Multiple sequence alignment - TraesCS5D01G009600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009600 chr5D 100.000 2129 0 0 1 2129 6207234 6205106 0.000000e+00 3932.0
1 TraesCS5D01G009600 chr5D 98.287 1635 21 4 1 1631 554200412 554198781 0.000000e+00 2857.0
2 TraesCS5D01G009600 chr1D 98.638 2130 27 2 1 2129 483922369 483920241 0.000000e+00 3771.0
3 TraesCS5D01G009600 chr1D 98.604 1862 21 2 1 1857 394179503 394181364 0.000000e+00 3290.0
4 TraesCS5D01G009600 chr1D 95.100 1796 79 6 1 1795 244444637 244446424 0.000000e+00 2820.0
5 TraesCS5D01G009600 chrUn 98.635 2125 26 1 1 2122 317472600 317470476 0.000000e+00 3760.0
6 TraesCS5D01G009600 chr3B 97.981 2130 41 2 1 2129 201507166 201509294 0.000000e+00 3694.0
7 TraesCS5D01G009600 chr2D 96.370 2149 45 5 11 2129 334226515 334228660 0.000000e+00 3506.0
8 TraesCS5D01G009600 chr2D 99.110 337 2 1 1 336 628286262 628286598 2.340000e-169 604.0
9 TraesCS5D01G009600 chr2D 96.954 197 3 1 1909 2105 407860653 407860846 5.660000e-86 327.0
10 TraesCS5D01G009600 chr2D 87.607 234 4 3 1847 2080 49802773 49802565 4.540000e-62 248.0
11 TraesCS5D01G009600 chr2D 100.000 94 0 0 1813 1906 624562247 624562340 7.810000e-40 174.0
12 TraesCS5D01G009600 chr6D 98.470 1634 22 2 1 1631 431400614 431402247 0.000000e+00 2876.0
13 TraesCS5D01G009600 chr6D 98.290 1579 24 2 199 1775 431403693 431405270 0.000000e+00 2763.0
14 TraesCS5D01G009600 chr2B 97.674 344 8 0 1786 2129 616580632 616580975 1.820000e-165 592.0
15 TraesCS5D01G009600 chr2B 96.491 114 4 0 1919 2032 171456012 171456125 2.790000e-44 189.0
16 TraesCS5D01G009600 chr2B 98.276 58 1 0 1764 1821 110647651 110647708 3.740000e-18 102.0
17 TraesCS5D01G009600 chr2B 100.000 33 0 0 1874 1906 171455982 171456014 6.340000e-06 62.1
18 TraesCS5D01G009600 chr7A 99.187 123 1 0 1975 2097 252993471 252993593 2.750000e-54 222.0
19 TraesCS5D01G009600 chr7A 98.305 59 1 0 2069 2127 582582441 582582499 1.040000e-18 104.0
20 TraesCS5D01G009600 chr7A 100.000 32 0 0 2096 2127 357646856 357646825 2.280000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009600 chr5D 6205106 6207234 2128 True 3932.0 3932 100.000 1 2129 1 chr5D.!!$R1 2128
1 TraesCS5D01G009600 chr5D 554198781 554200412 1631 True 2857.0 2857 98.287 1 1631 1 chr5D.!!$R2 1630
2 TraesCS5D01G009600 chr1D 483920241 483922369 2128 True 3771.0 3771 98.638 1 2129 1 chr1D.!!$R1 2128
3 TraesCS5D01G009600 chr1D 394179503 394181364 1861 False 3290.0 3290 98.604 1 1857 1 chr1D.!!$F2 1856
4 TraesCS5D01G009600 chr1D 244444637 244446424 1787 False 2820.0 2820 95.100 1 1795 1 chr1D.!!$F1 1794
5 TraesCS5D01G009600 chrUn 317470476 317472600 2124 True 3760.0 3760 98.635 1 2122 1 chrUn.!!$R1 2121
6 TraesCS5D01G009600 chr3B 201507166 201509294 2128 False 3694.0 3694 97.981 1 2129 1 chr3B.!!$F1 2128
7 TraesCS5D01G009600 chr2D 334226515 334228660 2145 False 3506.0 3506 96.370 11 2129 1 chr2D.!!$F1 2118
8 TraesCS5D01G009600 chr6D 431400614 431405270 4656 False 2819.5 2876 98.380 1 1775 2 chr6D.!!$F1 1774

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
266 3150 0.545309 TTGACCTCCTCCAGACCAGG 60.545 60.0 0.0 0.0 0.0 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1556 4449 1.631405 TGGCCATGAACCTCCTTTTG 58.369 50.0 0.0 0.0 0.0 2.44 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 7.521871 TTTAGGGATAGATCGTACCTCTTTC 57.478 40.000 8.07 1.30 32.87 2.62
266 3150 0.545309 TTGACCTCCTCCAGACCAGG 60.545 60.000 0.00 0.00 0.00 4.45
364 3249 1.596727 GAATCACGCTCTGCAGGATTC 59.403 52.381 19.95 19.95 37.68 2.52
420 3305 4.077108 TCTACCGAACTGAACTAAGAGCA 58.923 43.478 0.00 0.00 0.00 4.26
913 3799 8.638629 TTTTTAGGGATAGGAAAATTTCGTCA 57.361 30.769 4.07 0.00 0.00 4.35
1238 4127 8.150296 GGAAAAAGAAAGAAAAGATGGATTGGA 58.850 33.333 0.00 0.00 0.00 3.53
1616 4509 8.755977 AGAATCