1016 1017 1.067060 CGGAATGATACTGCGAGACCA 59.933 52.381 0.00 0.00 0.00 4.02
1017 1018 2.288457 CGGAATGATACTGCGAGACCAT 60.288 50.000 0.00 0.00 0.00 3.55
1018 1019 3.062763 GGAATGATACTGCGAGACCATG 58.937 50.000 0.00 0.00 0.00 3.66
1019 1020 3.243873 GGAATGATACTGCGAGACCATGA 60.244 47.826 0.00 0.00 0.00 3.07
1020 1021 4.371786 GAATGATACTGCGAGACCATGAA 58.628 43.478 0.00 0.00 0.00 2.57
1021 1022 3.443099 TGATACTGCGAGACCATGAAG 57.557 47.619 0.00 0.00 0.00 3.02
1022 1023 2.101415 TGATACTGCGAGACCATGAAGG 59.899 50.000 0.00 0.00 45.67 3.46
1023 1024 0.824109 TACTGCGAGACCATGAAGGG 59.176 55.000 0.00 0.00 43.89 3.95
1024 1025 1.153289 CTGCGAGACCATGAAGGGG 60.153 63.158 0.00 0.00 43.89 4.79
1025 1026 2.514824 GCGAGACCATGAAGGGGC 60.515 66.667 0.00 0.00 43.89 5.80
1026 1027 2.202932 CGAGACCATGAAGGGGCG 60.203 66.667 0.00 0.00 42.52 6.13
1027 1028 2.190578 GAGACCATGAAGGGGCGG 59.809 66.667 0.00 0.00 42.52 6.13
1028 1029 2.610859 AGACCATGAAGGGGCGGT 60.611 61.111 0.00 0.00 42.52 5.68
1029 1030 2.124695 GACCATGAAGGGGCGGTC 60.125 66.667 0.00 0.00 43.89 4.79
1030 1031 2.933287 ACCATGAAGGGGCGGTCA 60.933 61.111 0.00 0.00 43.89 4.02
1031 1032 2.270874 GACCATGAAGGGGCGGTCAT 62.271 60.000 0.00 0.00 45.96 3.06
1032 1033 1.076777 CCATGAAGGGGCGGTCATT 60.077 57.895 0.00 0.00 32.06 2.57
1033 1034 0.684153 CCATGAAGGGGCGGTCATTT 60.684 55.000 0.00 0.00 32.06 2.32
1034 1035 1.185315 CATGAAGGGGCGGTCATTTT 58.815 50.000 0.00 0.00 32.06 1.82
1035 1036 1.550072 CATGAAGGGGCGGTCATTTTT 59.450 47.619 0.00 0.00 32.06 1.94
1036 1037 0.965439 TGAAGGGGCGGTCATTTTTG 59.035 50.000 0.00 0.00 0.00 2.44
1037 1038 0.389817 GAAGGGGCGGTCATTTTTGC 60.390 55.000 0.00 0.00 0.00 3.68
1038 1039 1.826340 AAGGGGCGGTCATTTTTGCC 61.826 55.000 0.00 0.00 46.82 4.52
1039 1040 2.282783 GGGGCGGTCATTTTTGCCT 61.283 57.895 1.77 0.00 46.72 4.75
1040 1041 1.215382 GGGCGGTCATTTTTGCCTC 59.785 57.895 1.77 0.00 46.72 4.70
1041 1042 1.215382 GGCGGTCATTTTTGCCTCC 59.785 57.895 0.00 0.00 44.16 4.30
1042 1043 1.250840 GGCGGTCATTTTTGCCTCCT 61.251 55.000 0.00 0.00 44.16 3.69
1043 1044 0.109132 GCGGTCATTTTTGCCTCCTG 60.109 55.000 0.00 0.00 0.00 3.86
1044 1045 0.109132 CGGTCATTTTTGCCTCCTGC 60.109 55.000 0.00 0.00 41.77 4.85
1045 1046 0.247460 GGTCATTTTTGCCTCCTGCC 59.753 55.000 0.00 0.00 40.16 4.85
1046 1047 0.109132 GTCATTTTTGCCTCCTGCCG 60.109 55.000 0.00 0.00 40.16 5.69
1047 1048 1.216178 CATTTTTGCCTCCTGCCGG 59.784 57.895 0.00 0.00 40.16 6.13
1048 1049 1.228862 ATTTTTGCCTCCTGCCGGT 60.229 52.632 1.90 0.00 40.16 5.28
1049 1050 0.831711 ATTTTTGCCTCCTGCCGGTT 60.832 50.000 1.90 0.00 40.16 4.44
1050 1051 1.460273 TTTTTGCCTCCTGCCGGTTC 61.460 55.000 1.90 0.00 40.16 3.62
1051 1052 2.632602 TTTTGCCTCCTGCCGGTTCA 62.633 55.000 1.90 0.00 40.16 3.18
1052 1053 2.424842 TTTGCCTCCTGCCGGTTCAT 62.425 55.000 1.90 0.00 40.16 2.57
1053 1054 2.514824 GCCTCCTGCCGGTTCATC 60.515 66.667 1.90 0.00 0.00 2.92
1054 1055 2.190578 CCTCCTGCCGGTTCATCC 59.809 66.667 1.90 0.00 0.00 3.51
1055 1056 2.669133 CCTCCTGCCGGTTCATCCA 61.669 63.158 1.90 0.00 35.57 3.41
1056 1057 1.299648 CTCCTGCCGGTTCATCCAA 59.700 57.895 1.90 0.00 35.57 3.53
1057 1058 1.002624 TCCTGCCGGTTCATCCAAC 60.003 57.895 1.90 0.00 35.57 3.77
1058 1059 2.398554 CCTGCCGGTTCATCCAACG 61.399 63.158 1.90 0.00 35.59 4.10
1059 1060 3.039202 CTGCCGGTTCATCCAACGC 62.039 63.158 1.90 0.00 35.59 4.84
1060 1061 2.746277 GCCGGTTCATCCAACGCT 60.746 61.111 1.90 0.00 35.59 5.07
1061 1062 3.039202 GCCGGTTCATCCAACGCTG 62.039 63.158 1.90 0.00 35.59 5.18
1062 1063 2.480555 CGGTTCATCCAACGCTGC 59.519 61.111 0.00 0.00 35.59 5.25
1063 1064 2.324330 CGGTTCATCCAACGCTGCA 61.324 57.895 0.00 0.00 35.59 4.41
1064 1065 1.210155 GGTTCATCCAACGCTGCAC 59.790 57.895 0.00 0.00 35.59 4.57
1065 1066 1.210155 GTTCATCCAACGCTGCACC 59.790 57.895 0.00 0.00 0.00 5.01
1066 1067 1.228094 TTCATCCAACGCTGCACCA 60.228 52.632 0.00 0.00 0.00 4.17
1067 1068 1.236616 TTCATCCAACGCTGCACCAG 61.237 55.000 0.00 0.00 34.12 4.00
1068 1069 1.968017 CATCCAACGCTGCACCAGT 60.968 57.895 0.00 0.00 33.43 4.00
1069 1070 1.968017 ATCCAACGCTGCACCAGTG 60.968 57.895 0.00 4.38 46.11 3.66
1079 1080 2.740055 CACCAGTGCACTCGAGGC 60.740 66.667 18.64 17.12 0.00 4.70
1080 1081 4.363990 ACCAGTGCACTCGAGGCG 62.364 66.667 18.64 8.62 0.00 5.52
1082 1083 4.056125 CAGTGCACTCGAGGCGGA 62.056 66.667 18.64 5.75 0.00 5.54
1083 1084 3.753434 AGTGCACTCGAGGCGGAG 61.753 66.667 15.25 7.01 39.97 4.63
1084 1085 4.803426 GTGCACTCGAGGCGGAGG 62.803 72.222 18.41 0.00 38.39 4.30
1086 1087 4.500116 GCACTCGAGGCGGAGGTC 62.500 72.222 18.41 1.52 38.39 3.85
1087 1088 4.180946 CACTCGAGGCGGAGGTCG 62.181 72.222 18.41 0.52 38.39 4.79
1098 1099 3.857854 GAGGTCGCAGCGTGCATG 61.858 66.667 15.93 0.09 45.36 4.06
1101 1102 3.857854 GTCGCAGCGTGCATGGAG 61.858 66.667 15.93 0.00 45.36 3.86
1105 1106 4.790962 CAGCGTGCATGGAGGGCT 62.791 66.667 8.27 7.89 0.00 5.19
1106 1107 4.039092 AGCGTGCATGGAGGGCTT 62.039 61.111 8.27 0.00 0.00 4.35
1107 1108 3.818787 GCGTGCATGGAGGGCTTG 61.819 66.667 8.27 0.00 0.00 4.01
1108 1109 2.046023 CGTGCATGGAGGGCTTGA 60.046 61.111 0.00 0.00 0.00 3.02
1109 1110 2.401766 CGTGCATGGAGGGCTTGAC 61.402 63.158 0.00 0.00 0.00 3.18
1110 1111 2.048603 GTGCATGGAGGGCTTGACC 61.049 63.158 0.00 0.00 37.93 4.02
1119 1120 2.361737 GGCTTGACCCTTGCCCTC 60.362 66.667 0.00 0.00 40.71 4.30
1120 1121 2.747855 GCTTGACCCTTGCCCTCG 60.748 66.667 0.00 0.00 0.00 4.63
1121 1122 3.068881 CTTGACCCTTGCCCTCGA 58.931 61.111 0.00 0.00 0.00 4.04
1122 1123 1.374947 CTTGACCCTTGCCCTCGAA 59.625 57.895 0.00 0.00 0.00 3.71
1123 1124 0.035056 CTTGACCCTTGCCCTCGAAT 60.035 55.000 0.00 0.00 0.00 3.34
1124 1125 0.322456 TTGACCCTTGCCCTCGAATG 60.322 55.000 0.00 0.00 0.00 2.67
1125 1126 1.452108 GACCCTTGCCCTCGAATGG 60.452 63.158 0.00 0.00 0.00 3.16
1126 1127 1.910580 GACCCTTGCCCTCGAATGGA 61.911 60.000 4.86 0.00 0.00 3.41
1127 1128 1.153086 CCCTTGCCCTCGAATGGAG 60.153 63.158 4.86 0.00 42.75 3.86
1128 1129 1.821332 CCTTGCCCTCGAATGGAGC 60.821 63.158 4.86 1.80 41.71 4.70
1129 1130 1.078214 CTTGCCCTCGAATGGAGCA 60.078 57.895 4.86 4.21 41.71 4.26
1130 1131 1.078214 TTGCCCTCGAATGGAGCAG 60.078 57.895 4.86 0.00 41.71 4.24
1131 1132 1.552799 TTGCCCTCGAATGGAGCAGA 61.553 55.000 4.86 0.00 41.71 4.26
1132 1133 1.227497 GCCCTCGAATGGAGCAGAG 60.227 63.158 4.86 0.00 41.71 3.35
1133 1134 1.227497 CCCTCGAATGGAGCAGAGC 60.227 63.158 0.00 0.00 41.71 4.09
1134 1135 1.227497 CCTCGAATGGAGCAGAGCC 60.227 63.158 0.00 0.00 41.71 4.70
1135 1136 1.227497 CTCGAATGGAGCAGAGCCC 60.227 63.158 0.00 0.00 35.63 5.19
1136 1137 2.203126 CGAATGGAGCAGAGCCCC 60.203 66.667 0.00 0.00 0.00 5.80
1137 1138 2.739996 CGAATGGAGCAGAGCCCCT 61.740 63.158 0.00 0.00 0.00 4.79
1138 1139 1.148048 GAATGGAGCAGAGCCCCTC 59.852 63.158 0.00 0.00 0.00 4.30
1139 1140 1.307691 AATGGAGCAGAGCCCCTCT 60.308 57.895 0.00 0.00 42.11 3.69
1140 1141 1.344191 AATGGAGCAGAGCCCCTCTC 61.344 60.000 0.00 0.00 38.99 3.20
1141 1142 2.364842 GGAGCAGAGCCCCTCTCA 60.365 66.667 0.00 0.00 44.35 3.27
1142 1143 1.765657 GGAGCAGAGCCCCTCTCAT 60.766 63.158 0.00 0.00 44.35 2.90
1143 1144 1.344191 GGAGCAGAGCCCCTCTCATT 61.344 60.000 0.00 0.00 44.35 2.57
1144 1145 1.418334 GAGCAGAGCCCCTCTCATTA 58.582 55.000 0.00 0.00 44.35 1.90
1145 1146 1.977129 GAGCAGAGCCCCTCTCATTAT 59.023 52.381 0.00 0.00 44.35 1.28
1146 1147 2.371510 GAGCAGAGCCCCTCTCATTATT 59.628 50.000 0.00 0.00 44.35 1.40
1147 1148 2.106166 AGCAGAGCCCCTCTCATTATTG 59.894 50.000 0.00 0.00 44.35 1.90
1148 1149 2.105477 GCAGAGCCCCTCTCATTATTGA 59.895 50.000 0.00 0.00 44.35 2.57
1161 1162 4.176271 TCATTATTGAGACAGACTGCACG 58.824 43.478 1.25 0.00 0.00 5.34
1162 1163 3.660501 TTATTGAGACAGACTGCACGT 57.339 42.857 1.25 0.00 0.00 4.49
1163 1164 2.533266 ATTGAGACAGACTGCACGTT 57.467 45.000 1.25 0.00 0.00 3.99
1164 1165 2.309528 TTGAGACAGACTGCACGTTT 57.690 45.000 1.25 0.00 0.00 3.60
1165 1166 1.570813 TGAGACAGACTGCACGTTTG 58.429 50.000 1.25 5.63 34.12 2.93
1186 1187 2.990941 CGGCAAGCATGTTGTATGATC 58.009 47.619 0.00 0.00 0.00 2.92
1187 1188 2.287188 CGGCAAGCATGTTGTATGATCC 60.287 50.000 0.00 0.00 0.00 3.36
1188 1189 2.954318 GGCAAGCATGTTGTATGATCCT 59.046 45.455 0.00 0.00 0.00 3.24
1189 1190 3.243301 GGCAAGCATGTTGTATGATCCTG 60.243 47.826 0.00 0.00 0.00 3.86
1190 1191 3.628942 GCAAGCATGTTGTATGATCCTGA 59.371 43.478 0.00 0.00 0.00 3.86
1191 1192 4.261072 GCAAGCATGTTGTATGATCCTGAG 60.261 45.833 0.00 0.00 0.00 3.35
1192 1193 3.474600 AGCATGTTGTATGATCCTGAGC 58.525 45.455 0.00 0.00 0.00 4.26
1193 1194 3.136077 AGCATGTTGTATGATCCTGAGCT 59.864 43.478 0.00 0.00 0.00 4.09
1194 1195 3.497640 GCATGTTGTATGATCCTGAGCTC 59.502 47.826 6.82 6.82 0.00 4.09
1195 1196 4.700700 CATGTTGTATGATCCTGAGCTCA 58.299 43.478 17.19 17.19 0.00 4.26
1196 1197 4.824479 TGTTGTATGATCCTGAGCTCAA 57.176 40.909 18.85 3.88 0.00 3.02
1197 1198 5.363562 TGTTGTATGATCCTGAGCTCAAT 57.636 39.130 18.85 9.41 0.00 2.57
1198 1199 6.484364 TGTTGTATGATCCTGAGCTCAATA 57.516 37.500 18.85 9.33 0.00 1.90
1199 1200 6.519382 TGTTGTATGATCCTGAGCTCAATAG 58.481 40.000 18.85 9.68 0.00 1.73
1200 1201 6.324770 TGTTGTATGATCCTGAGCTCAATAGA 59.675 38.462 18.85 14.80 0.00 1.98
1201 1202 7.015974 TGTTGTATGATCCTGAGCTCAATAGAT 59.984 37.037 18.85 18.69 0.00 1.98
1202 1203 7.167924 TGTATGATCCTGAGCTCAATAGATC 57.832 40.000 28.08 28.08 38.67 2.75
1203 1204 6.723052 TGTATGATCCTGAGCTCAATAGATCA 59.277 38.462 33.66 33.66 45.62 2.92
1204 1205 5.465532 TGATCCTGAGCTCAATAGATCAC 57.534 43.478 30.93 18.32 43.05 3.06
1205 1206 4.282957 TGATCCTGAGCTCAATAGATCACC 59.717 45.833 30.93 17.85 43.05 4.02
1206 1207 2.625314 TCCTGAGCTCAATAGATCACCG 59.375 50.000 18.85 1.46 43.05 4.94
1207 1208 2.288702 CCTGAGCTCAATAGATCACCGG 60.289 54.545 18.85 7.39 43.05 5.28
1208 1209 2.363680 CTGAGCTCAATAGATCACCGGT 59.636 50.000 18.85 0.00 43.05 5.28
1209 1210 2.766263 TGAGCTCAATAGATCACCGGTT 59.234 45.455 15.67 0.00 43.05 4.44
1210 1211 3.126831 GAGCTCAATAGATCACCGGTTG 58.873 50.000 2.97 0.00 38.07 3.77
1211 1212 1.599542 GCTCAATAGATCACCGGTTGC 59.400 52.381 2.97 0.00 0.00 4.17
1212 1213 2.905075 CTCAATAGATCACCGGTTGCA 58.095 47.619 2.97 0.00 0.00 4.08
1213 1214 3.470709 CTCAATAGATCACCGGTTGCAT 58.529 45.455 2.97 0.00 0.00 3.96
1214 1215 3.466836 TCAATAGATCACCGGTTGCATC 58.533 45.455 2.97 7.13 0.00 3.91
1215 1216 3.134623 TCAATAGATCACCGGTTGCATCT 59.865 43.478 19.56 19.56 0.00 2.90
1216 1217 2.890808 TAGATCACCGGTTGCATCTC 57.109 50.000 19.32 5.51 0.00 2.75
1217 1218 1.198713 AGATCACCGGTTGCATCTCT 58.801 50.000 2.97 0.00 0.00 3.10
1218 1219 1.134580 AGATCACCGGTTGCATCTCTG 60.135 52.381 2.97 0.00 0.00 3.35
1219 1220 0.904649 ATCACCGGTTGCATCTCTGA 59.095 50.000 2.97 0.00 0.00 3.27
1220 1221 0.904649 TCACCGGTTGCATCTCTGAT 59.095 50.000 2.97 0.00 0.00 2.90
1221 1222 2.107366 TCACCGGTTGCATCTCTGATA 58.893 47.619 2.97 0.00 0.00 2.15
1222 1223 2.101415 TCACCGGTTGCATCTCTGATAG 59.899 50.000 2.97 0.00 0.00 2.08
1223 1224 2.101415 CACCGGTTGCATCTCTGATAGA 59.899 50.000 2.97 0.00 39.02 1.98
1224 1225 2.766263 ACCGGTTGCATCTCTGATAGAA 59.234 45.455 0.00 0.00 37.89 2.10
1225 1226 3.181471 ACCGGTTGCATCTCTGATAGAAG 60.181 47.826 0.00 0.00 37.89 2.85
1226 1227 2.799412 CGGTTGCATCTCTGATAGAAGC 59.201 50.000 0.00 0.00 46.77 3.86
1231 1232 3.711086 GCATCTCTGATAGAAGCAACGA 58.289 45.455 0.00 0.00 46.05 3.85
1232 1233 4.115516 GCATCTCTGATAGAAGCAACGAA 58.884 43.478 0.00 0.00 46.05 3.85
1233 1234 4.208873 GCATCTCTGATAGAAGCAACGAAG 59.791 45.833 0.00 0.00 46.05 3.79
1234 1235 3.775202 TCTCTGATAGAAGCAACGAAGC 58.225 45.455 0.00 0.00 0.00 3.86
1235 1236 2.530177 TCTGATAGAAGCAACGAAGCG 58.470 47.619 0.00 0.00 40.15 4.68
1236 1237 1.590238 CTGATAGAAGCAACGAAGCGG 59.410 52.381 0.00 0.00 40.15 5.52
1237 1238 0.301987 GATAGAAGCAACGAAGCGGC 59.698 55.000 0.00 0.00 40.15 6.53
1238 1239 0.391130 ATAGAAGCAACGAAGCGGCA 60.391 50.000 1.45 0.00 40.15 5.69
1239 1240 1.289109 TAGAAGCAACGAAGCGGCAC 61.289 55.000 1.45 0.00 40.15 5.01
1240 1241 3.595108 GAAGCAACGAAGCGGCACC 62.595 63.158 1.45 0.00 40.15 5.01
1241 1242 4.626081 AGCAACGAAGCGGCACCT 62.626 61.111 1.45 0.00 40.15 4.00
1242 1243 3.660111 GCAACGAAGCGGCACCTT 61.660 61.111 1.45 0.00 0.00 3.50
1243 1244 2.252260 CAACGAAGCGGCACCTTG 59.748 61.111 1.45 0.00 0.00 3.61
1244 1245 3.660111 AACGAAGCGGCACCTTGC 61.660 61.111 1.45 0.00 44.08 4.01
1254 1255 4.954970 CACCTTGCGGCTGGGTGT 62.955 66.667 25.39 6.21 43.72 4.16
1255 1256 4.643387 ACCTTGCGGCTGGGTGTC 62.643 66.667 14.52 0.00 31.48 3.67
1256 1257 4.641645 CCTTGCGGCTGGGTGTCA 62.642 66.667 0.00 0.00 0.00 3.58
1257 1258 2.594303 CTTGCGGCTGGGTGTCAA 60.594 61.111 0.00 0.00 0.00 3.18
1258 1259 2.904866 TTGCGGCTGGGTGTCAAC 60.905 61.111 0.00 0.00 0.00 3.18
1259 1260 3.705934 TTGCGGCTGGGTGTCAACA 62.706 57.895 0.00 0.00 0.00 3.33
1260 1261 2.672996 GCGGCTGGGTGTCAACAT 60.673 61.111 0.00 0.00 0.00 2.71
1261 1262 2.981560 GCGGCTGGGTGTCAACATG 61.982 63.158 0.00 0.00 0.00 3.21
1262 1263 1.600636 CGGCTGGGTGTCAACATGT 60.601 57.895 0.00 0.00 0.00 3.21
1263 1264 0.321210 CGGCTGGGTGTCAACATGTA 60.321 55.000 0.00 0.00 0.00 2.29
1264 1265 1.880221 CGGCTGGGTGTCAACATGTAA 60.880 52.381 0.00 0.00 0.00 2.41
1265 1266 2.446435 GGCTGGGTGTCAACATGTAAT 58.554 47.619 0.00 0.00 0.00 1.89
1266 1267 2.825532 GGCTGGGTGTCAACATGTAATT 59.174 45.455 0.00 0.00 0.00 1.40
1267 1268 4.013728 GGCTGGGTGTCAACATGTAATTA 58.986 43.478 0.00 0.00 0.00 1.40
1268 1269 4.461081 GGCTGGGTGTCAACATGTAATTAA 59.539 41.667 0.00 0.00 0.00 1.40
1269 1270 5.393027 GGCTGGGTGTCAACATGTAATTAAG 60.393 44.000 0.00 0.00 0.00 1.85
1270 1271 5.393027 GCTGGGTGTCAACATGTAATTAAGG 60.393 44.000 0.00 0.00 0.00 2.69
1271 1272 5.636123 TGGGTGTCAACATGTAATTAAGGT 58.364 37.500 0.00 0.00 0.00 3.50
1272 1273 5.475220 TGGGTGTCAACATGTAATTAAGGTG 59.525 40.000 0.00 0.00 0.00 4.00
1273 1274 5.708230 GGGTGTCAACATGTAATTAAGGTGA 59.292 40.000 0.00 0.00 0.00 4.02
1274 1275 6.377146 GGGTGTCAACATGTAATTAAGGTGAT 59.623 38.462 0.00 0.00 0.00 3.06
1275 1276 7.415206 GGGTGTCAACATGTAATTAAGGTGATC 60.415 40.741 0.00 0.00 0.00 2.92
1276 1277 7.120579 GGTGTCAACATGTAATTAAGGTGATCA 59.879 37.037 0.00 0.00 0.00 2.92
1277 1278 8.511321 GTGTCAACATGTAATTAAGGTGATCAA 58.489 33.333 0.00 0.00 0.00 2.57
1278 1279 8.729756 TGTCAACATGTAATTAAGGTGATCAAG 58.270 33.333 0.00 0.00 0.00 3.02
1279 1280 8.946085 GTCAACATGTAATTAAGGTGATCAAGA 58.054 33.333 0.00 0.00 0.00 3.02
1280 1281 9.166173 TCAACATGTAATTAAGGTGATCAAGAG 57.834 33.333 0.00 0.00 0.00 2.85
1281 1282 9.166173 CAACATGTAATTAAGGTGATCAAGAGA 57.834 33.333 0.00 0.00 0.00 3.10
1282 1283 8.954950 ACATGTAATTAAGGTGATCAAGAGAG 57.045 34.615 0.00 0.00 0.00 3.20
1283 1284 8.762645 ACATGTAATTAAGGTGATCAAGAGAGA 58.237 33.333 0.00 0.00 0.00 3.10
1284 1285 9.605275 CATGTAATTAAGGTGATCAAGAGAGAA 57.395 33.333 0.00 0.00 0.00 2.87
1285 1286 9.606631 ATGTAATTAAGGTGATCAAGAGAGAAC 57.393 33.333 0.00 0.00 0.00 3.01
1286 1287 8.593679 TGTAATTAAGGTGATCAAGAGAGAACA 58.406 33.333 0.00 0.00 0.00 3.18
1287 1288 9.436957 GTAATTAAGGTGATCAAGAGAGAACAA 57.563 33.333 0.00 0.00 0.00 2.83
1288 1289 8.924511 AATTAAGGTGATCAAGAGAGAACAAA 57.075 30.769 0.00 0.00 0.00 2.83
1289 1290 8.924511 ATTAAGGTGATCAAGAGAGAACAAAA 57.075 30.769 0.00 0.00 0.00 2.44
1290 1291 8.924511 TTAAGGTGATCAAGAGAGAACAAAAT 57.075 30.769 0.00 0.00 0.00 1.82
1292 1293 8.558973 AAGGTGATCAAGAGAGAACAAAATAG 57.441 34.615 0.00 0.00 0.00 1.73
1293 1294 7.684529 AGGTGATCAAGAGAGAACAAAATAGT 58.315 34.615 0.00 0.00 0.00 2.12
1294 1295 7.605691 AGGTGATCAAGAGAGAACAAAATAGTG 59.394 37.037 0.00 0.00 0.00 2.74
1295 1296 7.389053 GGTGATCAAGAGAGAACAAAATAGTGT 59.611 37.037 0.00 0.00 0.00 3.55
1296 1297 8.778358 GTGATCAAGAGAGAACAAAATAGTGTT 58.222 33.333 0.00 0.00 44.38 3.32
1297 1298 9.996554 TGATCAAGAGAGAACAAAATAGTGTTA 57.003 29.630 0.00 0.00 41.78 2.41
1299 1300 8.311650 TCAAGAGAGAACAAAATAGTGTTAGC 57.688 34.615 0.00 0.00 41.78 3.09
1300 1301 7.387948 TCAAGAGAGAACAAAATAGTGTTAGCC 59.612 37.037 0.00 0.00 41.78 3.93
1301 1302 6.769512 AGAGAGAACAAAATAGTGTTAGCCA 58.230 36.000 0.00 0.00 41.78 4.75
1302 1303 7.398024 AGAGAGAACAAAATAGTGTTAGCCAT 58.602 34.615 0.00 0.00 41.78 4.40
1303 1304 7.335422 AGAGAGAACAAAATAGTGTTAGCCATG 59.665 37.037 0.00 0.00 41.78 3.66
1304 1305 5.954335 AGAACAAAATAGTGTTAGCCATGC 58.046 37.500 0.00 0.00 41.78 4.06
1305 1306 5.711976 AGAACAAAATAGTGTTAGCCATGCT 59.288 36.000 0.00 0.00 41.78 3.79
1306 1307 5.982890 ACAAAATAGTGTTAGCCATGCTT 57.017 34.783 0.00 0.00 40.44 3.91
1307 1308 6.345096 ACAAAATAGTGTTAGCCATGCTTT 57.655 33.333 0.00 0.00 40.44 3.51
1308 1309 6.158598 ACAAAATAGTGTTAGCCATGCTTTG 58.841 36.000 0.00 0.00 40.44 2.77
1309 1310 8.217879 AACAAAATAGTGTTAGCCATGCTTTGG 61.218 37.037 0.00 2.22 43.13 3.28
1316 1317 4.368003 CCATGCTTTGGCCCAGAT 57.632 55.556 0.00 0.00 39.09 2.90
1317 1318 1.820581 CCATGCTTTGGCCCAGATG 59.179 57.895 0.00 2.85 39.09 2.90
1318 1319 1.682451 CCATGCTTTGGCCCAGATGG 61.682 60.000 0.00 7.99 39.09 3.51
1328 1329 3.234349 CCAGATGGGGCGATCTGT 58.766 61.111 18.54 0.00 45.49 3.41
1329 1330 2.440946 CCAGATGGGGCGATCTGTA 58.559 57.895 18.54 0.00 45.49 2.74
1330 1331 0.034059 CCAGATGGGGCGATCTGTAC 59.966 60.000 18.54 0.00 45.49 2.90
1331 1332 0.034059 CAGATGGGGCGATCTGTACC 59.966 60.000 14.11 0.00 43.04 3.34
1332 1333 1.122019 AGATGGGGCGATCTGTACCC 61.122 60.000 0.00 0.00 43.44 3.69
1334 1335 2.822399 GGGGCGATCTGTACCCAG 59.178 66.667 10.89 0.00 46.21 4.45
1342 1343 1.972198 TCTGTACCCAGAACAGCCG 59.028 57.895 0.00 0.00 44.67 5.52
1343 1344 0.830444 TCTGTACCCAGAACAGCCGT 60.830 55.000 0.00 0.00 44.67 5.68
1344 1345 0.034896 CTGTACCCAGAACAGCCGTT 59.965 55.000 0.00 0.00 41.50 4.44
1345 1346 0.470766 TGTACCCAGAACAGCCGTTT 59.529 50.000 0.00 0.00 34.75 3.60
1346 1347 0.872388 GTACCCAGAACAGCCGTTTG 59.128 55.000 0.00 0.00 34.75 2.93
1347 1348 0.250553 TACCCAGAACAGCCGTTTGG 60.251 55.000 6.91 6.91 34.75 3.28
1357 1358 4.383602 CCGTTTGGCTGCGTTCGG 62.384 66.667 8.99 8.99 0.00 4.30
1358 1359 3.645975 CGTTTGGCTGCGTTCGGT 61.646 61.111 0.00 0.00 0.00 4.69
1359 1360 2.251371 GTTTGGCTGCGTTCGGTC 59.749 61.111 0.00 0.00 0.00 4.79
1360 1361 2.975799 TTTGGCTGCGTTCGGTCC 60.976 61.111 0.00 0.00 0.00 4.46
1364 1365 4.373116 GCTGCGTTCGGTCCCTGA 62.373 66.667 0.00 0.00 0.00 3.86
1365 1366 2.342279 CTGCGTTCGGTCCCTGAA 59.658 61.111 0.00 0.00 0.00 3.02
1366 1367 1.738099 CTGCGTTCGGTCCCTGAAG 60.738 63.158 0.00 0.00 0.00 3.02
1367 1368 2.154798 CTGCGTTCGGTCCCTGAAGA 62.155 60.000 0.00 0.00 0.00 2.87
1368 1369 1.446272 GCGTTCGGTCCCTGAAGAG 60.446 63.158 0.00 0.00 0.00 2.85
1369 1370 1.215647 CGTTCGGTCCCTGAAGAGG 59.784 63.158 0.00 0.00 39.42 3.69
1370 1371 1.533469 CGTTCGGTCCCTGAAGAGGT 61.533 60.000 0.00 0.00 37.73 3.85
1371 1372 0.685660 GTTCGGTCCCTGAAGAGGTT 59.314 55.000 0.00 0.00 37.73 3.50
1372 1373 0.685097 TTCGGTCCCTGAAGAGGTTG 59.315 55.000 0.00 0.00 37.73 3.77
1373 1374 0.178944 TCGGTCCCTGAAGAGGTTGA 60.179 55.000 0.00 0.00 37.73 3.18
1374 1375 0.037232 CGGTCCCTGAAGAGGTTGAC 60.037 60.000 0.00 0.00 37.73 3.18
1375 1376 1.353091 GGTCCCTGAAGAGGTTGACT 58.647 55.000 0.00 0.00 37.73 3.41
1376 1377 1.700186 GGTCCCTGAAGAGGTTGACTT 59.300 52.381 0.00 0.00 37.73 3.01
1377 1378 2.551071 GGTCCCTGAAGAGGTTGACTTG 60.551 54.545 0.00 0.00 37.73 3.16
1378 1379 1.072331 TCCCTGAAGAGGTTGACTTGC 59.928 52.381 0.00 0.00 37.73 4.01
1379 1380 1.072965 CCCTGAAGAGGTTGACTTGCT 59.927 52.381 0.00 0.00 37.73 3.91
1380 1381 2.303022 CCCTGAAGAGGTTGACTTGCTA 59.697 50.000 0.00 0.00 37.73 3.49
1381 1382 3.054802 CCCTGAAGAGGTTGACTTGCTAT 60.055 47.826 0.00 0.00 37.73 2.97
1382 1383 3.937706 CCTGAAGAGGTTGACTTGCTATG 59.062 47.826 0.00 0.00 34.16 2.23
1383 1384 4.564406 CCTGAAGAGGTTGACTTGCTATGT 60.564 45.833 0.00 0.00 34.16 2.29
1384 1385 4.569943 TGAAGAGGTTGACTTGCTATGTC 58.430 43.478 0.00 0.00 35.21 3.06
1385 1386 4.040339 TGAAGAGGTTGACTTGCTATGTCA 59.960 41.667 3.58 3.58 41.94 3.58
1391 1392 4.350368 TTGACTTGCTATGTCAACAGGA 57.650 40.909 12.99 0.00 45.77 3.86
1392 1393 4.558226 TGACTTGCTATGTCAACAGGAT 57.442 40.909 4.93 0.00 40.89 3.24
1393 1394 4.910195 TGACTTGCTATGTCAACAGGATT 58.090 39.130 4.93 0.00 40.89 3.01
1394 1395 4.696877 TGACTTGCTATGTCAACAGGATTG 59.303 41.667 4.93 0.00 40.89 2.67
1395 1396 4.655963 ACTTGCTATGTCAACAGGATTGT 58.344 39.130 0.00 0.00 39.87 2.71
1396 1397 5.804639 ACTTGCTATGTCAACAGGATTGTA 58.195 37.500 0.00 0.00 36.23 2.41
1397 1398 6.237901 ACTTGCTATGTCAACAGGATTGTAA 58.762 36.000 0.00 0.00 36.23 2.41
1398 1399 6.886459 ACTTGCTATGTCAACAGGATTGTAAT 59.114 34.615 0.00 0.00 36.23 1.89
1399 1400 6.682423 TGCTATGTCAACAGGATTGTAATG 57.318 37.500 0.00 0.00 36.23 1.90
1400 1401 6.413892 TGCTATGTCAACAGGATTGTAATGA 58.586 36.000 0.00 0.00 36.23 2.57
1401 1402 6.316140 TGCTATGTCAACAGGATTGTAATGAC 59.684 38.462 5.85 5.85 41.90 3.06
1417 1418 7.716768 TGTAATGACAACGTTTGAGTAATGA 57.283 32.000 0.00 0.00 30.68 2.57
1418 1419 8.144155 TGTAATGACAACGTTTGAGTAATGAA 57.856 30.769 0.00 0.00 30.68 2.57
1419 1420 8.779303 TGTAATGACAACGTTTGAGTAATGAAT 58.221 29.630 0.00 0.00 30.68 2.57
1420 1421 9.607285 GTAATGACAACGTTTGAGTAATGAATT 57.393 29.630 0.00 0.00 0.00 2.17
1422 1423 9.528018 AATGACAACGTTTGAGTAATGAATTTT 57.472 25.926 0.00 0.00 0.00 1.82
1423 1424 8.918961 TGACAACGTTTGAGTAATGAATTTTT 57.081 26.923 0.00 0.00 0.00 1.94
1479 1480 9.465199 TCAGATTCAAGATGTTTGGATTTATGA 57.535 29.630 0.00 0.00 0.00 2.15
1483 1484 9.826574 ATTCAAGATGTTTGGATTTATGATTGG 57.173 29.630 0.00 0.00 0.00 3.16
1484 1485 8.592529 TCAAGATGTTTGGATTTATGATTGGA 57.407 30.769 0.00 0.00 0.00 3.53
1485 1486 8.689061 TCAAGATGTTTGGATTTATGATTGGAG 58.311 33.333 0.00 0.00 0.00 3.86
1486 1487 8.689061 CAAGATGTTTGGATTTATGATTGGAGA 58.311 33.333 0.00 0.00 0.00 3.71
1487 1488 8.827832 AGATGTTTGGATTTATGATTGGAGAA 57.172 30.769 0.00 0.00 0.00 2.87
1488 1489 8.910944 AGATGTTTGGATTTATGATTGGAGAAG 58.089 33.333 0.00 0.00 0.00 2.85
1489 1490 6.866480 TGTTTGGATTTATGATTGGAGAAGC 58.134 36.000 0.00 0.00 0.00 3.86
1490 1491 5.756195 TTGGATTTATGATTGGAGAAGCG 57.244 39.130 0.00 0.00 0.00 4.68
1491 1492 4.780815 TGGATTTATGATTGGAGAAGCGT 58.219 39.130 0.00 0.00 0.00 5.07
1492 1493 4.816385 TGGATTTATGATTGGAGAAGCGTC 59.184 41.667 0.00 0.00 0.00 5.19
1493 1494 4.214332 GGATTTATGATTGGAGAAGCGTCC 59.786 45.833 0.00 0.00 37.10 4.79
1494 1495 2.509052 TATGATTGGAGAAGCGTCCG 57.491 50.000 0.00 0.00 39.81 4.79
1495 1496 0.179073 ATGATTGGAGAAGCGTCCGG 60.179 55.000 0.00 0.00 39.81 5.14
1496 1497 1.218316 GATTGGAGAAGCGTCCGGT 59.782 57.895 0.00 0.00 39.81 5.28
1497 1498 1.079127 ATTGGAGAAGCGTCCGGTG 60.079 57.895 0.00 0.00 39.81 4.94
1498 1499 1.827399 ATTGGAGAAGCGTCCGGTGT 61.827 55.000 0.00 0.00 39.81 4.16
1499 1500 1.180456 TTGGAGAAGCGTCCGGTGTA 61.180 55.000 0.00 0.00 39.81 2.90
1500 1501 0.968901 TGGAGAAGCGTCCGGTGTAT 60.969 55.000 0.00 0.00 39.81 2.29
1501 1502 0.175073 GGAGAAGCGTCCGGTGTATT 59.825 55.000 0.00 0.00 0.00 1.89
1502 1503 1.405121 GGAGAAGCGTCCGGTGTATTT 60.405 52.381 0.00 0.00 0.00 1.40
1503 1504 2.344025 GAGAAGCGTCCGGTGTATTTT 58.656 47.619 0.00 0.00 0.00 1.82
1504 1505 2.344025 AGAAGCGTCCGGTGTATTTTC 58.656 47.619 0.00 0.00 0.00 2.29
1505 1506 1.060122 GAAGCGTCCGGTGTATTTTCG 59.940 52.381 0.00 0.00 0.00 3.46
1506 1507 0.037975 AGCGTCCGGTGTATTTTCGT 60.038 50.000 0.00 0.00 0.00 3.85
1507 1508 0.367887 GCGTCCGGTGTATTTTCGTC 59.632 55.000 0.00 0.00 0.00 4.20
1508 1509 1.986698 CGTCCGGTGTATTTTCGTCT 58.013 50.000 0.00 0.00 0.00 4.18
1509 1510 1.652124 CGTCCGGTGTATTTTCGTCTG 59.348 52.381 0.00 0.00 0.00 3.51
1510 1511 1.392510 GTCCGGTGTATTTTCGTCTGC 59.607 52.381 0.00 0.00 0.00 4.26
1511 1512 1.001068 TCCGGTGTATTTTCGTCTGCA 59.999 47.619 0.00 0.00 0.00 4.41
1512 1513 1.801771 CCGGTGTATTTTCGTCTGCAA 59.198 47.619 0.00 0.00 0.00 4.08
1513 1514 2.418628 CCGGTGTATTTTCGTCTGCAAT 59.581 45.455 0.00 0.00 0.00 3.56
1514 1515 3.119990 CCGGTGTATTTTCGTCTGCAATT 60.120 43.478 0.00 0.00 0.00 2.32
1515 1516 4.093703 CCGGTGTATTTTCGTCTGCAATTA 59.906 41.667 0.00 0.00 0.00 1.40
1516 1517 5.255596 CGGTGTATTTTCGTCTGCAATTAG 58.744 41.667 0.00 0.00 0.00 1.73
1517 1518 5.163893 CGGTGTATTTTCGTCTGCAATTAGT 60.164 40.000 0.00 0.00 0.00 2.24
1518 1519 6.608610 GGTGTATTTTCGTCTGCAATTAGTT 58.391 36.000 0.00 0.00 0.00 2.24
1519 1520 6.523201 GGTGTATTTTCGTCTGCAATTAGTTG 59.477 38.462 0.00 0.00 38.39 3.16
1520 1521 6.523201 GTGTATTTTCGTCTGCAATTAGTTGG 59.477 38.462 0.00 0.00 35.83 3.77
1521 1522 5.957842 ATTTTCGTCTGCAATTAGTTGGA 57.042 34.783 0.00 0.00 35.83 3.53
1522 1523 4.742438 TTTCGTCTGCAATTAGTTGGAC 57.258 40.909 0.00 0.00 35.83 4.02
1523 1524 3.394674 TCGTCTGCAATTAGTTGGACA 57.605 42.857 0.00 0.00 35.83 4.02
1524 1525 3.064207 TCGTCTGCAATTAGTTGGACAC 58.936 45.455 0.00 0.00 35.83 3.67
1525 1526 2.805671 CGTCTGCAATTAGTTGGACACA 59.194 45.455 0.00 0.00 35.83 3.72
1526 1527 3.249799 CGTCTGCAATTAGTTGGACACAA 59.750 43.478 0.00 0.00 35.83 3.33
1539 1540 4.647424 TGGACACAACAATGGAAAGAAC 57.353 40.909 0.00 0.00 0.00 3.01
1540 1541 4.277476 TGGACACAACAATGGAAAGAACT 58.723 39.130 0.00 0.00 0.00 3.01
1541 1542 4.709397 TGGACACAACAATGGAAAGAACTT 59.291 37.500 0.00 0.00 0.00 2.66
1542 1543 5.043248 GGACACAACAATGGAAAGAACTTG 58.957 41.667 0.00 0.00 0.00 3.16
1543 1544 5.163561 GGACACAACAATGGAAAGAACTTGA 60.164 40.000 0.00 0.00 0.00 3.02
1544 1545 6.461509 GGACACAACAATGGAAAGAACTTGAT 60.462 38.462 0.00 0.00 0.00 2.57
1545 1546 6.877236 ACACAACAATGGAAAGAACTTGATT 58.123 32.000 0.00 0.00 0.00 2.57
1546 1547 7.330262 ACACAACAATGGAAAGAACTTGATTT 58.670 30.769 0.00 0.00 0.00 2.17
1547 1548 7.823799 ACACAACAATGGAAAGAACTTGATTTT 59.176 29.630 0.00 0.00 0.00 1.82
1548 1549 8.330302 CACAACAATGGAAAGAACTTGATTTTC 58.670 33.333 0.00 0.00 0.00 2.29
1549 1550 8.260114 ACAACAATGGAAAGAACTTGATTTTCT 58.740 29.630 0.00 0.00 34.66 2.52
1550 1551 9.101655 CAACAATGGAAAGAACTTGATTTTCTT 57.898 29.630 0.00 0.00 43.67 2.52
1551 1552 8.877808 ACAATGGAAAGAACTTGATTTTCTTC 57.122 30.769 0.00 0.00 41.48 2.87
1552 1553 8.699130 ACAATGGAAAGAACTTGATTTTCTTCT 58.301 29.630 0.00 0.00 41.48 2.85
1553 1554 9.538508 CAATGGAAAGAACTTGATTTTCTTCTT 57.461 29.630 0.00 0.00 41.48 2.52
1554 1555 9.755804 AATGGAAAGAACTTGATTTTCTTCTTC 57.244 29.630 0.00 0.00 41.48 2.87
1555 1556 7.716612 TGGAAAGAACTTGATTTTCTTCTTCC 58.283 34.615 7.96 7.96 41.48 3.46
1556 1557 7.341769 TGGAAAGAACTTGATTTTCTTCTTCCA 59.658 33.333 11.61 11.61 42.48 3.53
1557 1558 8.197439 GGAAAGAACTTGATTTTCTTCTTCCAA 58.803 33.333 9.31 0.00 41.48 3.53
1558 1559 8.932945 AAAGAACTTGATTTTCTTCTTCCAAC 57.067 30.769 0.00 0.00 41.48 3.77
1559 1560 7.043961 AGAACTTGATTTTCTTCTTCCAACC 57.956 36.000 0.00 0.00 28.36 3.77
1560 1561 6.607198 AGAACTTGATTTTCTTCTTCCAACCA 59.393 34.615 0.00 0.00 28.36 3.67
1561 1562 6.790232 ACTTGATTTTCTTCTTCCAACCAA 57.210 33.333 0.00 0.00 0.00 3.67
1562 1563 6.573434 ACTTGATTTTCTTCTTCCAACCAAC 58.427 36.000 0.00 0.00 0.00 3.77
1563 1564 6.381133 ACTTGATTTTCTTCTTCCAACCAACT 59.619 34.615 0.00 0.00 0.00 3.16
1564 1565 7.559897 ACTTGATTTTCTTCTTCCAACCAACTA 59.440 33.333 0.00 0.00 0.00 2.24
1565 1566 8.477419 TTGATTTTCTTCTTCCAACCAACTAT 57.523 30.769 0.00 0.00 0.00 2.12
1566 1567 9.581289 TTGATTTTCTTCTTCCAACCAACTATA 57.419 29.630 0.00 0.00 0.00 1.31
1567 1568 9.581289 TGATTTTCTTCTTCCAACCAACTATAA 57.419 29.630 0.00 0.00 0.00 0.98
1569 1570 7.448748 TTTCTTCTTCCAACCAACTATAAGC 57.551 36.000 0.00 0.00 0.00 3.09
1570 1571 6.374417 TCTTCTTCCAACCAACTATAAGCT 57.626 37.500 0.00 0.00 0.00 3.74
1571 1572 6.173339 TCTTCTTCCAACCAACTATAAGCTG 58.827 40.000 0.00 0.00 0.00 4.24
1572 1573 5.499004 TCTTCCAACCAACTATAAGCTGT 57.501 39.130 0.00 0.00 0.00 4.40
1573 1574 5.488341 TCTTCCAACCAACTATAAGCTGTC 58.512 41.667 0.00 0.00 0.00 3.51
1574 1575 3.857052 TCCAACCAACTATAAGCTGTCG 58.143 45.455 0.00 0.00 0.00 4.35
1575 1576 2.936498 CCAACCAACTATAAGCTGTCGG 59.064 50.000 0.00 0.00 0.00 4.79
1576 1577 2.936498 CAACCAACTATAAGCTGTCGGG 59.064 50.000 0.00 0.00 0.00 5.14
1577 1578 2.185387 ACCAACTATAAGCTGTCGGGT 58.815 47.619 0.00 0.00 0.00 5.28
1578 1579 2.093658 ACCAACTATAAGCTGTCGGGTG 60.094 50.000 0.00 0.00 0.00 4.61
1579 1580 1.933853 CAACTATAAGCTGTCGGGTGC 59.066 52.381 0.00 0.00 0.00 5.01
1580 1581 0.464452 ACTATAAGCTGTCGGGTGCC 59.536 55.000 0.00 0.00 0.00 5.01
1581 1582 0.753262 CTATAAGCTGTCGGGTGCCT 59.247 55.000 0.00 0.00 0.00 4.75
1582 1583 0.464036 TATAAGCTGTCGGGTGCCTG 59.536 55.000 0.00 0.00 0.00 4.85
1583 1584 1.264749 ATAAGCTGTCGGGTGCCTGA 61.265 55.000 0.00 0.00 0.00 3.86
1584 1585 1.888436 TAAGCTGTCGGGTGCCTGAG 61.888 60.000 0.00 0.00 31.15 3.35
1596 1597 2.675519 GCCTGAGCAAGTCATCTCG 58.324 57.895 0.00 0.00 39.53 4.04
1597 1598 1.427592 GCCTGAGCAAGTCATCTCGC 61.428 60.000 0.00 0.00 39.53 5.03
1598 1599 0.175302 CCTGAGCAAGTCATCTCGCT 59.825 55.000 0.00 0.00 36.57 4.93
1600 1601 3.729356 GAGCAAGTCATCTCGCTCA 57.271 52.632 5.42 0.00 46.49 4.26
1601 1602 2.222007 GAGCAAGTCATCTCGCTCAT 57.778 50.000 5.42 0.00 46.49 2.90
1602 1603 2.126467 GAGCAAGTCATCTCGCTCATC 58.874 52.381 5.42 0.00 46.49 2.92
1603 1604 1.755959 AGCAAGTCATCTCGCTCATCT 59.244 47.619 0.00 0.00 25.90 2.90
1604 1605 2.168106 AGCAAGTCATCTCGCTCATCTT 59.832 45.455 0.00 0.00 25.90 2.40
1605 1606 2.284684 GCAAGTCATCTCGCTCATCTTG 59.715 50.000 0.00 0.00 35.43 3.02
1606 1607 3.778618 CAAGTCATCTCGCTCATCTTGA 58.221 45.455 0.00 0.00 34.62 3.02
1607 1608 4.370049 CAAGTCATCTCGCTCATCTTGAT 58.630 43.478 0.00 0.00 34.62 2.57
1608 1609 4.241590 AGTCATCTCGCTCATCTTGATC 57.758 45.455 0.00 0.00 0.00 2.92
1609 1610 3.890756 AGTCATCTCGCTCATCTTGATCT 59.109 43.478 0.00 0.00 0.00 2.75
1610 1611 5.069318 AGTCATCTCGCTCATCTTGATCTA 58.931 41.667 0.00 0.00 0.00 1.98
1611 1612 5.048782 AGTCATCTCGCTCATCTTGATCTAC 60.049 44.000 0.00 0.00 0.00 2.59
1612 1613 4.217334 TCATCTCGCTCATCTTGATCTACC 59.783 45.833 0.00 0.00 0.00 3.18
1613 1614 3.555966 TCTCGCTCATCTTGATCTACCA 58.444 45.455 0.00 0.00 0.00 3.25
1614 1615 3.567585 TCTCGCTCATCTTGATCTACCAG 59.432 47.826 0.00 0.00 0.00 4.00
1615 1616 2.035193 TCGCTCATCTTGATCTACCAGC 59.965 50.000 0.00 0.00 0.00 4.85
1616 1617 2.035704 CGCTCATCTTGATCTACCAGCT 59.964 50.000 0.00 0.00 0.00 4.24
1617 1618 3.652274 GCTCATCTTGATCTACCAGCTC 58.348 50.000 0.00 0.00 0.00 4.09
1618 1619 3.554752 GCTCATCTTGATCTACCAGCTCC 60.555 52.174 0.00 0.00 0.00 4.70
1619 1620 3.896888 CTCATCTTGATCTACCAGCTCCT 59.103 47.826 0.00 0.00 0.00 3.69
1620 1621 4.293494 TCATCTTGATCTACCAGCTCCTT 58.707 43.478 0.00 0.00 0.00 3.36
1621 1622 4.718774 TCATCTTGATCTACCAGCTCCTTT 59.281 41.667 0.00 0.00 0.00 3.11
1622 1623 5.190528 TCATCTTGATCTACCAGCTCCTTTT 59.809 40.000 0.00 0.00 0.00 2.27
1623 1624 5.505181 TCTTGATCTACCAGCTCCTTTTT 57.495 39.130 0.00 0.00 0.00 1.94
1624 1625 5.491982 TCTTGATCTACCAGCTCCTTTTTC 58.508 41.667 0.00 0.00 0.00 2.29
1625 1626 5.249393 TCTTGATCTACCAGCTCCTTTTTCT 59.751 40.000 0.00 0.00 0.00 2.52
1626 1627 5.505181 TGATCTACCAGCTCCTTTTTCTT 57.495 39.130 0.00 0.00 0.00 2.52
1627 1628 6.620877 TGATCTACCAGCTCCTTTTTCTTA 57.379 37.500 0.00 0.00 0.00 2.10
1628 1629 6.644347 TGATCTACCAGCTCCTTTTTCTTAG 58.356 40.000 0.00 0.00 0.00 2.18
1629 1630 6.213600 TGATCTACCAGCTCCTTTTTCTTAGT 59.786 38.462 0.00 0.00 0.00 2.24
1630 1631 6.038997 TCTACCAGCTCCTTTTTCTTAGTC 57.961 41.667 0.00 0.00 0.00 2.59
1631 1632 4.706842 ACCAGCTCCTTTTTCTTAGTCA 57.293 40.909 0.00 0.00 0.00 3.41
1632 1633 4.646572 ACCAGCTCCTTTTTCTTAGTCAG 58.353 43.478 0.00 0.00 0.00 3.51
1633 1634 4.006319 CCAGCTCCTTTTTCTTAGTCAGG 58.994 47.826 0.00 0.00 0.00 3.86
1634 1635 4.505742 CCAGCTCCTTTTTCTTAGTCAGGT 60.506 45.833 0.00 0.00 0.00 4.00
1635 1636 5.280011 CCAGCTCCTTTTTCTTAGTCAGGTA 60.280 44.000 0.00 0.00 0.00 3.08
1636 1637 6.410540 CAGCTCCTTTTTCTTAGTCAGGTAT 58.589 40.000 0.00 0.00 0.00 2.73
1637 1638 6.314896 CAGCTCCTTTTTCTTAGTCAGGTATG 59.685 42.308 0.00 0.00 0.00 2.39
1638 1639 6.213600 AGCTCCTTTTTCTTAGTCAGGTATGA 59.786 38.462 0.00 0.00 0.00 2.15
1639 1640 6.879458 GCTCCTTTTTCTTAGTCAGGTATGAA 59.121 38.462 0.00 0.00 37.14 2.57
1640 1641 7.554476 GCTCCTTTTTCTTAGTCAGGTATGAAT 59.446 37.037 0.00 0.00 37.14 2.57
1641 1642 8.792830 TCCTTTTTCTTAGTCAGGTATGAATG 57.207 34.615 0.00 0.00 37.14 2.67
1642 1643 8.383175 TCCTTTTTCTTAGTCAGGTATGAATGT 58.617 33.333 0.00 0.00 37.14 2.71
1643 1644 9.667107 CCTTTTTCTTAGTCAGGTATGAATGTA 57.333 33.333 0.00 0.00 37.14 2.29
1648 1649 9.987272 TTCTTAGTCAGGTATGAATGTATGATG 57.013 33.333 0.00 0.00 37.14 3.07
1649 1650 9.147732 TCTTAGTCAGGTATGAATGTATGATGT 57.852 33.333 0.00 0.00 37.14 3.06
1731 1737 1.229145 CCATGGCCTGGGACCAAAA 60.229 57.895 3.32 0.00 41.49 2.44
1754 1761 5.730550 AGGTCGATTACATGAAGCTTACAA 58.269 37.500 0.00 0.00 0.00 2.41
1755 1762 5.812642 AGGTCGATTACATGAAGCTTACAAG 59.187 40.000 0.00 0.00 0.00 3.16
1757 1764 6.019479 GGTCGATTACATGAAGCTTACAAGAG 60.019 42.308 0.00 0.00 0.00 2.85
1796 1803 4.871993 CTGTAAGCAGCCAAATACAGAG 57.128 45.455 15.26 0.00 45.05 3.35
1809 1828 2.509166 TACAGAGGCGGAGAGAAAGA 57.491 50.000 0.00 0.00 0.00 2.52
1862 1901 1.051812 GCTAATCTAGCCCAGCAGGA 58.948 55.000 0.00 0.00 45.95 3.86
1891 1930 5.220931 CCAGCTTGTAATAGCATCTTTGTCC 60.221 44.000 0.00 0.00 43.68 4.02
1902 1941 4.038402 AGCATCTTTGTCCTCCTGTTTTTG 59.962 41.667 0.00 0.00 0.00 2.44
1920 1959 4.204028 AGCCCGGTGTTGCCAAGT 62.204 61.111 0.00 0.00 36.97 3.16
1921 1960 3.223589 GCCCGGTGTTGCCAAGTT 61.224 61.111 0.00 0.00 36.97 2.66
1924 1963 1.671901 CCCGGTGTTGCCAAGTTTGT 61.672 55.000 0.00 0.00 36.97 2.83
1932 1971 4.020543 TGTTGCCAAGTTTGTAGGAGTTT 58.979 39.130 0.00 0.00 0.00 2.66
1939 1978 6.208644 CCAAGTTTGTAGGAGTTTTGACATG 58.791 40.000 0.00 0.00 0.00 3.21
1942 1981 8.402472 CAAGTTTGTAGGAGTTTTGACATGTAA 58.598 33.333 0.00 0.00 0.00 2.41
1943 1982 8.154649 AGTTTGTAGGAGTTTTGACATGTAAG 57.845 34.615 0.00 0.00 0.00 2.34
1960 1999 9.601217 GACATGTAAGTTTTGAGATATAGTGGT 57.399 33.333 0.00 0.00 0.00 4.16
1962 2001 9.599866 CATGTAAGTTTTGAGATATAGTGGTGA 57.400 33.333 0.00 0.00 0.00 4.02
2041 2080 1.689959 CAGCGAAAAGAATGTGCACC 58.310 50.000 15.69 0.00 0.00 5.01
2091 2130 4.091424 GCTCTGTGCATAAAATGAACGAC 58.909 43.478 0.00 0.00 41.98 4.34
2095 2134 3.743911 TGTGCATAAAATGAACGACGTCT 59.256 39.130 14.70 0.00 41.98 4.18
2139 2178 0.107456 ATATGGAACGCAGCCCAGAG 59.893 55.000 0.00 0.00 37.00 3.35
2184 2223 1.206878 ATGATGTGGCTGGCAGACTA 58.793 50.000 23.12 11.24 0.00 2.59
2185 2224 1.206878 TGATGTGGCTGGCAGACTAT 58.793 50.000 23.12 15.79 0.00 2.12
2186 2225 2.397597 TGATGTGGCTGGCAGACTATA 58.602 47.619 23.12 8.09 0.00 1.31
2187 2226 2.771372 TGATGTGGCTGGCAGACTATAA 59.229 45.455 23.12 6.52 0.00 0.98
2188 2227 2.691409 TGTGGCTGGCAGACTATAAC 57.309 50.000 23.12 11.87 0.00 1.89
2189 2228 2.187958 TGTGGCTGGCAGACTATAACT 58.812 47.619 23.12 0.00 0.00 2.24
2190 2229 3.371034 TGTGGCTGGCAGACTATAACTA 58.629 45.455 23.12 0.00 0.00 2.24
2191 2230 3.967326 TGTGGCTGGCAGACTATAACTAT 59.033 43.478 23.12 0.00 0.00 2.12
2192 2231 5.144832 TGTGGCTGGCAGACTATAACTATA 58.855 41.667 23.12 0.00 0.00 1.31
2193 2232 5.780282 TGTGGCTGGCAGACTATAACTATAT 59.220 40.000 23.12 0.00 0.00 0.86
2194 2233 6.270000 TGTGGCTGGCAGACTATAACTATATT 59.730 38.462 23.12 0.00 0.00 1.28
2195 2234 7.162082 GTGGCTGGCAGACTATAACTATATTT 58.838 38.462 23.12 0.00 0.00 1.40
2196 2235 8.311836 GTGGCTGGCAGACTATAACTATATTTA 58.688 37.037 23.12 0.00 0.00 1.40
2197 2236 8.311836 TGGCTGGCAGACTATAACTATATTTAC 58.688 37.037 23.12 0.00 0.00 2.01
2198 2237 7.488471 GGCTGGCAGACTATAACTATATTTACG 59.512 40.741 20.86 0.00 0.00 3.18
2199 2238 7.009357 GCTGGCAGACTATAACTATATTTACGC 59.991 40.741 20.86 0.00 0.00 4.42
2200 2239 7.025365 TGGCAGACTATAACTATATTTACGCG 58.975 38.462 3.53 3.53 0.00 6.01
2201 2240 7.094677 TGGCAGACTATAACTATATTTACGCGA 60.095 37.037 15.93 0.00 0.00 5.87
2202 2241 7.914346 GGCAGACTATAACTATATTTACGCGAT 59.086 37.037 15.93 0.00 0.00 4.58
2203 2242 9.926751 GCAGACTATAACTATATTTACGCGATA 57.073 33.333 15.93 0.00 0.00 2.92
2216 2255 7.724305 ATTTACGCGATATTGTATTCTTGGT 57.276 32.000 15.93 0.00 0.00 3.67
2217 2256 6.758593 TTACGCGATATTGTATTCTTGGTC 57.241 37.500 15.93 0.00 0.00 4.02
2218 2257 4.689071 ACGCGATATTGTATTCTTGGTCA 58.311 39.130 15.93 0.00 0.00 4.02
2219 2258 5.297547 ACGCGATATTGTATTCTTGGTCAT 58.702 37.500 15.93 0.00 0.00 3.06
2220 2259 5.758296 ACGCGATATTGTATTCTTGGTCATT 59.242 36.000 15.93 0.00 0.00 2.57
2221 2260 6.260050 ACGCGATATTGTATTCTTGGTCATTT 59.740 34.615 15.93 0.00 0.00 2.32
2222 2261 6.574832 CGCGATATTGTATTCTTGGTCATTTG 59.425 38.462 0.00 0.00 0.00 2.32
2223 2262 7.417612 GCGATATTGTATTCTTGGTCATTTGT 58.582 34.615 0.00 0.00 0.00 2.83
2224 2263 7.915397 GCGATATTGTATTCTTGGTCATTTGTT 59.085 33.333 0.00 0.00 0.00 2.83
2225 2264 9.225201 CGATATTGTATTCTTGGTCATTTGTTG 57.775 33.333 0.00 0.00 0.00 3.33
2229 2268 8.417780 TTGTATTCTTGGTCATTTGTTGTTTG 57.582 30.769 0.00 0.00 0.00 2.93
2230 2269 5.989551 ATTCTTGGTCATTTGTTGTTTGC 57.010 34.783 0.00 0.00 0.00 3.68
2231 2270 4.462508 TCTTGGTCATTTGTTGTTTGCA 57.537 36.364 0.00 0.00 0.00 4.08
2232 2271 4.431809 TCTTGGTCATTTGTTGTTTGCAG 58.568 39.130 0.00 0.00 0.00 4.41
2233 2272 3.176552 TGGTCATTTGTTGTTTGCAGG 57.823 42.857 0.00 0.00 0.00 4.85
2234 2273 1.866601 GGTCATTTGTTGTTTGCAGGC 59.133 47.619 0.00 0.00 0.00 4.85
2235 2274 2.548875 GTCATTTGTTGTTTGCAGGCA 58.451 42.857 0.00 0.00 0.00 4.75
2236 2275 2.284952 GTCATTTGTTGTTTGCAGGCAC 59.715 45.455 0.00 0.00 0.00 5.01
2237 2276 1.258458 CATTTGTTGTTTGCAGGCACG 59.742 47.619 0.00 0.00 0.00 5.34
2238 2277 1.080995 TTTGTTGTTTGCAGGCACGC 61.081 50.000 0.00 0.00 0.00 5.34
2239 2278 2.103934 GTTGTTTGCAGGCACGCA 59.896 55.556 0.00 0.00 41.03 5.24
2244 2283 2.356075 TTGCAGGCACGCAATTGC 60.356 55.556 20.76 20.76 46.61 3.56
2245 2284 2.858862 TTGCAGGCACGCAATTGCT 61.859 52.632 26.86 12.15 46.61 3.91
2246 2285 1.522302 TTGCAGGCACGCAATTGCTA 61.522 50.000 26.86 0.00 46.61 3.49
2247 2286 1.514873 GCAGGCACGCAATTGCTAC 60.515 57.895 26.86 15.73 42.56 3.58
2248 2287 1.875262 CAGGCACGCAATTGCTACA 59.125 52.632 26.86 0.00 42.56 2.74
2249 2288 0.179181 CAGGCACGCAATTGCTACAG 60.179 55.000 26.86 14.38 42.56 2.74
2250 2289 0.606401 AGGCACGCAATTGCTACAGT 60.606 50.000 26.86 15.03 42.56 3.55
2251 2290 0.240945 GGCACGCAATTGCTACAGTT 59.759 50.000 26.86 2.65 42.56 3.16
2252 2291 1.335872 GGCACGCAATTGCTACAGTTT 60.336 47.619 26.86 0.95 42.56 2.66
2253 2292 2.393764 GCACGCAATTGCTACAGTTTT 58.606 42.857 26.86 0.00 39.59 2.43
2254 2293 3.560503 GCACGCAATTGCTACAGTTTTA 58.439 40.909 26.86 0.00 39.59 1.52
2255 2294 3.978217 GCACGCAATTGCTACAGTTTTAA 59.022 39.130 26.86 0.00 39.59 1.52
2256 2295 4.143618 GCACGCAATTGCTACAGTTTTAAC 60.144 41.667 26.86 2.51 39.59 2.01
2257 2296 4.381566 CACGCAATTGCTACAGTTTTAACC 59.618 41.667 26.86 0.00 39.32 2.85
2258 2297 4.036971 ACGCAATTGCTACAGTTTTAACCA 59.963 37.500 26.86 0.00 39.32 3.67
2259 2298 5.160641 CGCAATTGCTACAGTTTTAACCAT 58.839 37.500 26.86 0.00 39.32 3.55
2260 2299 6.072397 ACGCAATTGCTACAGTTTTAACCATA 60.072 34.615 26.86 0.00 39.32 2.74
2261 2300 6.972328 CGCAATTGCTACAGTTTTAACCATAT 59.028 34.615 26.86 0.00 39.32 1.78
2262 2301 7.487829 CGCAATTGCTACAGTTTTAACCATATT 59.512 33.333 26.86 0.00 39.32 1.28
2263 2302 9.796120 GCAATTGCTACAGTTTTAACCATATTA 57.204 29.630 23.21 0.00 38.21 0.98
2280 2319 9.533831 AACCATATTAATTTCCTATGTCCCATC 57.466 33.333 0.00 0.00 0.00 3.51
2281 2320 8.677871 ACCATATTAATTTCCTATGTCCCATCA 58.322 33.333 0.00 0.00 0.00 3.07
2282 2321 9.532494 CCATATTAATTTCCTATGTCCCATCAA 57.468 33.333 0.00 0.00 0.00 2.57
2285 2324 7.639113 TTAATTTCCTATGTCCCATCAACAC 57.361 36.000 0.00 0.00 0.00 3.32
2286 2325 4.649267 TTTCCTATGTCCCATCAACACA 57.351 40.909 0.00 0.00 0.00 3.72
2287 2326 4.860802 TTCCTATGTCCCATCAACACAT 57.139 40.909 0.00 0.00 35.00 3.21
2288 2327 4.860802 TCCTATGTCCCATCAACACATT 57.139 40.909 0.00 0.00 32.88 2.71
2289 2328 5.191727 TCCTATGTCCCATCAACACATTT 57.808 39.130 0.00 0.00 32.88 2.32
2290 2329 5.579047 TCCTATGTCCCATCAACACATTTT 58.421 37.500 0.00 0.00 32.88 1.82
2291 2330 5.652014 TCCTATGTCCCATCAACACATTTTC 59.348 40.000 0.00 0.00 32.88 2.29
2292 2331 3.913548 TGTCCCATCAACACATTTTCG 57.086 42.857 0.00 0.00 0.00 3.46
2293 2332 3.218453 TGTCCCATCAACACATTTTCGT 58.782 40.909 0.00 0.00 0.00 3.85
2294 2333 3.252215 TGTCCCATCAACACATTTTCGTC 59.748 43.478 0.00 0.00 0.00 4.20
2295 2334 3.252215 GTCCCATCAACACATTTTCGTCA 59.748 43.478 0.00 0.00 0.00 4.35
2296 2335 3.885901 TCCCATCAACACATTTTCGTCAA 59.114 39.130 0.00 0.00 0.00 3.18
2297 2336 4.522405 TCCCATCAACACATTTTCGTCAAT 59.478 37.500 0.00 0.00 0.00 2.57
2298 2337 4.622313 CCCATCAACACATTTTCGTCAATG 59.378 41.667 7.50 7.50 39.67 2.82
2299 2338 5.459768 CCATCAACACATTTTCGTCAATGA 58.540 37.500 13.87 0.00 37.55 2.57
2300 2339 6.094719 CCATCAACACATTTTCGTCAATGAT 58.905 36.000 13.87 0.00 37.55 2.45
2301 2340 6.587226 CCATCAACACATTTTCGTCAATGATT 59.413 34.615 13.87 6.90 37.55 2.57
2302 2341 7.116662 CCATCAACACATTTTCGTCAATGATTT 59.883 33.333 13.87 5.74 37.55 2.17
2303 2342 8.489559 CATCAACACATTTTCGTCAATGATTTT 58.510 29.630 13.87 3.94 37.55 1.82
2304 2343 9.689976 ATCAACACATTTTCGTCAATGATTTTA 57.310 25.926 13.87 2.31 37.55 1.52
2305 2344 9.689976 TCAACACATTTTCGTCAATGATTTTAT 57.310 25.926 13.87 0.00 37.55 1.40
2316 2355 9.785982 TCGTCAATGATTTTATATTGTATGGGA 57.214 29.630 0.00 0.00 36.09 4.37
2317 2356 9.825972 CGTCAATGATTTTATATTGTATGGGAC 57.174 33.333 0.00 0.00 36.09 4.46
2322 2361 9.745018 ATGATTTTATATTGTATGGGACTGGAG 57.255 33.333 0.00 0.00 0.00 3.86
2323 2362 7.665559 TGATTTTATATTGTATGGGACTGGAGC 59.334 37.037 0.00 0.00 0.00 4.70
2324 2363 6.508030 TTTATATTGTATGGGACTGGAGCA 57.492 37.500 0.00 0.00 0.00 4.26
2325 2364 6.702449 TTATATTGTATGGGACTGGAGCAT 57.298 37.500 0.00 0.00 0.00 3.79
2326 2365 2.715749 TTGTATGGGACTGGAGCATG 57.284 50.000 0.00 0.00 0.00 4.06
2327 2366 0.839277 TGTATGGGACTGGAGCATGG 59.161 55.000 0.00 0.00 0.00 3.66
2328 2367 0.536006 GTATGGGACTGGAGCATGGC 60.536 60.000 0.00 0.00 0.00 4.40
2329 2368 0.695462 TATGGGACTGGAGCATGGCT 60.695 55.000 0.00 0.00 43.88 4.75
2330 2369 0.695462 ATGGGACTGGAGCATGGCTA 60.695 55.000 0.00 0.00 39.88 3.93
2331 2370 0.695462 TGGGACTGGAGCATGGCTAT 60.695 55.000 0.00 0.00 39.88 2.97
2332 2371 0.475906 GGGACTGGAGCATGGCTATT 59.524 55.000 0.00 0.00 39.88 1.73
2333 2372 1.699634 GGGACTGGAGCATGGCTATTA 59.300 52.381 0.00 0.00 39.88 0.98
2334 2373 2.307098 GGGACTGGAGCATGGCTATTAT 59.693 50.000 0.00 0.00 39.88 1.28
2335 2374 3.245052 GGGACTGGAGCATGGCTATTATT 60.245 47.826 0.00 0.00 39.88 1.40
2336 2375 4.401925 GGACTGGAGCATGGCTATTATTT 58.598 43.478 0.00 0.00 39.88 1.40
2337 2376 4.457257 GGACTGGAGCATGGCTATTATTTC 59.543 45.833 0.00 0.00 39.88 2.17
2338 2377 4.401925 ACTGGAGCATGGCTATTATTTCC 58.598 43.478 0.00 0.00 39.88 3.13
2339 2378 4.105377 ACTGGAGCATGGCTATTATTTCCT 59.895 41.667 0.00 0.00 39.88 3.36
2340 2379 5.065613 TGGAGCATGGCTATTATTTCCTT 57.934 39.130 0.00 0.00 39.88 3.36
2341 2380 5.457686 TGGAGCATGGCTATTATTTCCTTT 58.542 37.500 0.00 0.00 39.88 3.11
2342 2381 5.898972 TGGAGCATGGCTATTATTTCCTTTT 59.101 36.000 0.00 0.00 39.88 2.27
2343 2382 6.040842 TGGAGCATGGCTATTATTTCCTTTTC 59.959 38.462 0.00 0.00 39.88 2.29
2344 2383 6.266330 GGAGCATGGCTATTATTTCCTTTTCT 59.734 38.462 0.00 0.00 39.88 2.52
2345 2384 7.201947 GGAGCATGGCTATTATTTCCTTTTCTT 60.202 37.037 0.00 0.00 39.88 2.52
2346 2385 8.082672 AGCATGGCTATTATTTCCTTTTCTTT 57.917 30.769 0.00 0.00 36.99 2.52
2347 2386 7.983484 AGCATGGCTATTATTTCCTTTTCTTTG 59.017 33.333 0.00 0.00 36.99 2.77
2348 2387 7.981225 GCATGGCTATTATTTCCTTTTCTTTGA 59.019 33.333 0.00 0.00 0.00 2.69
2351 2390 9.253832 TGGCTATTATTTCCTTTTCTTTGATCA 57.746 29.630 0.00 0.00 0.00 2.92
2360 2399 9.590451 TTTCCTTTTCTTTGATCATATGAATGC 57.410 29.630 9.99 3.23 32.76 3.56
2361 2400 8.529424 TCCTTTTCTTTGATCATATGAATGCT 57.471 30.769 9.99 0.00 32.76 3.79
2362 2401 8.974238 TCCTTTTCTTTGATCATATGAATGCTT 58.026 29.630 9.99 0.00 32.76 3.91
2366 2405 9.740239 TTTCTTTGATCATATGAATGCTTAAGC 57.260 29.630 20.84 20.84 42.50 3.09
2367 2406 8.687292 TCTTTGATCATATGAATGCTTAAGCT 57.313 30.769 26.90 9.03 42.66 3.74
2368 2407 8.565416 TCTTTGATCATATGAATGCTTAAGCTG 58.435 33.333 26.90 15.33 42.66 4.24
2369 2408 8.454570 TTTGATCATATGAATGCTTAAGCTGA 57.545 30.769 26.90 19.71 42.66 4.26
2370 2409 7.668525 TGATCATATGAATGCTTAAGCTGAG 57.331 36.000 26.90 9.30 42.66 3.35
2371 2410 7.447594 TGATCATATGAATGCTTAAGCTGAGA 58.552 34.615 26.90 8.34 42.66 3.27
2372 2411 8.101419 TGATCATATGAATGCTTAAGCTGAGAT 58.899 33.333 26.90 17.02 42.66 2.75
2373 2412 8.865420 ATCATATGAATGCTTAAGCTGAGATT 57.135 30.769 26.90 17.89 42.66 2.40
2374 2413 8.095937 TCATATGAATGCTTAAGCTGAGATTG 57.904 34.615 26.90 15.88 42.66 2.67
2375 2414 4.627611 TGAATGCTTAAGCTGAGATTGC 57.372 40.909 26.90 12.53 42.66 3.56
2376 2415 3.379372 TGAATGCTTAAGCTGAGATTGCC 59.621 43.478 26.90 8.91 42.66 4.52
2377 2416 2.495155 TGCTTAAGCTGAGATTGCCA 57.505 45.000 26.90 0.77 42.66 4.92
2378 2417 2.362736 TGCTTAAGCTGAGATTGCCAG 58.637 47.619 26.90 0.00 42.66 4.85
2379 2418 2.026915 TGCTTAAGCTGAGATTGCCAGA 60.027 45.455 26.90 0.02 42.66 3.86
2380 2419 3.212685 GCTTAAGCTGAGATTGCCAGAT 58.787 45.455 20.38 0.00 38.21 2.90
2381 2420 3.250521 GCTTAAGCTGAGATTGCCAGATC 59.749 47.826 20.38 0.00 38.21 2.75
2382 2421 1.950828 AAGCTGAGATTGCCAGATCG 58.049 50.000 0.00 0.00 33.65 3.69
2383 2422 0.106335 AGCTGAGATTGCCAGATCGG 59.894 55.000 0.00 0.00 33.65 4.18
2384 2423 0.105593 GCTGAGATTGCCAGATCGGA 59.894 55.000 7.64 0.00 36.56 4.55
2385 2424 1.270732 GCTGAGATTGCCAGATCGGAT 60.271 52.381 7.64 0.00 36.56 4.18
2386 2425 2.809665 GCTGAGATTGCCAGATCGGATT 60.810 50.000 7.64 0.00 36.56 3.01
2387 2426 3.474600 CTGAGATTGCCAGATCGGATTT 58.525 45.455 7.64 0.00 36.56 2.17
2388 2427 3.208594 TGAGATTGCCAGATCGGATTTG 58.791 45.455 7.64 1.69 36.56 2.32
2389 2428 3.209410 GAGATTGCCAGATCGGATTTGT 58.791 45.455 7.63 0.00 36.56 2.83
2390 2429 4.141733 TGAGATTGCCAGATCGGATTTGTA 60.142 41.667 7.63 0.00 36.56 2.41
2391 2430 4.130118 AGATTGCCAGATCGGATTTGTAC 58.870 43.478 7.63 0.96 36.56 2.90
2392 2431 3.342377 TTGCCAGATCGGATTTGTACA 57.658 42.857 7.63 0.00 36.56 2.90
2393 2432 2.905075 TGCCAGATCGGATTTGTACAG 58.095 47.619 7.63 0.00 36.56 2.74
2394 2433 2.499693 TGCCAGATCGGATTTGTACAGA 59.500 45.455 7.63 0.00 36.56 3.41
2395 2434 3.126831 GCCAGATCGGATTTGTACAGAG 58.873 50.000 7.63 0.00 36.56 3.35
2396 2435 3.722147 CCAGATCGGATTTGTACAGAGG 58.278 50.000 7.63 0.00 36.56 3.69
2397 2436 3.126831 CAGATCGGATTTGTACAGAGGC 58.873 50.000 0.00 0.00 0.00 4.70
2398 2437 2.766263 AGATCGGATTTGTACAGAGGCA 59.234 45.455 0.00 0.00 0.00 4.75
2399 2438 3.389329 AGATCGGATTTGTACAGAGGCAT 59.611 43.478 0.00 0.00 0.00 4.40
2400 2439 3.179443 TCGGATTTGTACAGAGGCATC 57.821 47.619 0.00 0.00 0.00 3.91
2401 2440 2.499693 TCGGATTTGTACAGAGGCATCA 59.500 45.455 0.00 0.00 0.00 3.07
2402 2441 2.609459 CGGATTTGTACAGAGGCATCAC 59.391 50.000 0.00 0.00 0.00 3.06
2403 2442 3.679917 CGGATTTGTACAGAGGCATCACT 60.680 47.826 0.00 0.00 0.00 3.41
2404 2443 4.441495 CGGATTTGTACAGAGGCATCACTA 60.441 45.833 0.00 0.00 0.00 2.74
2405 2444 5.428253 GGATTTGTACAGAGGCATCACTAA 58.572 41.667 0.00 0.00 0.00 2.24
2406 2445 6.058183 GGATTTGTACAGAGGCATCACTAAT 58.942 40.000 0.00 0.00 0.00 1.73
2407 2446 6.543831 GGATTTGTACAGAGGCATCACTAATT 59.456 38.462 0.00 0.00 0.00 1.40
2408 2447 7.715249 GGATTTGTACAGAGGCATCACTAATTA 59.285 37.037 0.00 0.00 0.00 1.40
2409 2448 8.668510 ATTTGTACAGAGGCATCACTAATTAG 57.331 34.615 11.05 11.05 0.00 1.73
2410 2449 7.418337 TTGTACAGAGGCATCACTAATTAGA 57.582 36.000 19.38 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.554305 ACTTCCCCCAACGAAACCTT 59.446 50.000 0.00 0.00 0.00 3.50
1 2 0.179001 CACTTCCCCCAACGAAACCT 60.179 55.000 0.00 0.00 0.00 3.50
2 3 1.802337 GCACTTCCCCCAACGAAACC 61.802 60.000 0.00 0.00 0.00 3.27
3 4 1.658114 GCACTTCCCCCAACGAAAC 59.342 57.895 0.00 0.00 0.00 2.78
4 5 1.894756 CGCACTTCCCCCAACGAAA 60.895 57.895 0.00 0.00 0.00 3.46
5 6 2.281208 CGCACTTCCCCCAACGAA 60.281 61.111 0.00 0.00 0.00 3.85
12 13 4.025401 CAACACGCGCACTTCCCC 62.025 66.667 5.73 0.00 0.00 4.81
13 14 4.683334 GCAACACGCGCACTTCCC 62.683 66.667 5.73 0.00 0.00 3.97
14 15 3.254014 ATGCAACACGCGCACTTCC 62.254 57.895 5.73 0.00 46.97 3.46
15 16 2.076628 CATGCAACACGCGCACTTC 61.077 57.895 5.73 0.00 46.97 3.01
16 17 2.051076 CATGCAACACGCGCACTT 60.051 55.556 5.73 0.00 46.97 3.16
17 18 2.715864 GAACATGCAACACGCGCACT 62.716 55.000 5.73 0.00 46.97 4.40
18 19 2.353376 AACATGCAACACGCGCAC 60.353 55.556 5.73 0.00 46.97 5.34
19 20 2.051435 GAACATGCAACACGCGCA 60.051 55.556 5.73 0.00 46.97 6.09
20 21 1.906994 TAGGAACATGCAACACGCGC 61.907 55.000 5.73 0.00 46.97 6.86
21 22 0.179225 GTAGGAACATGCAACACGCG 60.179 55.000 3.53 3.53 46.97 6.01
22 23 1.156736 AGTAGGAACATGCAACACGC 58.843 50.000 0.00 0.00 42.89 5.34
23 24 2.159627 GGAAGTAGGAACATGCAACACG 59.840 50.000 0.00 0.00 0.00 4.49
24 25 3.412386 AGGAAGTAGGAACATGCAACAC 58.588 45.455 0.00 0.00 0.00 3.32
25 26 3.559171 GGAGGAAGTAGGAACATGCAACA 60.559 47.826 0.00 0.00 0.00 3.33
26 27 3.010420 GGAGGAAGTAGGAACATGCAAC 58.990 50.000 0.00 0.00 0.00 4.17
27 28 2.026262 GGGAGGAAGTAGGAACATGCAA 60.026 50.000 0.00 0.00 0.00 4.08
28 29 1.559682 GGGAGGAAGTAGGAACATGCA 59.440 52.381 0.00 0.00 0.00 3.96
29 30 1.559682 TGGGAGGAAGTAGGAACATGC 59.440 52.381 0.00 0.00 0.00 4.06
30 31 2.840651 ACTGGGAGGAAGTAGGAACATG 59.159 50.000 0.00 0.00 0.00 3.21
31 32 3.207044 ACTGGGAGGAAGTAGGAACAT 57.793 47.619 0.00 0.00 0.00 2.71
32 33 2.715763 ACTGGGAGGAAGTAGGAACA 57.284 50.000 0.00 0.00 0.00 3.18
33 34 3.181464 GCATACTGGGAGGAAGTAGGAAC 60.181 52.174 0.00 0.00 34.61 3.62
34 35 3.039011 GCATACTGGGAGGAAGTAGGAA 58.961 50.000 0.00 0.00 34.61 3.36
35 36 2.023404 TGCATACTGGGAGGAAGTAGGA 60.023 50.000 0.00 0.00 34.61 2.94
36 37 2.366916 CTGCATACTGGGAGGAAGTAGG 59.633 54.545 0.00 0.00 35.54 3.18
37 38 3.068873 GTCTGCATACTGGGAGGAAGTAG 59.931 52.174 0.00 0.00 33.78 2.57
38 39 3.031736 GTCTGCATACTGGGAGGAAGTA 58.968 50.000 0.00 0.00 34.73 2.24
39 40 1.834263 GTCTGCATACTGGGAGGAAGT 59.166 52.381 0.00 0.00 0.00 3.01
40 41 1.833630 TGTCTGCATACTGGGAGGAAG 59.166 52.381 3.71 0.00 0.00 3.46
41 42 1.951209 TGTCTGCATACTGGGAGGAA 58.049 50.000 3.71 0.00 0.00 3.36
42 43 2.042464 GATGTCTGCATACTGGGAGGA 58.958 52.381 3.71 0.00 35.07 3.71
43 44 2.045524 AGATGTCTGCATACTGGGAGG 58.954 52.381 3.71 0.00 35.07 4.30
44 45 3.133542 TGAAGATGTCTGCATACTGGGAG 59.866 47.826 3.71 0.00 35.07 4.30
45 46 3.106827 TGAAGATGTCTGCATACTGGGA 58.893 45.455 3.71 0.00 35.07 4.37
46 47 3.201290 GTGAAGATGTCTGCATACTGGG 58.799 50.000 3.71 0.00 33.31 4.45
47 48 3.201290 GGTGAAGATGTCTGCATACTGG 58.799 50.000 3.71 0.00 33.31 4.00
48 49 3.865446 TGGTGAAGATGTCTGCATACTG 58.135 45.455 3.71 0.00 33.31 2.74
49 50 4.558226 TTGGTGAAGATGTCTGCATACT 57.442 40.909 3.71 0.00 33.31 2.12
50 51 4.095483 CCTTTGGTGAAGATGTCTGCATAC 59.905 45.833 0.00 0.00 37.57 2.39
51 52 4.019411 TCCTTTGGTGAAGATGTCTGCATA 60.019 41.667 0.00 0.00 37.57 3.14
52 53 3.087031 CCTTTGGTGAAGATGTCTGCAT 58.913 45.455 0.00 0.00 37.57 3.96
53 54 2.106338 TCCTTTGGTGAAGATGTCTGCA 59.894 45.455 0.00 0.00 37.57 4.41
54 55 2.485814 GTCCTTTGGTGAAGATGTCTGC 59.514 50.000 0.00 0.00 37.57 4.26
55 56 3.750130 CAGTCCTTTGGTGAAGATGTCTG 59.250 47.826 0.00 0.00 37.57 3.51
56 57 3.808618 GCAGTCCTTTGGTGAAGATGTCT 60.809 47.826 0.00 0.00 37.57 3.41
57 58 2.485814 GCAGTCCTTTGGTGAAGATGTC 59.514 50.000 0.00 0.00 37.57 3.06
58 59 2.508526 GCAGTCCTTTGGTGAAGATGT 58.491 47.619 0.00 0.00 37.57 3.06
59 60 1.815003 GGCAGTCCTTTGGTGAAGATG 59.185 52.381 0.00 0.00 37.57 2.90
60 61 1.707427 AGGCAGTCCTTTGGTGAAGAT 59.293 47.619 0.00 0.00 40.66 2.40
61 62 1.140312 AGGCAGTCCTTTGGTGAAGA 58.860 50.000 0.00 0.00 40.66 2.87
62 63 2.039084 AGTAGGCAGTCCTTTGGTGAAG 59.961 50.000 0.00 0.00 40.66 3.02
63 64 2.054799 AGTAGGCAGTCCTTTGGTGAA 58.945 47.619 0.00 0.00 40.66 3.18
64 65 1.347707 CAGTAGGCAGTCCTTTGGTGA 59.652 52.381 0.00 0.00 40.66 4.02
65 66 1.813513 CAGTAGGCAGTCCTTTGGTG 58.186 55.000 0.00 0.00 40.66 4.17
66 67 0.036875 GCAGTAGGCAGTCCTTTGGT 59.963 55.000 0.00 0.00 40.66 3.67
67 68 2.859992 GCAGTAGGCAGTCCTTTGG 58.140 57.895 0.00 0.00 40.66 3.28
68 69 0.036732 TGGCAGTAGGCAGTCCTTTG 59.963 55.000 0.00 0.00 46.46 2.77
69 70 2.463441 TGGCAGTAGGCAGTCCTTT 58.537 52.632 0.00 0.00 46.46 3.11
70 71 4.232905 TGGCAGTAGGCAGTCCTT 57.767 55.556 0.00 0.00 46.46 3.36
77 78 0.875059 GTGTGAAAGTGGCAGTAGGC 59.125 55.000 0.00 0.00 43.74 3.93
78 79 2.254546 TGTGTGAAAGTGGCAGTAGG 57.745 50.000 0.00 0.00 0.00 3.18
79 80 4.275689 TGAATTGTGTGAAAGTGGCAGTAG 59.724 41.667 0.00 0.00 0.00 2.57
80 81 4.203226 TGAATTGTGTGAAAGTGGCAGTA 58.797 39.130 0.00 0.00 0.00 2.74
81 82 3.023119 TGAATTGTGTGAAAGTGGCAGT 58.977 40.909 0.00 0.00 0.00 4.40
82 83 3.551454 CCTGAATTGTGTGAAAGTGGCAG 60.551 47.826 0.00 0.00 0.00 4.85
83 84 2.361757 CCTGAATTGTGTGAAAGTGGCA 59.638 45.455 0.00 0.00 0.00 4.92
84 85 2.362077 ACCTGAATTGTGTGAAAGTGGC 59.638 45.455 0.00 0.00 0.00 5.01
85 86 3.004734 GGACCTGAATTGTGTGAAAGTGG 59.995 47.826 0.00 0.00 0.00 4.00
86 87 3.631686 TGGACCTGAATTGTGTGAAAGTG 59.368 43.478 0.00 0.00 0.00 3.16
87 88 3.885297 CTGGACCTGAATTGTGTGAAAGT 59.115 43.478 0.00 0.00 0.00 2.66
88 89 3.885297 ACTGGACCTGAATTGTGTGAAAG 59.115 43.478 5.22 0.00 0.00 2.62
89 90 3.882888 GACTGGACCTGAATTGTGTGAAA 59.117 43.478 5.22 0.00 0.00 2.69
90 91 3.136443 AGACTGGACCTGAATTGTGTGAA 59.864 43.478 5.22 0.00 0.00 3.18
91 92 2.705658 AGACTGGACCTGAATTGTGTGA 59.294 45.455 5.22 0.00 0.00 3.58
92 93 3.070018 GAGACTGGACCTGAATTGTGTG 58.930 50.000 5.22 0.00 0.00 3.82
93 94 2.705658 TGAGACTGGACCTGAATTGTGT 59.294 45.455 5.22 0.00 0.00 3.72
94 95 3.407424 TGAGACTGGACCTGAATTGTG 57.593 47.619 5.22 0.00 0.00 3.33
95 96 3.744660 GTTGAGACTGGACCTGAATTGT 58.255 45.455 5.22 0.00 0.00 2.71
96 97 2.738846 CGTTGAGACTGGACCTGAATTG 59.261 50.000 5.22 0.00 0.00 2.32
97 98 2.368875 ACGTTGAGACTGGACCTGAATT 59.631 45.455 5.22 0.00 0.00 2.17
98 99 1.971357 ACGTTGAGACTGGACCTGAAT 59.029 47.619 5.22 0.00 0.00 2.57
99 100 1.410004 ACGTTGAGACTGGACCTGAA 58.590 50.000 5.22 0.00 0.00 3.02
100 101 1.340248 GAACGTTGAGACTGGACCTGA 59.660 52.381 5.00 0.00 0.00 3.86
101 102 1.784525 GAACGTTGAGACTGGACCTG 58.215 55.000 5.00 0.00 0.00 4.00
102 103 0.314302 CGAACGTTGAGACTGGACCT 59.686 55.000 5.00 0.00 0.00 3.85
103 104 0.666577 CCGAACGTTGAGACTGGACC 60.667 60.000 5.00 0.00 0.00 4.46
104 105 0.031721 ACCGAACGTTGAGACTGGAC 59.968 55.000 5.00 0.00 0.00 4.02
105 106 0.313043 GACCGAACGTTGAGACTGGA 59.687 55.000 5.00 0.00 0.00 3.86
106 107 0.666577 GGACCGAACGTTGAGACTGG 60.667 60.000 5.00 0.00 0.00 4.00
107 108 0.314302 AGGACCGAACGTTGAGACTG 59.686 55.000 5.00 0.00 0.00 3.51
108 109 0.597072 GAGGACCGAACGTTGAGACT 59.403 55.000 5.00 0.00 0.00 3.24
109 110 0.388263 GGAGGACCGAACGTTGAGAC 60.388 60.000 5.00 0.00 0.00 3.36
110 111 1.530013 GGGAGGACCGAACGTTGAGA 61.530 60.000 5.00 0.00 36.97 3.27
111 112 1.080025 GGGAGGACCGAACGTTGAG 60.080 63.158 5.00 0.00 36.97 3.02
112 113 1.833492 TGGGAGGACCGAACGTTGA 60.833 57.895 5.00 0.00 44.64 3.18
113 114 1.666872 GTGGGAGGACCGAACGTTG 60.667 63.158 5.00 0.00 44.64 4.10
114 115 2.739132 GTGGGAGGACCGAACGTT 59.261 61.111 0.00 0.00 44.64 3.99
115 116 3.677648 CGTGGGAGGACCGAACGT 61.678 66.667 0.00 0.00 44.64 3.99
116 117 2.707849 ATCGTGGGAGGACCGAACG 61.708 63.158 0.00 0.00 44.64 3.95
117 118 1.153628 CATCGTGGGAGGACCGAAC 60.154 63.158 0.00 0.00 44.64 3.95
118 119 1.304630 TCATCGTGGGAGGACCGAA 60.305 57.895 0.00 0.00 44.64 4.30
119 120 1.753078 CTCATCGTGGGAGGACCGA 60.753 63.158 0.00 0.00 44.64 4.69
120 121 1.753078 TCTCATCGTGGGAGGACCG 60.753 63.158 0.00 0.00 44.64 4.79
121 122 0.684805 AGTCTCATCGTGGGAGGACC 60.685 60.000 0.00 0.00 40.81 4.46
122 123 0.457851 CAGTCTCATCGTGGGAGGAC 59.542 60.000 0.00 0.00 33.18 3.85
123 124 1.323271 GCAGTCTCATCGTGGGAGGA 61.323 60.000 0.00 0.00 33.18 3.71
124 125 1.142748 GCAGTCTCATCGTGGGAGG 59.857 63.158 0.00 0.00 33.18 4.30
125 126 1.226802 CGCAGTCTCATCGTGGGAG 60.227 63.158 0.00 0.00 0.00 4.30
126 127 2.710902 CCGCAGTCTCATCGTGGGA 61.711 63.158 0.00 0.00 0.00 4.37
127 128 2.202797 CCGCAGTCTCATCGTGGG 60.203 66.667 0.00 0.00 0.00 4.61
128 129 2.202797 CCCGCAGTCTCATCGTGG 60.203 66.667 0.00 0.00 0.00 4.94
129 130 2.202797 CCCCGCAGTCTCATCGTG 60.203 66.667 0.00 0.00 0.00 4.35
130 131 3.461773 CCCCCGCAGTCTCATCGT 61.462 66.667 0.00 0.00 0.00 3.73
144 145 1.907255 ACAAGTAGTCTAACAGCCCCC 59.093 52.381 0.00 0.00 0.00 5.40
145 146 5.116882 CAATACAAGTAGTCTAACAGCCCC 58.883 45.833 0.00 0.00 0.00 5.80
146 147 5.116882 CCAATACAAGTAGTCTAACAGCCC 58.883 45.833 0.00 0.00 0.00 5.19
147 148 5.731591 ACCAATACAAGTAGTCTAACAGCC 58.268 41.667 0.00 0.00 0.00 4.85
148 149 6.631962 AGACCAATACAAGTAGTCTAACAGC 58.368 40.000 0.00 0.00 36.08 4.40
149 150 7.122948 AGGAGACCAATACAAGTAGTCTAACAG 59.877 40.741 0.00 0.00 37.90 3.16
150 151 6.952358 AGGAGACCAATACAAGTAGTCTAACA 59.048 38.462 0.00 0.00 37.90 2.41
151 152 7.407393 AGGAGACCAATACAAGTAGTCTAAC 57.593 40.000 0.00 0.00 37.90 2.34
152 153 7.281774 CGTAGGAGACCAATACAAGTAGTCTAA 59.718 40.741 0.00 0.00 37.90 2.10
153 154 6.765036 CGTAGGAGACCAATACAAGTAGTCTA 59.235 42.308 0.00 0.00 37.90 2.59
154 155 5.589452 CGTAGGAGACCAATACAAGTAGTCT 59.411 44.000 0.00 0.00 40.40 3.24
155 156 5.732810 GCGTAGGAGACCAATACAAGTAGTC 60.733 48.000 0.00 0.00 0.00 2.59
156 157 4.097589 GCGTAGGAGACCAATACAAGTAGT 59.902 45.833 0.00 0.00 0.00 2.73
157 158 4.338682 AGCGTAGGAGACCAATACAAGTAG 59.661 45.833 0.00 0.00 0.00 2.57
158 159 4.275810 AGCGTAGGAGACCAATACAAGTA 58.724 43.478 0.00 0.00 0.00 2.24
159 160 3.097614 AGCGTAGGAGACCAATACAAGT 58.902 45.455 0.00 0.00 0.00 3.16
160 161 3.802948 AGCGTAGGAGACCAATACAAG 57.197 47.619 0.00 0.00 0.00 3.16
161 162 4.023450 CGATAGCGTAGGAGACCAATACAA 60.023 45.833 0.00 0.00 0.00 2.41
162 163 3.501062 CGATAGCGTAGGAGACCAATACA 59.499 47.826 0.00 0.00 0.00 2.29
163 164 3.119919 CCGATAGCGTAGGAGACCAATAC 60.120 52.174 0.00 0.00 35.23 1.89
164 165 3.079578 CCGATAGCGTAGGAGACCAATA 58.920 50.000 0.00 0.00 35.23 1.90
165 166 1.887198 CCGATAGCGTAGGAGACCAAT 59.113 52.381 0.00 0.00 35.23 3.16
166 167 1.315690 CCGATAGCGTAGGAGACCAA 58.684 55.000 0.00 0.00 35.23 3.67
167 168 1.170919 GCCGATAGCGTAGGAGACCA 61.171 60.000 0.00 0.00 35.23 4.02
168 169 1.580437 GCCGATAGCGTAGGAGACC 59.420 63.158 0.00 0.00 35.23 3.85
178 179 0.878086 GACCAGCTCAAGCCGATAGC 60.878 60.000 0.00 0.00 43.38 2.97
179 180 0.461548 TGACCAGCTCAAGCCGATAG 59.538 55.000 0.00 0.00 43.38 2.08
180 181 0.901827 TTGACCAGCTCAAGCCGATA 59.098 50.000 0.00 0.00 43.38 2.92
181 182 1.679311 TTGACCAGCTCAAGCCGAT 59.321 52.632 0.00 0.00 43.38 4.18
182 183 3.147132 TTGACCAGCTCAAGCCGA 58.853 55.556 0.00 0.00 43.38 5.54
187 188 0.819259 GGCACACTTGACCAGCTCAA 60.819 55.000 0.00 0.00 36.46 3.02
188 189 1.227943 GGCACACTTGACCAGCTCA 60.228 57.895 0.00 0.00 0.00 4.26
189 190 0.536006 AAGGCACACTTGACCAGCTC 60.536 55.000 0.00 0.00 38.21 4.09
190 191 0.764890 TAAGGCACACTTGACCAGCT 59.235 50.000 0.00 0.00 40.37 4.24
191 192 1.740025 GATAAGGCACACTTGACCAGC 59.260 52.381 0.00 0.00 40.37 4.85
192 193 2.359900 GGATAAGGCACACTTGACCAG 58.640 52.381 0.00 0.00 40.37 4.00
193 194 1.004277 GGGATAAGGCACACTTGACCA 59.996 52.381 0.00 0.00 40.37 4.02
194 195 1.751437 GGGATAAGGCACACTTGACC 58.249 55.000 0.00 0.00 40.37 4.02
195 196 1.369625 CGGGATAAGGCACACTTGAC 58.630 55.000 0.00 0.00 40.37 3.18
196 197 0.392461 GCGGGATAAGGCACACTTGA 60.392 55.000 0.00 0.00 40.37 3.02
197 198 1.376609 GGCGGGATAAGGCACACTTG 61.377 60.000 0.00 0.00 40.37 3.16
198 199 1.077716 GGCGGGATAAGGCACACTT 60.078 57.895 0.00 0.00 43.28 3.16
199 200 2.590092 GGCGGGATAAGGCACACT 59.410 61.111 0.00 0.00 0.00 3.55
200 201 2.895372 CGGCGGGATAAGGCACAC 60.895 66.667 0.00 0.00 0.00 3.82
201 202 3.078196 TCGGCGGGATAAGGCACA 61.078 61.111 7.21 0.00 0.00 4.57
202 203 2.588034 GTCGGCGGGATAAGGCAC 60.588 66.667 7.21 0.00 0.00 5.01
203 204 4.215742 CGTCGGCGGGATAAGGCA 62.216 66.667 7.21 0.00 0.00 4.75
204 205 3.728279 AACGTCGGCGGGATAAGGC 62.728 63.158 16.39 0.00 43.45 4.35
205 206 1.881252 CAACGTCGGCGGGATAAGG 60.881 63.158 16.39 0.00 43.45 2.69
206 207 2.522638 GCAACGTCGGCGGGATAAG 61.523 63.158 16.39 0.00 43.45 1.73
207 208 2.509786 GCAACGTCGGCGGGATAA 60.510 61.111 16.39 0.00 43.45 1.75
208 209 3.083848 ATGCAACGTCGGCGGGATA 62.084 57.895 16.39 0.00 43.45 2.59
209 210 4.467084 ATGCAACGTCGGCGGGAT 62.467 61.111 16.39 0.00 43.45 3.85
230 231 2.100991 GGTAGTTGCGCTGCATGC 59.899 61.111 11.82 11.82 38.76 4.06
231 232 1.378882 ATGGGTAGTTGCGCTGCATG 61.379 55.000 9.73 0.00 38.76 4.06
232 233 1.077501 ATGGGTAGTTGCGCTGCAT 60.078 52.632 9.73 0.00 38.76 3.96
233 234 1.745115 GATGGGTAGTTGCGCTGCA 60.745 57.895 9.73 0.00 36.47 4.41
234 235 2.813179 CGATGGGTAGTTGCGCTGC 61.813 63.158 9.73 0.48 0.00 5.25
235 236 0.530650 ATCGATGGGTAGTTGCGCTG 60.531 55.000 9.73 0.00 0.00 5.18
236 237 0.249489 GATCGATGGGTAGTTGCGCT 60.249 55.000 9.73 0.00 0.00 5.92
237 238 0.249489 AGATCGATGGGTAGTTGCGC 60.249 55.000 0.54 0.00 0.00 6.09
238 239 2.351835 CCTAGATCGATGGGTAGTTGCG 60.352 54.545 0.54 0.00 0.00 4.85
239 240 2.891580 TCCTAGATCGATGGGTAGTTGC 59.108 50.000 0.54 0.00 0.00 4.17
240 241 4.142578 CGATCCTAGATCGATGGGTAGTTG 60.143 50.000 19.51 0.00 43.59 3.16
241 242 4.011023 CGATCCTAGATCGATGGGTAGTT 58.989 47.826 19.51 0.00 43.59 2.24
242 243 3.263681 TCGATCCTAGATCGATGGGTAGT 59.736 47.826 22.06 0.00 44.42 2.73
243 244 3.875125 TCGATCCTAGATCGATGGGTAG 58.125 50.000 22.06 0.73 44.42 3.18
244 245 3.994931 TCGATCCTAGATCGATGGGTA 57.005 47.619 22.06 3.17 44.42 3.69
245 246 2.881111 TCGATCCTAGATCGATGGGT 57.119 50.000 22.06 0.00 44.42 4.51
251 252 7.084486 TGAATACAACAATCGATCCTAGATCG 58.916 38.462 18.45 18.45 42.38 3.69
252 253 8.085296 ACTGAATACAACAATCGATCCTAGATC 58.915 37.037 0.00 0.00 0.00 2.75
253 254 7.957002 ACTGAATACAACAATCGATCCTAGAT 58.043 34.615 0.00 0.00 0.00 1.98
254 255 7.348080 ACTGAATACAACAATCGATCCTAGA 57.652 36.000 0.00 0.00 0.00 2.43
255 256 9.186323 CTAACTGAATACAACAATCGATCCTAG 57.814 37.037 0.00 0.00 0.00 3.02
256 257 8.909923 TCTAACTGAATACAACAATCGATCCTA 58.090 33.333 0.00 0.00 0.00 2.94
257 258 7.782049 TCTAACTGAATACAACAATCGATCCT 58.218 34.615 0.00 0.00 0.00 3.24
258 259 7.921214 TCTCTAACTGAATACAACAATCGATCC 59.079 37.037 0.00 0.00 0.00 3.36
259 260 8.858003 TCTCTAACTGAATACAACAATCGATC 57.142 34.615 0.00 0.00 0.00 3.69
260 261 8.470805 ACTCTCTAACTGAATACAACAATCGAT 58.529 33.333 0.00 0.00 0.00 3.59
261 262 7.755373 CACTCTCTAACTGAATACAACAATCGA 59.245 37.037 0.00 0.00 0.00 3.59
262 263 7.463383 GCACTCTCTAACTGAATACAACAATCG 60.463 40.741 0.00 0.00 0.00 3.34
263 264 7.331934 TGCACTCTCTAACTGAATACAACAATC 59.668 37.037 0.00 0.00 0.00 2.67
264 265 7.161404 TGCACTCTCTAACTGAATACAACAAT 58.839 34.615 0.00 0.00 0.00 2.71
265 266 6.521162 TGCACTCTCTAACTGAATACAACAA 58.479 36.000 0.00 0.00 0.00 2.83
266 267 6.096673 TGCACTCTCTAACTGAATACAACA 57.903 37.500 0.00 0.00 0.00 3.33
267 268 6.591834 ACATGCACTCTCTAACTGAATACAAC 59.408 38.462 0.00 0.00 0.00 3.32
268 269 6.591448 CACATGCACTCTCTAACTGAATACAA 59.409 38.462 0.00 0.00 0.00 2.41
269 270 6.101997 CACATGCACTCTCTAACTGAATACA 58.898 40.000 0.00 0.00 0.00 2.29
270 271 6.102663 ACACATGCACTCTCTAACTGAATAC 58.897 40.000 0.00 0.00 0.00 1.89
271 272 6.286240 ACACATGCACTCTCTAACTGAATA 57.714 37.500 0.00 0.00 0.00 1.75
272 273 5.157940 ACACATGCACTCTCTAACTGAAT 57.842 39.130 0.00 0.00 0.00 2.57
273 274 4.607293 ACACATGCACTCTCTAACTGAA 57.393 40.909 0.00 0.00 0.00 3.02
274 275 5.654209 AGATACACATGCACTCTCTAACTGA 59.346 40.000 0.00 0.00 0.00 3.41
275 276 5.900425 AGATACACATGCACTCTCTAACTG 58.100 41.667 0.00 0.00 0.00 3.16
276 277 6.379703 AGAAGATACACATGCACTCTCTAACT 59.620 38.462 0.00 0.00 0.00 2.24
277 278 6.568869 AGAAGATACACATGCACTCTCTAAC 58.431 40.000 0.00 0.00 0.00 2.34
278 279 6.782082 AGAAGATACACATGCACTCTCTAA 57.218 37.500 0.00 0.00 0.00 2.10
279 280 6.605194 AGAAGAAGATACACATGCACTCTCTA 59.395 38.462 0.00 0.00 0.00 2.43
280 281 5.421693 AGAAGAAGATACACATGCACTCTCT 59.578 40.000 0.00 0.00 0.00 3.10
281 282 5.659463 AGAAGAAGATACACATGCACTCTC 58.341 41.667 0.00 0.00 0.00 3.20
282 283 5.395103 GGAGAAGAAGATACACATGCACTCT 60.395 44.000 0.00 0.00 0.00 3.24
283 284 4.808364 GGAGAAGAAGATACACATGCACTC 59.192 45.833 0.00 0.00 0.00 3.51
284 285 4.469227 AGGAGAAGAAGATACACATGCACT 59.531 41.667 0.00 0.00 0.00 4.40
285 286 4.764172 AGGAGAAGAAGATACACATGCAC 58.236 43.478 0.00 0.00 0.00 4.57
286 287 4.713814 AGAGGAGAAGAAGATACACATGCA 59.286 41.667 0.00 0.00 0.00 3.96
287 288 5.068987 AGAGAGGAGAAGAAGATACACATGC 59.931 44.000 0.00 0.00 0.00 4.06
288 289 6.320926 TGAGAGAGGAGAAGAAGATACACATG 59.679 42.308 0.00 0.00 0.00 3.21
289 290 6.321181 GTGAGAGAGGAGAAGAAGATACACAT 59.679 42.308 0.00 0.00 0.00 3.21
290 291 5.650266 GTGAGAGAGGAGAAGAAGATACACA 59.350 44.000 0.00 0.00 0.00 3.72
291 292 5.885912 AGTGAGAGAGGAGAAGAAGATACAC 59.114 44.000 0.00 0.00 0.00 2.90
292 293 5.885352 CAGTGAGAGAGGAGAAGAAGATACA 59.115 44.000 0.00 0.00 0.00 2.29
293 294 6.119536 TCAGTGAGAGAGGAGAAGAAGATAC 58.880 44.000 0.00 0.00 0.00 2.24
294 295 6.320434 TCAGTGAGAGAGGAGAAGAAGATA 57.680 41.667 0.00 0.00 0.00 1.98
295 296 5.191727 TCAGTGAGAGAGGAGAAGAAGAT 57.808 43.478 0.00 0.00 0.00 2.40
296 297 4.649267 TCAGTGAGAGAGGAGAAGAAGA 57.351 45.455 0.00 0.00 0.00 2.87
297 298 4.706476 ACATCAGTGAGAGAGGAGAAGAAG 59.294 45.833 0.00 0.00 0.00 2.85
298 299 4.671831 ACATCAGTGAGAGAGGAGAAGAA 58.328 43.478 0.00 0.00 0.00 2.52
299 300 4.314522 ACATCAGTGAGAGAGGAGAAGA 57.685 45.455 0.00 0.00 0.00 2.87
300 301 6.547141 AGATTACATCAGTGAGAGAGGAGAAG 59.453 42.308 0.00 0.00 0.00 2.85
301 302 6.430864 AGATTACATCAGTGAGAGAGGAGAA 58.569 40.000 0.00 0.00 0.00 2.87
302 303 6.012337 AGATTACATCAGTGAGAGAGGAGA 57.988 41.667 0.00 0.00 0.00 3.71
303 304 9.685276 ATATAGATTACATCAGTGAGAGAGGAG 57.315 37.037 0.00 0.00 0.00 3.69
321 322 9.574577 TCCACAAGGGGTAATGATATATAGATT 57.425 33.333 0.00 0.00 37.22 2.40
322 323 9.749996 ATCCACAAGGGGTAATGATATATAGAT 57.250 33.333 0.00 0.00 37.22 1.98
323 324 8.992349 CATCCACAAGGGGTAATGATATATAGA 58.008 37.037 0.00 0.00 37.22 1.98
324 325 8.992349 TCATCCACAAGGGGTAATGATATATAG 58.008 37.037 0.00 0.00 37.22 1.31
325 326 8.925447 TCATCCACAAGGGGTAATGATATATA 57.075 34.615 0.00 0.00 37.22 0.86
326 327 7.829224 TCATCCACAAGGGGTAATGATATAT 57.171 36.000 0.00 0.00 37.22 0.86
327 328 7.640577 TTCATCCACAAGGGGTAATGATATA 57.359 36.000 0.00 0.00 33.41 0.86
328 329 6.529084 TTCATCCACAAGGGGTAATGATAT 57.471 37.500 0.00 0.00 33.41 1.63
329 330 5.985175 TTCATCCACAAGGGGTAATGATA 57.015 39.130 0.00 0.00 33.41 2.15
330 331 4.879295 TTCATCCACAAGGGGTAATGAT 57.121 40.909 0.00 0.00 33.41 2.45
331 332 4.879295 ATTCATCCACAAGGGGTAATGA 57.121 40.909 0.00 0.00 37.22 2.57
332 333 5.445069 TGTATTCATCCACAAGGGGTAATG 58.555 41.667 0.00 0.00 37.22 1.90
333 334 5.725551 TGTATTCATCCACAAGGGGTAAT 57.274 39.130 0.00 0.00 37.22 1.89
334 335 5.505780 CTTGTATTCATCCACAAGGGGTAA 58.494 41.667 6.57 0.00 45.08 2.85
335 336 5.110814 CTTGTATTCATCCACAAGGGGTA 57.889 43.478 6.57 0.00 45.08 3.69
336 337 3.968265 CTTGTATTCATCCACAAGGGGT 58.032 45.455 6.57 0.00 45.08 4.95
341 342 3.669536 TCACGCTTGTATTCATCCACAA 58.330 40.909 0.00 0.00 33.76 3.33
342 343 3.326836 TCACGCTTGTATTCATCCACA 57.673 42.857 0.00 0.00 0.00 4.17
343 344 3.546815 GCATCACGCTTGTATTCATCCAC 60.547 47.826 0.00 0.00 37.77 4.02
344 345 2.613595 GCATCACGCTTGTATTCATCCA 59.386 45.455 0.00 0.00 37.77 3.41
345 346 2.613595 TGCATCACGCTTGTATTCATCC 59.386 45.455 0.00 0.00 43.06 3.51
346 347 3.950087 TGCATCACGCTTGTATTCATC 57.050 42.857 0.00 0.00 43.06 2.92
347 348 3.251729 GGATGCATCACGCTTGTATTCAT 59.748 43.478 27.25 0.00 43.06 2.57
348 349 2.613595 GGATGCATCACGCTTGTATTCA 59.386 45.455 27.25 0.00 43.06 2.57
349 350 2.031682 GGGATGCATCACGCTTGTATTC 60.032 50.000 27.25 5.88 43.06 1.75
350 351 1.949525 GGGATGCATCACGCTTGTATT 59.050 47.619 27.25 0.00 43.06 1.89
351 352 1.134128 TGGGATGCATCACGCTTGTAT 60.134 47.619 27.25 0.00 43.06 2.29
352 353 0.251634 TGGGATGCATCACGCTTGTA 59.748 50.000 27.25 4.59 43.06 2.41
353 354 0.608856 TTGGGATGCATCACGCTTGT 60.609 50.000 27.25 0.00 43.06 3.16
354 355 0.527113 TTTGGGATGCATCACGCTTG 59.473 50.000 27.25 0.00 43.06 4.01
355 356 0.527565 GTTTGGGATGCATCACGCTT 59.472 50.000 27.25 0.00 43.06 4.68
356 357 0.322816 AGTTTGGGATGCATCACGCT 60.323 50.000 27.25 19.33 43.06 5.07
357 358 0.099436 GAGTTTGGGATGCATCACGC 59.901 55.000 27.25 17.51 42.89 5.34
358 359 1.452110 TGAGTTTGGGATGCATCACG 58.548 50.000 27.25 0.00 31.21 4.35
359 360 3.285484 AGATGAGTTTGGGATGCATCAC 58.715 45.455 27.25 25.01 38.19 3.06
360 361 3.054213 TGAGATGAGTTTGGGATGCATCA 60.054 43.478 27.25 6.50 38.19 3.07
361 362 3.548770 TGAGATGAGTTTGGGATGCATC 58.451 45.455 18.81 18.81 36.49 3.91
362 363 3.657398 TGAGATGAGTTTGGGATGCAT 57.343 42.857 0.00 0.00 0.00 3.96
363 364 3.438216 TTGAGATGAGTTTGGGATGCA 57.562 42.857 0.00 0.00 0.00 3.96
364 365 4.643784 AGAATTGAGATGAGTTTGGGATGC 59.356 41.667 0.00 0.00 0.00 3.91
365 366 6.770746 AAGAATTGAGATGAGTTTGGGATG 57.229 37.500 0.00 0.00 0.00 3.51
366 367 7.890127 TGTTAAGAATTGAGATGAGTTTGGGAT 59.110 33.333 0.00 0.00 0.00 3.85
367 368 7.230747 TGTTAAGAATTGAGATGAGTTTGGGA 58.769 34.615 0.00 0.00 0.00 4.37
368 369 7.452880 TGTTAAGAATTGAGATGAGTTTGGG 57.547 36.000 0.00 0.00 0.00 4.12
369 370 7.025963 GCTGTTAAGAATTGAGATGAGTTTGG 58.974 38.462 0.00 0.00 0.00 3.28
370 371 7.025963 GGCTGTTAAGAATTGAGATGAGTTTG 58.974 38.462 0.00 0.00 0.00 2.93
371 372 6.128172 CGGCTGTTAAGAATTGAGATGAGTTT 60.128 38.462 0.00 0.00 0.00 2.66
372 373 5.352569 CGGCTGTTAAGAATTGAGATGAGTT 59.647 40.000 0.00 0.00 0.00 3.01
373 374 4.872691 CGGCTGTTAAGAATTGAGATGAGT 59.127 41.667 0.00 0.00 0.00 3.41
374 375 5.111989 TCGGCTGTTAAGAATTGAGATGAG 58.888 41.667 0.00 0.00 0.00 2.90
375 376 5.084818 TCGGCTGTTAAGAATTGAGATGA 57.915 39.130 0.00 0.00 0.00 2.92
376 377 5.801350 TTCGGCTGTTAAGAATTGAGATG 57.199 39.130 0.00 0.00 0.00 2.90
377 378 5.940470 ACTTTCGGCTGTTAAGAATTGAGAT 59.060 36.000 14.33 0.00 0.00 2.75
378 379 5.179368 CACTTTCGGCTGTTAAGAATTGAGA 59.821 40.000 14.33 0.00 0.00 3.27
379 380 5.385617 CACTTTCGGCTGTTAAGAATTGAG 58.614 41.667 14.33 0.00 0.00 3.02
380 381 4.215399 CCACTTTCGGCTGTTAAGAATTGA 59.785 41.667 14.33 0.00 0.00 2.57
381 382 4.215399 TCCACTTTCGGCTGTTAAGAATTG 59.785 41.667 14.33 5.30 0.00 2.32
382 383 4.394729 TCCACTTTCGGCTGTTAAGAATT 58.605 39.130 14.33 0.00 0.00 2.17
383 384 4.003648 CTCCACTTTCGGCTGTTAAGAAT 58.996 43.478 14.33 0.00 0.00 2.40
384 385 3.070446 TCTCCACTTTCGGCTGTTAAGAA 59.930 43.478 14.33 0.00 0.00 2.52
385 386 2.631062 TCTCCACTTTCGGCTGTTAAGA 59.369 45.455 14.33 0.00 0.00 2.10
386 387 3.040147 TCTCCACTTTCGGCTGTTAAG 57.960 47.619 8.11 8.11 0.00 1.85
387 388 3.135994 GTTCTCCACTTTCGGCTGTTAA 58.864 45.455 0.00 0.00 0.00 2.01
388 389 2.103432 TGTTCTCCACTTTCGGCTGTTA 59.897 45.455 0.00 0.00 0.00 2.41
389 390 1.134220 TGTTCTCCACTTTCGGCTGTT 60.134 47.619 0.00 0.00 0.00 3.16
390 391 0.468226 TGTTCTCCACTTTCGGCTGT 59.532 50.000 0.00 0.00 0.00 4.40
391 392 1.734465 GATGTTCTCCACTTTCGGCTG 59.266 52.381 0.00 0.00 0.00 4.85
392 393 1.347707 TGATGTTCTCCACTTTCGGCT 59.652 47.619 0.00 0.00 0.00 5.52
393 394 1.808411 TGATGTTCTCCACTTTCGGC 58.192 50.000 0.00 0.00 0.00 5.54
394 395 3.599343 TGATGATGTTCTCCACTTTCGG 58.401 45.455 0.00 0.00 0.00 4.30
395 396 4.452114 TGTTGATGATGTTCTCCACTTTCG 59.548 41.667 0.00 0.00 0.00 3.46
396 397 5.471456 AGTGTTGATGATGTTCTCCACTTTC 59.529 40.000 0.00 0.00 29.12 2.62
397 398 5.240183 CAGTGTTGATGATGTTCTCCACTTT 59.760 40.000 0.00 0.00 30.24 2.66
398 399 4.758674 CAGTGTTGATGATGTTCTCCACTT 59.241 41.667 0.00 0.00 30.24 3.16
399 400 4.321718 CAGTGTTGATGATGTTCTCCACT 58.678 43.478 0.00 0.00 31.72 4.00
400 401 3.438087 CCAGTGTTGATGATGTTCTCCAC 59.562 47.826 0.00 0.00 0.00 4.02
401 402 3.072915 ACCAGTGTTGATGATGTTCTCCA 59.927 43.478 0.00 0.00 0.00 3.86
402 403 3.679389 ACCAGTGTTGATGATGTTCTCC 58.321 45.455 0.00 0.00 0.00 3.71
403 404 3.686726 GGACCAGTGTTGATGATGTTCTC 59.313 47.826 0.00 0.00 0.00 2.87
404 405 3.328931 AGGACCAGTGTTGATGATGTTCT 59.671 43.478 0.00 0.00 0.00 3.01
405 406 3.438087 CAGGACCAGTGTTGATGATGTTC 59.562 47.826 0.00 0.00 0.00 3.18
406 407 3.072915 TCAGGACCAGTGTTGATGATGTT 59.927 43.478 0.00 0.00 0.00 2.71
407 408 2.639347 TCAGGACCAGTGTTGATGATGT 59.361 45.455 0.00 0.00 0.00 3.06
408 409 3.339253 TCAGGACCAGTGTTGATGATG 57.661 47.619 0.00 0.00 0.00 3.07
409 410 4.267536 CATTCAGGACCAGTGTTGATGAT 58.732 43.478 0.00 0.00 0.00 2.45
410 411 3.559811 CCATTCAGGACCAGTGTTGATGA 60.560 47.826 0.00 0.00 41.22 2.92
411 412 2.751259 CCATTCAGGACCAGTGTTGATG 59.249 50.000 0.00 0.00 41.22 3.07
412 413 2.644299 TCCATTCAGGACCAGTGTTGAT 59.356 45.455 0.00 0.00 43.07 2.57
413 414 2.054021 TCCATTCAGGACCAGTGTTGA 58.946 47.619 0.00 0.00 43.07 3.18
414 415 2.566833 TCCATTCAGGACCAGTGTTG 57.433 50.000 0.00 0.00 43.07 3.33
426 427 7.360622 CCTCAAGCAGGTGAATTATCCATTCA 61.361 42.308 0.00 0.00 40.37 2.57
427 428 5.009410 CCTCAAGCAGGTGAATTATCCATTC 59.991 44.000 0.00 0.00 37.53 2.67
428 429 4.891756 CCTCAAGCAGGTGAATTATCCATT 59.108 41.667 0.00 0.00 37.53 3.16
429 430 4.467769 CCTCAAGCAGGTGAATTATCCAT 58.532 43.478 0.00 0.00 37.53 3.41
430 431 3.371917 CCCTCAAGCAGGTGAATTATCCA 60.372 47.826 0.00 0.00 41.51 3.41
431 432 3.117888 TCCCTCAAGCAGGTGAATTATCC 60.118 47.826 0.00 0.00 41.51 2.59
432 433 4.156455 TCCCTCAAGCAGGTGAATTATC 57.844 45.455 0.00 0.00 41.51 1.75
433 434 4.467769 CATCCCTCAAGCAGGTGAATTAT 58.532 43.478 0.00 0.00 41.51 1.28
434 435 3.889815 CATCCCTCAAGCAGGTGAATTA 58.110 45.455 0.00 0.00 41.51 1.40
435 436 2.731572 CATCCCTCAAGCAGGTGAATT 58.268 47.619 0.00 0.00 41.51 2.17
436 437 1.684248 GCATCCCTCAAGCAGGTGAAT 60.684 52.381 0.00 0.00 41.51 2.57
437 438 0.322816 GCATCCCTCAAGCAGGTGAA 60.323 55.000 0.00 0.00 41.51 3.18
438 439 1.300963 GCATCCCTCAAGCAGGTGA 59.699 57.895 0.00 0.00 41.51 4.02
439 440 1.001764 TGCATCCCTCAAGCAGGTG 60.002 57.895 0.00 0.00 41.51 4.00
440 441 1.001641 GTGCATCCCTCAAGCAGGT 60.002 57.895 0.00 0.00 41.51 4.00
441 442 0.747283 GAGTGCATCCCTCAAGCAGG 60.747 60.000 0.00 0.00 43.01 4.85
442 443 0.035725 TGAGTGCATCCCTCAAGCAG 60.036 55.000 3.17 0.00 39.21 4.24
443 444 0.622136 ATGAGTGCATCCCTCAAGCA 59.378 50.000 9.31 0.00 41.93 3.91
444 445 1.022735 CATGAGTGCATCCCTCAAGC 58.977 55.000 9.31 0.00 41.93 4.01
445 446 2.704464 TCATGAGTGCATCCCTCAAG 57.296 50.000 9.31 5.78 41.93 3.02
446 447 2.573009 TCTTCATGAGTGCATCCCTCAA 59.427 45.455 9.31 0.00 41.93 3.02
447 448 2.169978 CTCTTCATGAGTGCATCCCTCA 59.830 50.000 7.85 7.85 42.74 3.86
448 449 2.836262 CTCTTCATGAGTGCATCCCTC 58.164 52.381 0.00 0.00 37.99 4.30
449 450 1.134159 GCTCTTCATGAGTGCATCCCT 60.134 52.381 10.44 0.00 44.41 4.20
450 451 1.307097 GCTCTTCATGAGTGCATCCC 58.693 55.000 10.44 0.00 44.41 3.85
451 452 0.935898 CGCTCTTCATGAGTGCATCC 59.064 55.000 14.09 0.00 44.91 3.51
464 465 1.257743 TAGCACTGGAAGACGCTCTT 58.742 50.000 0.00 0.71 43.24 2.85
465 466 1.257743 TTAGCACTGGAAGACGCTCT 58.742 50.000 0.00 0.00 43.24 4.09
466 467 1.929836 CATTAGCACTGGAAGACGCTC 59.070 52.381 0.00 0.00 43.24 5.03
467 468 1.550524 TCATTAGCACTGGAAGACGCT 59.449 47.619 0.00 0.00 45.44 5.07
468 469 1.661112 GTCATTAGCACTGGAAGACGC 59.339 52.381 0.00 0.00 37.43 5.19
469 470 1.920574 CGTCATTAGCACTGGAAGACG 59.079 52.381 0.00 0.00 40.81 4.18
470 471 1.661112 GCGTCATTAGCACTGGAAGAC 59.339 52.381 0.00 0.00 37.43 3.01
471 472 1.550524 AGCGTCATTAGCACTGGAAGA 59.449 47.619 0.00 0.00 37.43 2.87
472 473 2.015736 AGCGTCATTAGCACTGGAAG 57.984 50.000 0.00 0.00 42.29 3.46
473 474 3.457234 CATAGCGTCATTAGCACTGGAA 58.543 45.455 0.00 0.00 37.01 3.53
474 475 2.224042 CCATAGCGTCATTAGCACTGGA 60.224 50.000 3.89 0.00 39.34 3.86
475 476 2.138320 CCATAGCGTCATTAGCACTGG 58.862 52.381 0.00 0.00 37.01 4.00
476 477 3.055591 CTCCATAGCGTCATTAGCACTG 58.944 50.000 0.00 0.00 37.01 3.66
477 478 2.036475 CCTCCATAGCGTCATTAGCACT 59.964 50.000 0.00 0.00 37.01 4.40
478 479 2.035961 TCCTCCATAGCGTCATTAGCAC 59.964 50.000 0.00 0.00 37.01 4.40
479 480 2.316108 TCCTCCATAGCGTCATTAGCA 58.684 47.619 0.00 0.00 37.01 3.49
480 481 3.386768 TTCCTCCATAGCGTCATTAGC 57.613 47.619 0.00 0.00 0.00 3.09
481 482 4.692625 CCAATTCCTCCATAGCGTCATTAG 59.307 45.833 0.00 0.00 0.00 1.73
482 483 4.102524 ACCAATTCCTCCATAGCGTCATTA 59.897 41.667 0.00 0.00 0.00 1.90
483 484 3.117888 ACCAATTCCTCCATAGCGTCATT 60.118 43.478 0.00 0.00 0.00 2.57
484 485 2.439507 ACCAATTCCTCCATAGCGTCAT 59.560 45.455 0.00 0.00 0.00 3.06
485 486 1.837439 ACCAATTCCTCCATAGCGTCA 59.163 47.619 0.00 0.00 0.00 4.35
486 487 2.622064 ACCAATTCCTCCATAGCGTC 57.378 50.000 0.00 0.00 0.00 5.19
487 488 2.223971 CGTACCAATTCCTCCATAGCGT 60.224 50.000 0.00 0.00 0.00 5.07
488 489 2.223971 ACGTACCAATTCCTCCATAGCG 60.224 50.000 0.00 0.00 0.00 4.26
489 490 3.391049 GACGTACCAATTCCTCCATAGC 58.609 50.000 0.00 0.00 0.00 2.97
490 491 3.552273 CGGACGTACCAATTCCTCCATAG 60.552 52.174 0.00 0.00 38.90 2.23
491 492 2.363038 CGGACGTACCAATTCCTCCATA 59.637 50.000 0.00 0.00 38.90 2.74
492 493 1.138266 CGGACGTACCAATTCCTCCAT 59.862 52.381 0.00 0.00 38.90 3.41
493 494 0.533491 CGGACGTACCAATTCCTCCA 59.467 55.000 0.00 0.00 38.90 3.86
494 495 0.819582 TCGGACGTACCAATTCCTCC 59.180 55.000 0.00 0.00 38.90 4.30
495 496 2.660189 TTCGGACGTACCAATTCCTC 57.340 50.000 0.00 0.00 38.90 3.71
496 497 3.055675 TCATTTCGGACGTACCAATTCCT 60.056 43.478 0.00 0.00 38.90 3.36
497 498 3.264104 TCATTTCGGACGTACCAATTCC 58.736 45.455 0.00 0.00 38.90 3.01
498 499 4.932268 TTCATTTCGGACGTACCAATTC 57.068 40.909 0.00 0.00 38.90 2.17
499 500 5.890424 ATTTCATTTCGGACGTACCAATT 57.110 34.783 0.00 0.00 38.90 2.32
500 501 5.875910 TGTATTTCATTTCGGACGTACCAAT 59.124 36.000 0.00 0.00 38.90 3.16
501 502 5.120519 GTGTATTTCATTTCGGACGTACCAA 59.879 40.000 0.00 0.00 38.90 3.67
502 503 4.626604 GTGTATTTCATTTCGGACGTACCA 59.373 41.667 0.00 0.00 38.90 3.25
503 504 4.033243 GGTGTATTTCATTTCGGACGTACC 59.967 45.833 0.00 0.00 0.00 3.34
504 505 4.626604 TGGTGTATTTCATTTCGGACGTAC 59.373 41.667 0.00 0.00 0.00 3.67
505 506 4.626604 GTGGTGTATTTCATTTCGGACGTA 59.373 41.667 0.00 0.00 0.00 3.57
506 507 3.434299 GTGGTGTATTTCATTTCGGACGT 59.566 43.478 0.00 0.00 0.00 4.34
507 508 3.482923 CGTGGTGTATTTCATTTCGGACG 60.483 47.826 0.00 0.00 0.00 4.79
508 509 3.680937 TCGTGGTGTATTTCATTTCGGAC 59.319 43.478 0.00 0.00 0.00 4.79
509 510 3.927854 TCGTGGTGTATTTCATTTCGGA 58.072 40.909 0.00 0.00 0.00 4.55
510 511 3.930229 TCTCGTGGTGTATTTCATTTCGG 59.070 43.478 0.00 0.00 0.00 4.30
511 512 5.524511 TTCTCGTGGTGTATTTCATTTCG 57.475 39.130 0.00 0.00 0.00 3.46
512 513 5.324697 GCTTCTCGTGGTGTATTTCATTTC 58.675 41.667 0.00 0.00 0.00 2.17
513 514 4.156008 GGCTTCTCGTGGTGTATTTCATTT 59.844 41.667 0.00 0.00 0.00 2.32
514 515 3.689649 GGCTTCTCGTGGTGTATTTCATT 59.310 43.478 0.00 0.00 0.00 2.57
515 516 3.270877 GGCTTCTCGTGGTGTATTTCAT 58.729 45.455 0.00 0.00 0.00 2.57
516 517 2.695359 GGCTTCTCGTGGTGTATTTCA 58.305 47.619 0.00 0.00 0.00 2.69
517 518 1.659098 CGGCTTCTCGTGGTGTATTTC 59.341 52.381 0.00 0.00 0.00 2.17
518 519 1.674817 CCGGCTTCTCGTGGTGTATTT 60.675 52.381 0.00 0.00 0.00 1.40
519 520 0.108329 CCGGCTTCTCGTGGTGTATT 60.108 55.000 0.00 0.00 0.00 1.89
520 521 1.515954 CCGGCTTCTCGTGGTGTAT 59.484 57.895 0.00 0.00 0.00 2.29
521 522 2.967397 CCGGCTTCTCGTGGTGTA 59.033 61.111 0.00 0.00 0.00 2.90
522 523 4.681978 GCCGGCTTCTCGTGGTGT 62.682 66.667 22.15 0.00 0.00 4.16
523 524 4.680237 TGCCGGCTTCTCGTGGTG 62.680 66.667 29.70 0.00 0.00 4.17
524 525 4.681978 GTGCCGGCTTCTCGTGGT 62.682 66.667 29.70 0.00 0.00 4.16
526 527 4.379243 AGGTGCCGGCTTCTCGTG 62.379 66.667 29.70 0.00 0.00 4.35
527 528 4.070552 GAGGTGCCGGCTTCTCGT 62.071 66.667 29.70 16.06 0.00 4.18
528 529 4.821589 GGAGGTGCCGGCTTCTCG 62.822 72.222 29.70 0.00 0.00 4.04
537 538 0.749454 ATGCTTCAATCGGAGGTGCC 60.749 55.000 0.00 0.00 0.00 5.01
538 539 0.659957 GATGCTTCAATCGGAGGTGC 59.340 55.000 0.00 0.00 0.00 5.01
539 540 1.303309 GGATGCTTCAATCGGAGGTG 58.697 55.000 1.64 0.00 0.00 4.00
540 541 0.911769 TGGATGCTTCAATCGGAGGT 59.088 50.000 1.64 0.00 0.00 3.85
541 542 1.139654 TCTGGATGCTTCAATCGGAGG 59.860 52.381 1.64 0.00 0.00 4.30
542 543 2.609427 TCTGGATGCTTCAATCGGAG 57.391 50.000 1.64 0.00 0.00 4.63
543 544 2.420547 CCTTCTGGATGCTTCAATCGGA 60.421 50.000 1.64 0.00 34.57 4.55
544 545 1.945394 CCTTCTGGATGCTTCAATCGG 59.055 52.381 1.64 0.00 34.57 4.18
545 546 2.636830 ACCTTCTGGATGCTTCAATCG 58.363 47.619 1.64 0.00 37.04 3.34
546 547 3.379688 GGAACCTTCTGGATGCTTCAATC 59.620 47.826 1.64 0.00 37.04 2.67
547 548 3.011032 AGGAACCTTCTGGATGCTTCAAT 59.989 43.478 1.64 0.00 33.23 2.57
548 549 2.376518 AGGAACCTTCTGGATGCTTCAA 59.623 45.455 1.64 0.00 33.23 2.69
549 550 1.988107 AGGAACCTTCTGGATGCTTCA 59.012 47.619 1.64 0.00 33.23 3.02
550 551 2.797177 AGGAACCTTCTGGATGCTTC 57.203 50.000 0.00 0.00 33.23 3.86
551 552 3.160269 CAAAGGAACCTTCTGGATGCTT 58.840 45.455 6.56 0.00 45.77 3.91
552 553 2.800250 CAAAGGAACCTTCTGGATGCT 58.200 47.619 6.56 0.00 38.37 3.79
553 554 1.203287 GCAAAGGAACCTTCTGGATGC 59.797 52.381 6.56 8.66 34.84 3.91
554 555 1.470098 CGCAAAGGAACCTTCTGGATG 59.530 52.381 6.56 2.68 34.84 3.51
555 556 1.614317 CCGCAAAGGAACCTTCTGGAT 60.614 52.381 6.56 0.00 45.00 3.41
556 557 0.250727 CCGCAAAGGAACCTTCTGGA 60.251 55.000 6.56 0.00 45.00 3.86
557 558 0.537371 ACCGCAAAGGAACCTTCTGG 60.537 55.000 6.56 10.78 45.00 3.86
558 559 1.318576 AACCGCAAAGGAACCTTCTG 58.681 50.000 6.56 8.46 45.00 3.02
559 560 2.943036 TAACCGCAAAGGAACCTTCT 57.057 45.000 6.56 0.00 45.00 2.85
560 561 5.355910 TCAATATAACCGCAAAGGAACCTTC 59.644 40.000 6.56 0.00 45.00 3.46
561 562 5.258051 TCAATATAACCGCAAAGGAACCTT 58.742 37.500 0.00 0.00 45.00 3.50
562 563 4.850680 TCAATATAACCGCAAAGGAACCT 58.149 39.130 0.00 0.00 45.00 3.50
563 564 5.767816 ATCAATATAACCGCAAAGGAACC 57.232 39.130 0.00 0.00 45.00 3.62
564 565 7.441458 AGACTATCAATATAACCGCAAAGGAAC 59.559 37.037 0.00 0.00 45.00 3.62
565 566 7.441157 CAGACTATCAATATAACCGCAAAGGAA 59.559 37.037 0.00 0.00 45.00 3.36
566 567 6.929049 CAGACTATCAATATAACCGCAAAGGA 59.071 38.462 0.00 0.00 45.00 3.36
568 569 6.425114 AGCAGACTATCAATATAACCGCAAAG 59.575 38.462 0.00 0.00 0.00 2.77
569 570 6.288294 AGCAGACTATCAATATAACCGCAAA 58.712 36.000 0.00 0.00 0.00 3.68
570 571 5.853936 AGCAGACTATCAATATAACCGCAA 58.146 37.500 0.00 0.00 0.00 4.85
571 572 5.010617 TGAGCAGACTATCAATATAACCGCA 59.989 40.000 0.00 0.00 0.00 5.69
572 573 5.346281 GTGAGCAGACTATCAATATAACCGC 59.654 44.000 0.00 0.00 0.00 5.68
573 574 6.682746 AGTGAGCAGACTATCAATATAACCG 58.317 40.000 0.00 0.00 0.00 4.44
578 579 8.034215 GCTGAATAGTGAGCAGACTATCAATAT 58.966 37.037 0.00 4.73 38.05 1.28
579 580 7.014615 TGCTGAATAGTGAGCAGACTATCAATA 59.985 37.037 0.00 1.02 40.30 1.90
580 581 6.183360 TGCTGAATAGTGAGCAGACTATCAAT 60.183 38.462 0.00 0.00 40.30 2.57
581 582 5.127682 TGCTGAATAGTGAGCAGACTATCAA 59.872 40.000 0.00 0.96 40.30 2.57
582 583 4.646492 TGCTGAATAGTGAGCAGACTATCA 59.354 41.667 0.00 7.27 40.30 2.15
583 584 5.193663 TGCTGAATAGTGAGCAGACTATC 57.806 43.478 0.00 4.05 40.30 2.08
584 585 5.604758 TTGCTGAATAGTGAGCAGACTAT 57.395 39.130 4.21 2.58 45.65 2.12
585 586 5.604758 ATTGCTGAATAGTGAGCAGACTA 57.395 39.130 4.21 0.00 45.65 2.59
586 587 3.969287 TTGCTGAATAGTGAGCAGACT 57.031 42.857 4.21 0.00 45.65 3.24
587 588 4.509600 GGTATTGCTGAATAGTGAGCAGAC 59.490 45.833 4.21 7.23 45.65 3.51
588 589 4.443457 GGGTATTGCTGAATAGTGAGCAGA 60.443 45.833 4.21 0.00 45.65 4.26
589 590 3.812053 GGGTATTGCTGAATAGTGAGCAG 59.188 47.826 4.21 0.00 45.65 4.24
590 591 3.433598 GGGGTATTGCTGAATAGTGAGCA 60.434 47.826 0.00 0.00 43.47 4.26
591 592 3.142174 GGGGTATTGCTGAATAGTGAGC 58.858 50.000 0.00 0.00 35.65 4.26
592 593 4.130118 GTGGGGTATTGCTGAATAGTGAG 58.870 47.826 0.00 0.00 0.00 3.51
593 594 3.780294 AGTGGGGTATTGCTGAATAGTGA 59.220 43.478 0.00 0.00 0.00 3.41
594 595 4.156455 AGTGGGGTATTGCTGAATAGTG 57.844 45.455 0.00 0.00 0.00 2.74
595 596 4.385310 GGAAGTGGGGTATTGCTGAATAGT 60.385 45.833 0.00 0.00 0.00 2.12
596 597 4.137543 GGAAGTGGGGTATTGCTGAATAG 58.862 47.826 0.00 0.00 0.00 1.73
597 598 3.433031 CGGAAGTGGGGTATTGCTGAATA 60.433 47.826 0.00 0.00 0.00 1.75
598 599 2.683742 CGGAAGTGGGGTATTGCTGAAT 60.684 50.000 0.00 0.00 0.00 2.57
599 600 1.339631 CGGAAGTGGGGTATTGCTGAA 60.340 52.381 0.00 0.00 0.00 3.02
600 601 0.251916 CGGAAGTGGGGTATTGCTGA 59.748 55.000 0.00 0.00 0.00 4.26
601 602 0.251916 TCGGAAGTGGGGTATTGCTG 59.748 55.000 0.00 0.00 0.00 4.41
602 603 1.213296 ATCGGAAGTGGGGTATTGCT 58.787 50.000 0.00 0.00 0.00 3.91
603 604 2.922740 TATCGGAAGTGGGGTATTGC 57.077 50.000 0.00 0.00 0.00 3.56
604 605 4.223032 AGCTATATCGGAAGTGGGGTATTG 59.777 45.833 0.00 0.00 0.00 1.90
605 606 4.426704 AGCTATATCGGAAGTGGGGTATT 58.573 43.478 0.00 0.00 0.00 1.89
606 607 4.062490 AGCTATATCGGAAGTGGGGTAT 57.938 45.455 0.00 0.00 0.00 2.73
607 608 3.537795 AGCTATATCGGAAGTGGGGTA 57.462 47.619 0.00 0.00 0.00 3.69
608 609 2.400467 AGCTATATCGGAAGTGGGGT 57.600 50.000 0.00 0.00 0.00 4.95
609 610 4.322801 CCTTTAGCTATATCGGAAGTGGGG 60.323 50.000 0.00 0.00 0.00 4.96
610 611 4.322801 CCCTTTAGCTATATCGGAAGTGGG 60.323 50.000 0.00 0.00 0.00 4.61
611 612 4.527038 TCCCTTTAGCTATATCGGAAGTGG 59.473 45.833 0.00 0.00 0.00 4.00
612 613 5.723672 TCCCTTTAGCTATATCGGAAGTG 57.276 43.478 0.00 0.00 0.00 3.16
613 614 6.075984 TCTTCCCTTTAGCTATATCGGAAGT 58.924 40.000 24.14 0.00 43.45 3.01
614 615 6.591750 TCTTCCCTTTAGCTATATCGGAAG 57.408 41.667 21.76 21.76 44.05 3.46
615 616 6.070767 CCATCTTCCCTTTAGCTATATCGGAA 60.071 42.308 0.00 3.81 0.00 4.30
616 617 5.422331 CCATCTTCCCTTTAGCTATATCGGA 59.578 44.000 0.00 0.00 0.00 4.55
617 618 5.187967 ACCATCTTCCCTTTAGCTATATCGG 59.812 44.000 0.00 0.00 0.00 4.18
618 619 6.287589 ACCATCTTCCCTTTAGCTATATCG 57.712 41.667 0.00 0.00 0.00 2.92
619 620 9.825109 GATAACCATCTTCCCTTTAGCTATATC 57.175 37.037 0.00 0.00 0.00 1.63
620 621 9.567702 AGATAACCATCTTCCCTTTAGCTATAT 57.432 33.333 0.00 0.00 38.41 0.86
621 622 8.974292 AGATAACCATCTTCCCTTTAGCTATA 57.026 34.615 0.00 0.00 38.41 1.31
622 623 7.037945 GGAGATAACCATCTTCCCTTTAGCTAT 60.038 40.741 0.00 0.00 41.78 2.97
623 624 6.270231 GGAGATAACCATCTTCCCTTTAGCTA 59.730 42.308 0.00 0.00 41.78 3.32
624 625 5.072464 GGAGATAACCATCTTCCCTTTAGCT 59.928 44.000 0.00 0.00 41.78 3.32
625 626 5.072464 AGGAGATAACCATCTTCCCTTTAGC 59.928 44.000 0.00 0.00 41.78 3.09
626 627 6.755542 AGGAGATAACCATCTTCCCTTTAG 57.244 41.667 0.00 0.00 41.78 1.85
627 628 7.237679 CCATAGGAGATAACCATCTTCCCTTTA 59.762 40.741 0.00 0.00 41.78 1.85
628 629 6.044871 CCATAGGAGATAACCATCTTCCCTTT 59.955 42.308 0.00 0.00 41.78 3.11
629 630 5.549619 CCATAGGAGATAACCATCTTCCCTT 59.450 44.000 0.00 0.00 41.78 3.95
630 631 5.097234 CCATAGGAGATAACCATCTTCCCT 58.903 45.833 0.00 0.00 41.78 4.20
631 632 4.846940 ACCATAGGAGATAACCATCTTCCC 59.153 45.833 0.00 0.00 41.78 3.97
632 633 5.544176 TCACCATAGGAGATAACCATCTTCC 59.456 44.000 0.00 0.00 41.78 3.46
633 634 6.672266 TCACCATAGGAGATAACCATCTTC 57.328 41.667 0.00 0.00 41.78 2.87
634 635 6.789457 TGATCACCATAGGAGATAACCATCTT 59.211 38.462 0.00 0.00 41.78 2.40
635 636 6.326161 TGATCACCATAGGAGATAACCATCT 58.674 40.000 0.00 0.00 44.51 2.90
636 637 6.611613 TGATCACCATAGGAGATAACCATC 57.388 41.667 0.00 0.00 33.39 3.51
637 638 7.072961 ACTTTGATCACCATAGGAGATAACCAT 59.927 37.037 0.00 0.00 33.39 3.55
638 639 6.386927 ACTTTGATCACCATAGGAGATAACCA 59.613 38.462 0.00 0.00 33.39 3.67
639 640 6.831976 ACTTTGATCACCATAGGAGATAACC 58.168 40.000 0.00 0.00 33.39 2.85
640 641 8.738645 AAACTTTGATCACCATAGGAGATAAC 57.261 34.615 0.00 0.00 33.39 1.89
643 644 9.753674 TTTAAAACTTTGATCACCATAGGAGAT 57.246 29.630 0.00 0.00 35.81 2.75
644 645 9.753674 ATTTAAAACTTTGATCACCATAGGAGA 57.246 29.630 0.00 0.00 0.00 3.71
647 648 9.736023 GCTATTTAAAACTTTGATCACCATAGG 57.264 33.333 0.00 0.00 0.00 2.57
648 649 9.438291 CGCTATTTAAAACTTTGATCACCATAG 57.562 33.333 0.00 0.00 0.00 2.23
649 650 7.913297 GCGCTATTTAAAACTTTGATCACCATA 59.087 33.333 0.00 0.00 0.00 2.74
650 651 6.751888 GCGCTATTTAAAACTTTGATCACCAT 59.248 34.615 0.00 0.00 0.00 3.55
651 652 6.090129 GCGCTATTTAAAACTTTGATCACCA 58.910 36.000 0.00 0.00 0.00 4.17
652 653 5.227184 CGCGCTATTTAAAACTTTGATCACC 59.773 40.000 5.56 0.00 0.00 4.02
653 654 5.275280 GCGCGCTATTTAAAACTTTGATCAC 60.275 40.000 26.67 0.00 0.00 3.06
654 655 4.791163 GCGCGCTATTTAAAACTTTGATCA 59.209 37.500 26.67 0.00 0.00 2.92
655 656 5.028375 AGCGCGCTATTTAAAACTTTGATC 58.972 37.500 35.79 0.00 0.00 2.92
656 657 4.981794 AGCGCGCTATTTAAAACTTTGAT 58.018 34.783 35.79 0.63 0.00 2.57
657 658 4.413495 AGCGCGCTATTTAAAACTTTGA 57.587 36.364 35.79 0.00 0.00 2.69
658 659 5.275280 GCTTAGCGCGCTATTTAAAACTTTG 60.275 40.000 38.51 15.49 0.00 2.77
659 660 4.791676 GCTTAGCGCGCTATTTAAAACTTT 59.208 37.500 38.51 13.72 0.00 2.66
660 661 4.142773 TGCTTAGCGCGCTATTTAAAACTT 60.143 37.500 38.51 13.94 43.27 2.66
661 662 3.372822 TGCTTAGCGCGCTATTTAAAACT 59.627 39.130 38.51 14.50 43.27 2.66
662 663 3.676540 TGCTTAGCGCGCTATTTAAAAC 58.323 40.909 38.51 22.00 43.27 2.43
663 664 4.272504 AGATGCTTAGCGCGCTATTTAAAA 59.727 37.500 38.51 24.43 43.27 1.52
664 665 3.807622 AGATGCTTAGCGCGCTATTTAAA 59.192 39.130 38.51 25.16 43.27 1.52
665 666 3.390135 AGATGCTTAGCGCGCTATTTAA 58.610 40.909 38.51 25.53 43.27 1.52
666 667 3.026630 AGATGCTTAGCGCGCTATTTA 57.973 42.857 38.51 26.65 43.27 1.40
667 668 1.871080 AGATGCTTAGCGCGCTATTT 58.129 45.000 38.51 23.54 43.27 1.40
668 669 1.871080 AAGATGCTTAGCGCGCTATT 58.129 45.000 38.51 26.01 43.27 1.73
669 670 2.600731 CTAAGATGCTTAGCGCGCTAT 58.399 47.619 38.51 26.50 43.27 2.97
670 671 1.930817 GCTAAGATGCTTAGCGCGCTA 60.931 52.381 35.48 35.48 43.27 4.26
671 672 1.218230 GCTAAGATGCTTAGCGCGCT 61.218 55.000 38.01 38.01 43.27 5.92
672 673 1.202816 GCTAAGATGCTTAGCGCGC 59.797 57.895 26.66 26.66 43.27 6.86
676 677 1.560860 CCGGCGCTAAGATGCTTAGC 61.561 60.000 22.75 22.75 42.82 3.09
677 678 0.032130 TCCGGCGCTAAGATGCTTAG 59.968 55.000 7.64 9.30 0.00 2.18
678 679 0.249322 GTCCGGCGCTAAGATGCTTA 60.249 55.000 7.64 0.00 0.00 3.09
679 680 1.521681 GTCCGGCGCTAAGATGCTT 60.522 57.895 7.64 0.00 0.00 3.91
680 681 1.961180 AAGTCCGGCGCTAAGATGCT 61.961 55.000 7.64 0.00 0.00 3.79
681 682 1.491505 GAAGTCCGGCGCTAAGATGC 61.492 60.000 7.64 0.00 0.00 3.91
682 683 0.103208 AGAAGTCCGGCGCTAAGATG 59.897 55.000 7.64 0.00 0.00 2.90
683 684 0.824759 AAGAAGTCCGGCGCTAAGAT 59.175 50.000 7.64 0.00 0.00 2.40
684 685 0.606604 AAAGAAGTCCGGCGCTAAGA 59.393 50.000 7.64 0.00 0.00 2.10
685 686 1.000145 GAAAGAAGTCCGGCGCTAAG 59.000 55.000 7.64 0.00 0.00 2.18
686 687 0.319083 TGAAAGAAGTCCGGCGCTAA 59.681 50.000 7.64 0.00 0.00 3.09
687 688 0.319083 TTGAAAGAAGTCCGGCGCTA 59.681 50.000 7.64 0.00 0.00 4.26
688 689 0.534203 TTTGAAAGAAGTCCGGCGCT 60.534 50.000 7.64 0.00 0.00 5.92
689 690 0.521735 ATTTGAAAGAAGTCCGGCGC 59.478 50.000 0.00 0.00 0.00 6.53
690 691 1.729149 GCATTTGAAAGAAGTCCGGCG 60.729 52.381 0.00 0.00 0.00 6.46
691 692 1.541588 AGCATTTGAAAGAAGTCCGGC 59.458 47.619 0.00 0.00 0.00 6.13
692 693 5.277538 GCTATAGCATTTGAAAGAAGTCCGG 60.278 44.000 20.01 0.00 41.59 5.14
693 694 5.557136 CGCTATAGCATTTGAAAGAAGTCCG 60.557 44.000 23.99 0.00 42.21 4.79
694 695 5.294552 ACGCTATAGCATTTGAAAGAAGTCC 59.705 40.000 23.99 0.00 42.21 3.85
695 696 6.188175 CACGCTATAGCATTTGAAAGAAGTC 58.812 40.000 23.99 0.00 42.21 3.01
696 697 5.447818 GCACGCTATAGCATTTGAAAGAAGT 60.448 40.000 23.99 6.60 42.21 3.01
697 698 4.966366 GCACGCTATAGCATTTGAAAGAAG 59.034 41.667 23.99 5.98 42.21 2.85
698 699 4.635765 AGCACGCTATAGCATTTGAAAGAA 59.364 37.500 23.99 0.00 42.21 2.52
699 700 4.191544 AGCACGCTATAGCATTTGAAAGA 58.808 39.130 23.99 0.00 42.21 2.52
700 701 4.542662 AGCACGCTATAGCATTTGAAAG 57.457 40.909 23.99 7.87 42.21 2.62
701 702 7.351414 CTATAGCACGCTATAGCATTTGAAA 57.649 36.000 25.42 9.51 46.26 2.69
702 703 6.951256 CTATAGCACGCTATAGCATTTGAA 57.049 37.500 25.42 9.81 46.26 2.69
711 712 1.400846 GCTCCGCTATAGCACGCTATA 59.599 52.381 23.99 15.99 42.21 1.31
712 713 0.171455 GCTCCGCTATAGCACGCTAT 59.829 55.000 23.99 15.45 42.21 2.97
713 714 0.889638 AGCTCCGCTATAGCACGCTA 60.890 55.000 23.99 0.39 42.62 4.26
714 715 0.889638 TAGCTCCGCTATAGCACGCT 60.890 55.000 25.78 25.78 42.62 5.07
715 716 1.579932 TAGCTCCGCTATAGCACGC 59.420 57.895 23.99 20.26 42.62 5.34
723 724 2.868196 CGCGCTATAGCTCCGCTA 59.132 61.111 21.98 0.00 45.55 4.26
726 727 0.179161 AATAGCGCGCTATAGCTCCG 60.179 55.000 43.81 22.32 43.44 4.63
727 728 1.997669 AAATAGCGCGCTATAGCTCC 58.002 50.000 43.81 10.26 43.44 4.70
728 729 5.511088 TTTTAAATAGCGCGCTATAGCTC 57.489 39.130 43.81 13.77 43.44 4.09
729 730 5.408604 ACATTTTAAATAGCGCGCTATAGCT 59.591 36.000 43.81 33.17 46.53 3.32
730 731 5.618561 ACATTTTAAATAGCGCGCTATAGC 58.381 37.500 43.81 15.09 38.20 2.97
731 732 7.586300 ACAAACATTTTAAATAGCGCGCTATAG 59.414 33.333 43.81 29.40 38.20 1.31
732 733 7.411274 ACAAACATTTTAAATAGCGCGCTATA 58.589 30.769 43.81 31.73 38.20 1.31
733 734 6.262601 ACAAACATTTTAAATAGCGCGCTAT 58.737 32.000 40.32 40.32 40.63 2.97
734 735 5.632959 ACAAACATTTTAAATAGCGCGCTA 58.367 33.333 39.72 39.72 0.00 4.26
735 736 4.481463 ACAAACATTTTAAATAGCGCGCT 58.519 34.783 38.01 38.01 0.00 5.92
736 737 4.816277 ACAAACATTTTAAATAGCGCGC 57.184 36.364 26.66 26.66 0.00 6.86
737 738 6.369326 TGAACAAACATTTTAAATAGCGCG 57.631 33.333 0.00 0.00 0.00 6.86
738 739 7.626815 CGAATGAACAAACATTTTAAATAGCGC 59.373 33.333 0.00 0.00 40.03 5.92
739 740 8.635124 ACGAATGAACAAACATTTTAAATAGCG 58.365 29.630 0.00 0.00 40.03 4.26
743 744 9.928236 CCAAACGAATGAACAAACATTTTAAAT 57.072 25.926 0.00 0.00 40.03 1.40
744 745 9.151471 TCCAAACGAATGAACAAACATTTTAAA 57.849 25.926 0.00 0.00 40.03 1.52
745 746 8.596380 GTCCAAACGAATGAACAAACATTTTAA 58.404 29.630 0.00 0.00 40.03 1.52
746 747 7.222999 GGTCCAAACGAATGAACAAACATTTTA 59.777 33.333 0.00 0.00 40.03 1.52
747 748 6.036626 GGTCCAAACGAATGAACAAACATTTT 59.963 34.615 0.00 0.00 40.03 1.82
748 749 5.522097 GGTCCAAACGAATGAACAAACATTT 59.478 36.000 0.00 0.00 40.03 2.32
749 750 5.047188 GGTCCAAACGAATGAACAAACATT 58.953 37.500 0.00 0.00 42.19 2.71
750 751 4.098654 TGGTCCAAACGAATGAACAAACAT 59.901 37.500 0.00 0.00 0.00 2.71
751 752 3.444034 TGGTCCAAACGAATGAACAAACA 59.556 39.130 0.00 0.00 0.00 2.83
752 753 4.035278 TGGTCCAAACGAATGAACAAAC 57.965 40.909 0.00 0.00 0.00 2.93
753 754 4.720649 TTGGTCCAAACGAATGAACAAA 57.279 36.364 0.40 0.00 33.06 2.83
754 755 4.927978 ATTGGTCCAAACGAATGAACAA 57.072 36.364 8.75 0.00 39.77 2.83
760 761 4.021102 AGAGACATTGGTCCAAACGAAT 57.979 40.909 8.75 0.00 45.48 3.34
761 762 3.485463 AGAGACATTGGTCCAAACGAA 57.515 42.857 8.75 0.00 45.48 3.85
762 763 3.485463 AAGAGACATTGGTCCAAACGA 57.515 42.857 8.75 0.00 45.48 3.85
763 764 3.125316 GCTAAGAGACATTGGTCCAAACG 59.875 47.826 8.75 5.63 45.48 3.60
764 765 3.125316 CGCTAAGAGACATTGGTCCAAAC 59.875 47.826 8.75 3.71 45.48 2.93
765 766 3.334691 CGCTAAGAGACATTGGTCCAAA 58.665 45.455 8.75 0.00 45.48 3.28
766 767 2.935238 GCGCTAAGAGACATTGGTCCAA 60.935 50.000 6.80 6.80 45.48 3.53
767 768 1.405526 GCGCTAAGAGACATTGGTCCA 60.406 52.381 0.00 0.00 45.48 4.02
768 769 1.291132 GCGCTAAGAGACATTGGTCC 58.709 55.000 0.00 0.00 45.48 4.46
769 770 2.010145 TGCGCTAAGAGACATTGGTC 57.990 50.000 9.73 0.00 44.66 4.02
770 771 2.028112 TCTTGCGCTAAGAGACATTGGT 60.028 45.455 9.73 0.00 40.43 3.67
771 772 2.349886 GTCTTGCGCTAAGAGACATTGG 59.650 50.000 18.44 0.00 45.71 3.16
772 773 2.349886 GGTCTTGCGCTAAGAGACATTG 59.650 50.000 24.20 0.79 45.71 2.82
773 774 2.234908 AGGTCTTGCGCTAAGAGACATT 59.765 45.455 24.20 14.78 45.71 2.71
774 775 1.827969 AGGTCTTGCGCTAAGAGACAT 59.172 47.619 24.20 18.84 45.71 3.06
775 776 1.257743 AGGTCTTGCGCTAAGAGACA 58.742 50.000 24.20 5.74 45.71 3.41
776 777 2.371910 AAGGTCTTGCGCTAAGAGAC 57.628 50.000 18.44 18.59 45.71 3.36
777 778 3.067106 CAAAAGGTCTTGCGCTAAGAGA 58.933 45.455 18.44 9.99 45.71 3.10
778 779 2.808543 ACAAAAGGTCTTGCGCTAAGAG 59.191 45.455 18.44 10.73 45.71 2.85
779 780 2.846193 ACAAAAGGTCTTGCGCTAAGA 58.154 42.857 9.73 13.31 43.01 2.10
780 781 4.742438 TTACAAAAGGTCTTGCGCTAAG 57.258 40.909 9.73 11.02 37.76 2.18
781 782 4.553156 CGTTTACAAAAGGTCTTGCGCTAA 60.553 41.667 9.73 0.00 0.00 3.09
782 783 3.059461 CGTTTACAAAAGGTCTTGCGCTA 60.059 43.478 9.73 0.00 0.00 4.26
783 784 2.286772 CGTTTACAAAAGGTCTTGCGCT 60.287 45.455 9.73 0.00 0.00 5.92
784 785 2.041244 CGTTTACAAAAGGTCTTGCGC 58.959 47.619 0.00 0.00 0.00 6.09
785 786 3.328237 ACGTTTACAAAAGGTCTTGCG 57.672 42.857 0.00 0.00 0.00 4.85
786 787 4.417506 ACAACGTTTACAAAAGGTCTTGC 58.582 39.130 0.00 0.00 0.00 4.01
787 788 5.679792 GCTACAACGTTTACAAAAGGTCTTG 59.320 40.000 0.00 0.00 0.00 3.02
788 789 5.502869 CGCTACAACGTTTACAAAAGGTCTT 60.503 40.000 0.00 0.00 0.00 3.01
789 790 4.025480 CGCTACAACGTTTACAAAAGGTCT 60.025 41.667 0.00 0.00 0.00 3.85
790 791 4.206088 CGCTACAACGTTTACAAAAGGTC 58.794 43.478 0.00 0.00 0.00 3.85
791 792 3.622612 ACGCTACAACGTTTACAAAAGGT 59.377 39.130 0.00 0.00 45.75 3.50
792 793 3.963724 CACGCTACAACGTTTACAAAAGG 59.036 43.478 0.00 0.00 45.75 3.11
793 794 3.416352 GCACGCTACAACGTTTACAAAAG 59.584 43.478 0.00 0.00 45.75 2.27
794 795 3.063725 AGCACGCTACAACGTTTACAAAA 59.936 39.130 0.00 0.00 45.75 2.44
795 796 2.608546 AGCACGCTACAACGTTTACAAA 59.391 40.909 0.00 0.00 45.75 2.83
796 797 2.203401 AGCACGCTACAACGTTTACAA 58.797 42.857 0.00 0.00 45.75 2.41
797 798 1.855513 AGCACGCTACAACGTTTACA 58.144 45.000 0.00 0.00 45.75 2.41
798 799 4.316930 GCTATAGCACGCTACAACGTTTAC 60.317 45.833 20.01 0.00 45.75 2.01
799 800 3.792956 GCTATAGCACGCTACAACGTTTA 59.207 43.478 20.01 0.00 45.75 2.01
800 801 2.601763 GCTATAGCACGCTACAACGTTT 59.398 45.455 20.01 0.00 45.75 3.60
801 802 2.190981 GCTATAGCACGCTACAACGTT 58.809 47.619 20.01 0.00 45.75 3.99
803 804 0.770590 CGCTATAGCACGCTACAACG 59.229 55.000 23.99 1.83 42.21 4.10
804 805 1.129326 CCGCTATAGCACGCTACAAC 58.871 55.000 23.99 0.00 42.21 3.32
805 806 1.001706 CTCCGCTATAGCACGCTACAA 60.002 52.381 23.99 0.00 42.21 2.41
806 807 0.591659 CTCCGCTATAGCACGCTACA 59.408 55.000 23.99 0.00 42.21 2.74
807 808 0.729816 GCTCCGCTATAGCACGCTAC 60.730 60.000 23.99 4.81 42.21 3.58
808 809 0.889638 AGCTCCGCTATAGCACGCTA 60.890 55.000 23.99 0.39 42.62 4.26
809 810 0.889638 TAGCTCCGCTATAGCACGCT 60.890 55.000 25.78 25.78 42.62 5.07
810 811 1.579932 TAGCTCCGCTATAGCACGC 59.420 57.895 23.99 20.26 42.62 5.34
818 819 2.341101 GCCCGCTATAGCTCCGCTA 61.341 63.158 21.98 0.00 45.55 4.26
819 820 2.766306 TAGCCCGCTATAGCTCCGCT 62.766 60.000 24.41 24.41 43.41 5.52
820 821 1.668101 ATAGCCCGCTATAGCTCCGC 61.668 60.000 21.98 18.46 40.56 5.54
821 822 0.818296 AATAGCCCGCTATAGCTCCG 59.182 55.000 21.98 10.15 40.56 4.63
822 823 2.233922 TCAAATAGCCCGCTATAGCTCC 59.766 50.000 21.98 10.06 40.56 4.70
823 824 3.594603 TCAAATAGCCCGCTATAGCTC 57.405 47.619 21.98 11.04 40.56 4.09
824 825 4.065789 GTTTCAAATAGCCCGCTATAGCT 58.934 43.478 21.98 6.31 43.20 3.32
825 826 3.813166 TGTTTCAAATAGCCCGCTATAGC 59.187 43.478 15.09 15.09 38.20 2.97
826 827 5.050091 CACTGTTTCAAATAGCCCGCTATAG 60.050 44.000 9.56 6.26 38.20 1.31
827 828 4.814234 CACTGTTTCAAATAGCCCGCTATA 59.186 41.667 9.56 0.00 38.20 1.31
828 829 3.627577 CACTGTTTCAAATAGCCCGCTAT 59.372 43.478 3.31 3.31 40.63 2.97
829 830 3.006940 CACTGTTTCAAATAGCCCGCTA 58.993 45.455 0.00 0.00 0.00 4.26
830 831 1.812571 CACTGTTTCAAATAGCCCGCT 59.187 47.619 0.00 0.00 0.00 5.52
831 832 1.810151 TCACTGTTTCAAATAGCCCGC 59.190 47.619 0.00 0.00 0.00 6.13
832 833 3.181497 CCATCACTGTTTCAAATAGCCCG 60.181 47.826 0.00 0.00 0.00 6.13
833 834 3.763897 ACCATCACTGTTTCAAATAGCCC 59.236 43.478 0.00 0.00 0.00 5.19
834 835 4.458989 TCACCATCACTGTTTCAAATAGCC 59.541 41.667 0.00 0.00 0.00 3.93
835 836 5.627499 TCACCATCACTGTTTCAAATAGC 57.373 39.130 0.00 0.00 0.00 2.97
836 837 7.621428 AGATCACCATCACTGTTTCAAATAG 57.379 36.000 0.00 0.00 0.00 1.73
837 838 9.513906 TTTAGATCACCATCACTGTTTCAAATA 57.486 29.630 0.00 0.00 0.00 1.40
838 839 8.408043 TTTAGATCACCATCACTGTTTCAAAT 57.592 30.769 0.00 0.00 0.00 2.32
839 840 7.719193 TCTTTAGATCACCATCACTGTTTCAAA 59.281 33.333 0.00 0.00 0.00 2.69
840 841 7.223584 TCTTTAGATCACCATCACTGTTTCAA 58.776 34.615 0.00 0.00 0.00 2.69
841 842 6.768483 TCTTTAGATCACCATCACTGTTTCA 58.232 36.000 0.00 0.00 0.00 2.69
842 843 7.173218 TGTTCTTTAGATCACCATCACTGTTTC 59.827 37.037 0.00 0.00 0.00 2.78
843 844 6.998074 TGTTCTTTAGATCACCATCACTGTTT 59.002 34.615 0.00 0.00 0.00 2.83
844 845 6.533730 TGTTCTTTAGATCACCATCACTGTT 58.466 36.000 0.00 0.00 0.00 3.16
845 846 6.114187 TGTTCTTTAGATCACCATCACTGT 57.886 37.500 0.00 0.00 0.00 3.55
846 847 5.583854 CCTGTTCTTTAGATCACCATCACTG 59.416 44.000 0.00 0.00 0.00 3.66
847 848 5.485353 TCCTGTTCTTTAGATCACCATCACT 59.515 40.000 0.00 0.00 0.00 3.41
848 849 5.734720 TCCTGTTCTTTAGATCACCATCAC 58.265 41.667 0.00 0.00 0.00 3.06
849 850 6.213397 TCTTCCTGTTCTTTAGATCACCATCA 59.787 38.462 0.00 0.00 0.00 3.07
850 851 6.644347 TCTTCCTGTTCTTTAGATCACCATC 58.356 40.000 0.00 0.00 0.00 3.51
851 852 6.627087 TCTTCCTGTTCTTTAGATCACCAT 57.373 37.500 0.00 0.00 0.00 3.55
852 853 6.043243 ACTTCTTCCTGTTCTTTAGATCACCA 59.957 38.462 0.00 0.00 0.00 4.17
853 854 6.468543 ACTTCTTCCTGTTCTTTAGATCACC 58.531 40.000 0.00 0.00 0.00 4.02
854 855 7.330700 CAGACTTCTTCCTGTTCTTTAGATCAC 59.669 40.741 0.00 0.00 0.00 3.06
855 856 7.233553 TCAGACTTCTTCCTGTTCTTTAGATCA 59.766 37.037 0.00 0.00 0.00 2.92
856 857 7.607250 TCAGACTTCTTCCTGTTCTTTAGATC 58.393 38.462 0.00 0.00 0.00 2.75
857 858 7.546250 TCAGACTTCTTCCTGTTCTTTAGAT 57.454 36.000 0.00 0.00 0.00 1.98
858 859 6.978674 TCAGACTTCTTCCTGTTCTTTAGA 57.021 37.500 0.00 0.00 0.00 2.10
859 860 6.091986 GCATCAGACTTCTTCCTGTTCTTTAG 59.908 42.308 0.00 0.00 0.00 1.85
860 861 5.934625 GCATCAGACTTCTTCCTGTTCTTTA 59.065 40.000 0.00 0.00 0.00 1.85
861 862 4.759183 GCATCAGACTTCTTCCTGTTCTTT 59.241 41.667 0.00 0.00 0.00 2.52
862 863 4.202398 TGCATCAGACTTCTTCCTGTTCTT 60.202 41.667 0.00 0.00 0.00 2.52
863 864 3.326006 TGCATCAGACTTCTTCCTGTTCT 59.674 43.478 0.00 0.00 0.00 3.01
864 865 3.668447 TGCATCAGACTTCTTCCTGTTC 58.332 45.455 0.00 0.00 0.00 3.18
865 866 3.777106 TGCATCAGACTTCTTCCTGTT 57.223 42.857 0.00 0.00 0.00 3.16
866 867 3.181451 TGTTGCATCAGACTTCTTCCTGT 60.181 43.478 0.00 0.00 0.00 4.00
867 868 3.405831 TGTTGCATCAGACTTCTTCCTG 58.594 45.455 0.00 0.00 0.00 3.86
868 869 3.672808 CTGTTGCATCAGACTTCTTCCT 58.327 45.455 18.19 0.00 37.61 3.36
869 870 2.161211 GCTGTTGCATCAGACTTCTTCC 59.839 50.000 25.50 4.36 37.61 3.46
870 871 2.159734 CGCTGTTGCATCAGACTTCTTC 60.160 50.000 25.50 7.43 39.64 2.87
871 872 1.802960 CGCTGTTGCATCAGACTTCTT 59.197 47.619 25.50 0.00 39.64 2.52
872 873 1.436600 CGCTGTTGCATCAGACTTCT 58.563 50.000 25.50 0.00 39.64 2.85
873 874 0.445436 CCGCTGTTGCATCAGACTTC 59.555 55.000 25.50 9.02 39.64 3.01
874 875 1.580845 GCCGCTGTTGCATCAGACTT 61.581 55.000 25.50 0.00 39.64 3.01
875 876 2.037136 GCCGCTGTTGCATCAGACT 61.037 57.895 25.50 0.00 39.64 3.24
876 877 1.855213 TTGCCGCTGTTGCATCAGAC 61.855 55.000 25.50 16.04 38.76 3.51
877 878 1.171549 TTTGCCGCTGTTGCATCAGA 61.172 50.000 25.50 4.58 38.76 3.27
878 879 1.005294 GTTTGCCGCTGTTGCATCAG 61.005 55.000 18.61 18.61 38.76 2.90
879 880 1.007502 GTTTGCCGCTGTTGCATCA 60.008 52.632 0.00 0.00 38.76 3.07
880 881 1.005294 CAGTTTGCCGCTGTTGCATC 61.005 55.000 0.00 0.00 38.76 3.91
881 882 1.007038 CAGTTTGCCGCTGTTGCAT 60.007 52.632 0.00 0.00 38.76 3.96
882 883 2.412525 CAGTTTGCCGCTGTTGCA 59.587 55.556 0.00 0.00 39.64 4.08
883 884 3.032033 GCAGTTTGCCGCTGTTGC 61.032 61.111 0.00 0.00 37.42 4.17
884 885 1.659335 CTGCAGTTTGCCGCTGTTG 60.659 57.895 5.25 0.00 44.23 3.33
885 886 2.063541 GACTGCAGTTTGCCGCTGTT 62.064 55.000 22.65 0.00 44.23 3.16
886 887 2.516930 ACTGCAGTTTGCCGCTGT 60.517 55.556 15.25 0.00 44.23 4.40
887 888 2.253452 GACTGCAGTTTGCCGCTG 59.747 61.111 22.65 0.00 44.23 5.18
888 889 3.349006 CGACTGCAGTTTGCCGCT 61.349 61.111 22.65 0.00 44.23 5.52
889 890 2.892334 TTCGACTGCAGTTTGCCGC 61.892 57.895 22.65 5.81 44.23 6.53
890 891 1.082756 GTTCGACTGCAGTTTGCCG 60.083 57.895 22.65 19.38 44.23 5.69
891 892 0.235926 GAGTTCGACTGCAGTTTGCC 59.764 55.000 22.65 7.03 44.23 4.52
892 893 0.235926 GGAGTTCGACTGCAGTTTGC 59.764 55.000 22.65 11.70 45.29 3.68
893 894 1.581934 TGGAGTTCGACTGCAGTTTG 58.418 50.000 22.65 16.76 41.73 2.93
898 899 1.290324 GCTCTGGAGTTCGACTGCA 59.710 57.895 8.43 8.43 44.42 4.41
899 900 1.803519 CGCTCTGGAGTTCGACTGC 60.804 63.158 0.00 0.00 37.06 4.40
900 901 1.803519 GCGCTCTGGAGTTCGACTG 60.804 63.158 0.00 0.00 0.00 3.51
901 902 1.974343 AGCGCTCTGGAGTTCGACT 60.974 57.895 2.64 0.00 0.00 4.18
902 903 1.803519 CAGCGCTCTGGAGTTCGAC 60.804 63.158 7.13 0.00 36.68 4.20
903 904 2.568612 CAGCGCTCTGGAGTTCGA 59.431 61.111 7.13 0.00 36.68 3.71
911 912 3.497932 GCTTGCTCCAGCGCTCTG 61.498 66.667 7.13 0.92 45.83 3.35
912 913 4.774503 GGCTTGCTCCAGCGCTCT 62.775 66.667 7.13 0.00 45.83 4.09
918 919 4.845580 ATCGGCGGCTTGCTCCAG 62.846 66.667 7.21 0.00 45.43 3.86
931 932 4.418328 TTTCGCCCACCCCATCGG 62.418 66.667 0.00 0.00 37.81 4.18
932 933 3.131478 GTTTCGCCCACCCCATCG 61.131 66.667 0.00 0.00 0.00 3.84
933 934 1.749258 GAGTTTCGCCCACCCCATC 60.749 63.158 0.00 0.00 0.00 3.51
934 935 2.075355 TTGAGTTTCGCCCACCCCAT 62.075 55.000 0.00 0.00 0.00 4.00
935 936 2.075355 ATTGAGTTTCGCCCACCCCA 62.075 55.000 0.00 0.00 0.00 4.96
936 937 1.304134 ATTGAGTTTCGCCCACCCC 60.304 57.895 0.00 0.00 0.00 4.95
937 938 0.893727 ACATTGAGTTTCGCCCACCC 60.894 55.000 0.00 0.00 0.00 4.61
938 939 1.737793 CTACATTGAGTTTCGCCCACC 59.262 52.381 0.00 0.00 0.00 4.61
939 940 2.415512 GTCTACATTGAGTTTCGCCCAC 59.584 50.000 0.00 0.00 0.00 4.61
940 941 2.695359 GTCTACATTGAGTTTCGCCCA 58.305 47.619 0.00 0.00 0.00 5.36
941 942 1.659098 CGTCTACATTGAGTTTCGCCC 59.341 52.381 0.00 0.00 0.00 6.13
942 943 1.659098 CCGTCTACATTGAGTTTCGCC 59.341 52.381 0.00 0.00 0.00 5.54
943 944 2.599082 CTCCGTCTACATTGAGTTTCGC 59.401 50.000 0.00 0.00 0.00 4.70
944 945 2.599082 GCTCCGTCTACATTGAGTTTCG 59.401 50.000 0.00 0.00 0.00 3.46
945 946 3.851098 AGCTCCGTCTACATTGAGTTTC 58.149 45.455 0.00 0.00 0.00 2.78
946 947 3.963428 AGCTCCGTCTACATTGAGTTT 57.037 42.857 0.00 0.00 0.00 2.66
947 948 3.589988 CAAGCTCCGTCTACATTGAGTT 58.410 45.455 0.00 0.00 0.00 3.01
948 949 2.093973 CCAAGCTCCGTCTACATTGAGT 60.094 50.000 0.00 0.00 0.00 3.41
949 950 2.544685 CCAAGCTCCGTCTACATTGAG 58.455 52.381 0.00 0.00 0.00 3.02
950 951 1.405526 GCCAAGCTCCGTCTACATTGA 60.406 52.381 0.00 0.00 0.00 2.57
951 952 1.009829 GCCAAGCTCCGTCTACATTG 58.990 55.000 0.00 0.00 0.00 2.82
952 953 0.460284 CGCCAAGCTCCGTCTACATT 60.460 55.000 0.00 0.00 0.00 2.71
953 954 1.141881 CGCCAAGCTCCGTCTACAT 59.858 57.895 0.00 0.00 0.00 2.29
954 955 1.934220 CTCGCCAAGCTCCGTCTACA 61.934 60.000 0.00 0.00 0.00 2.74
955 956 1.226717 CTCGCCAAGCTCCGTCTAC 60.227 63.158 0.00 0.00 0.00 2.59
956 957 0.963856 TTCTCGCCAAGCTCCGTCTA 60.964 55.000 0.00 0.00 0.00 2.59
957 958 2.219325 CTTCTCGCCAAGCTCCGTCT 62.219 60.000 0.00 0.00 0.00 4.18
958 959 1.807573 CTTCTCGCCAAGCTCCGTC 60.808 63.158 0.00 0.00 0.00 4.79
959 960 1.816863 TTCTTCTCGCCAAGCTCCGT 61.817 55.000 0.00 0.00 0.00 4.69
960 961 1.079819 TTCTTCTCGCCAAGCTCCG 60.080 57.895 0.00 0.00 0.00 4.63
961 962 0.247736 TCTTCTTCTCGCCAAGCTCC 59.752 55.000 0.00 0.00 0.00 4.70
962 963 1.355005 GTCTTCTTCTCGCCAAGCTC 58.645 55.000 0.00 0.00 0.00 4.09
963 964 0.389166 CGTCTTCTTCTCGCCAAGCT 60.389 55.000 0.00 0.00 0.00 3.74
964 965 1.355066 CCGTCTTCTTCTCGCCAAGC 61.355 60.000 0.00 0.00 0.00 4.01
965 966 1.355066 GCCGTCTTCTTCTCGCCAAG 61.355 60.000 0.00 0.00 0.00 3.61
966 967 1.374252 GCCGTCTTCTTCTCGCCAA 60.374 57.895 0.00 0.00 0.00 4.52
967 968 2.261671 GCCGTCTTCTTCTCGCCA 59.738 61.111 0.00 0.00 0.00 5.69
968 969 2.095252 GTGCCGTCTTCTTCTCGCC 61.095 63.158 0.00 0.00 0.00 5.54
969 970 2.437343 CGTGCCGTCTTCTTCTCGC 61.437 63.158 0.00 0.00 0.00 5.03
970 971 1.801913 CCGTGCCGTCTTCTTCTCG 60.802 63.158 0.00 0.00 0.00 4.04
971 972 1.446272 CCCGTGCCGTCTTCTTCTC 60.446 63.158 0.00 0.00 0.00 2.87
972 973 1.878656 CTCCCGTGCCGTCTTCTTCT 61.879 60.000 0.00 0.00 0.00 2.85
973 974 1.446272 CTCCCGTGCCGTCTTCTTC 60.446 63.158 0.00 0.00 0.00 2.87
974 975 2.657237 CTCCCGTGCCGTCTTCTT 59.343 61.111 0.00 0.00 0.00 2.52
975 976 3.382832 CCTCCCGTGCCGTCTTCT 61.383 66.667 0.00 0.00 0.00 2.85
976 977 3.358076 CTCCTCCCGTGCCGTCTTC 62.358 68.421 0.00 0.00 0.00 2.87
977 978 3.382832 CTCCTCCCGTGCCGTCTT 61.383 66.667 0.00 0.00 0.00 3.01
984 985 3.470888 ATTCCGGCTCCTCCCGTG 61.471 66.667 0.00 0.00 46.71 4.94
985 986 3.470888 CATTCCGGCTCCTCCCGT 61.471 66.667 0.00 0.00 46.71 5.28
987 988 0.321996 GTATCATTCCGGCTCCTCCC 59.678 60.000 0.00 0.00 0.00 4.30
988 989 1.001406 CAGTATCATTCCGGCTCCTCC 59.999 57.143 0.00 0.00 0.00 4.30
989 990 1.606737 GCAGTATCATTCCGGCTCCTC 60.607 57.143 0.00 0.00 0.00 3.71
990 991 0.394565 GCAGTATCATTCCGGCTCCT 59.605 55.000 0.00 0.00 0.00 3.69
991 992 0.946221 CGCAGTATCATTCCGGCTCC 60.946 60.000 0.00 0.00 0.00 4.70
992 993 0.032130 TCGCAGTATCATTCCGGCTC 59.968 55.000 0.00 0.00 0.00 4.70
993 994 0.032678 CTCGCAGTATCATTCCGGCT 59.967 55.000 0.00 0.00 0.00 5.52
994 995 0.032130 TCTCGCAGTATCATTCCGGC 59.968 55.000 0.00 0.00 0.00 6.13
995 996 1.603172 GGTCTCGCAGTATCATTCCGG 60.603 57.143 0.00 0.00 0.00 5.14
996 997 1.067060 TGGTCTCGCAGTATCATTCCG 59.933 52.381 0.00 0.00 0.00 4.30
997 998 2.890808 TGGTCTCGCAGTATCATTCC 57.109 50.000 0.00 0.00 0.00 3.01
998 999 3.982475 TCATGGTCTCGCAGTATCATTC 58.018 45.455 0.00 0.00 0.00 2.67
999 1000 4.375272 CTTCATGGTCTCGCAGTATCATT 58.625 43.478 0.00 0.00 0.00 2.57
1000 1001 3.244009 CCTTCATGGTCTCGCAGTATCAT 60.244 47.826 0.00 0.00 0.00 2.45
1001 1002 2.101415 CCTTCATGGTCTCGCAGTATCA 59.899 50.000 0.00 0.00 0.00 2.15
1002 1003 2.546795 CCCTTCATGGTCTCGCAGTATC 60.547 54.545 0.00 0.00 0.00 2.24
1003 1004 1.414181 CCCTTCATGGTCTCGCAGTAT 59.586 52.381 0.00 0.00 0.00 2.12
1004 1005 0.824109 CCCTTCATGGTCTCGCAGTA 59.176 55.000 0.00 0.00 0.00 2.74
1005 1006 1.599047 CCCTTCATGGTCTCGCAGT 59.401 57.895 0.00 0.00 0.00 4.40
1006 1007 1.153289 CCCCTTCATGGTCTCGCAG 60.153 63.158 0.00 0.00 0.00 5.18
1007 1008 2.989639 CCCCTTCATGGTCTCGCA 59.010 61.111 0.00 0.00 0.00 5.10
1008 1009 2.514824 GCCCCTTCATGGTCTCGC 60.515 66.667 0.00 0.00 0.00 5.03
1009 1010 2.202932 CGCCCCTTCATGGTCTCG 60.203 66.667 0.00 0.00 0.00 4.04
1010 1011 2.190578 CCGCCCCTTCATGGTCTC 59.809 66.667 0.00 0.00 0.00 3.36
1011 1012 2.610859 ACCGCCCCTTCATGGTCT 60.611 61.111 0.00 0.00 0.00 3.85
1012 1013 2.124695 GACCGCCCCTTCATGGTC 60.125 66.667 0.00 0.00 43.60 4.02
1013 1014 1.863155 AATGACCGCCCCTTCATGGT 61.863 55.000 0.00 0.00 37.44 3.55
1014 1015 0.684153 AAATGACCGCCCCTTCATGG 60.684 55.000 0.00 0.00 32.63 3.66
1015 1016 1.185315 AAAATGACCGCCCCTTCATG 58.815 50.000 0.00 0.00 32.63 3.07
1016 1017 1.550072 CAAAAATGACCGCCCCTTCAT 59.450 47.619 0.00 0.00 33.74 2.57
1017 1018 0.965439 CAAAAATGACCGCCCCTTCA 59.035 50.000 0.00 0.00 0.00 3.02
1018 1019 0.389817 GCAAAAATGACCGCCCCTTC 60.390 55.000 0.00 0.00 0.00 3.46
1019 1020 1.671166 GCAAAAATGACCGCCCCTT 59.329 52.632 0.00 0.00 0.00 3.95
1020 1021 2.282783 GGCAAAAATGACCGCCCCT 61.283 57.895 0.00 0.00 38.67 4.79
1021 1022 2.225791 GAGGCAAAAATGACCGCCCC 62.226 60.000 0.00 0.00 46.08 5.80
1022 1023 1.215382 GAGGCAAAAATGACCGCCC 59.785 57.895 0.00 0.00 46.08 6.13
1023 1024 1.215382 GGAGGCAAAAATGACCGCC 59.785 57.895 0.00 0.00 45.23 6.13
1024 1025 0.109132 CAGGAGGCAAAAATGACCGC 60.109 55.000 0.00 0.00 0.00 5.68
1025 1026 0.109132 GCAGGAGGCAAAAATGACCG 60.109 55.000 0.00 0.00 43.97 4.79
1026 1027 3.820595 GCAGGAGGCAAAAATGACC 57.179 52.632 0.00 0.00 43.97 4.02
1036 1037 2.514824 GATGAACCGGCAGGAGGC 60.515 66.667 10.86 0.00 41.02 4.70
1037 1038 2.190578 GGATGAACCGGCAGGAGG 59.809 66.667 10.86 0.00 41.02 4.30
1038 1039 1.026718 GTTGGATGAACCGGCAGGAG 61.027 60.000 10.86 0.00 42.61 3.69
1039 1040 1.002624 GTTGGATGAACCGGCAGGA 60.003 57.895 10.86 0.00 42.61 3.86
1040 1041 2.398554 CGTTGGATGAACCGGCAGG 61.399 63.158 0.00 0.00 42.61 4.85
1041 1042 3.039202 GCGTTGGATGAACCGGCAG 62.039 63.158 0.00 0.00 42.61 4.85
1042 1043 3.053291 GCGTTGGATGAACCGGCA 61.053 61.111 0.00 0.00 42.61 5.69
1043 1044 2.746277 AGCGTTGGATGAACCGGC 60.746 61.111 0.00 0.00 42.61 6.13
1044 1045 3.039202 GCAGCGTTGGATGAACCGG 62.039 63.158 0.00 0.00 42.61 5.28
1045 1046 2.324330 TGCAGCGTTGGATGAACCG 61.324 57.895 0.16 0.00 42.61 4.44
1046 1047 1.210155 GTGCAGCGTTGGATGAACC 59.790 57.895 0.16 0.00 31.62 3.62
1047 1048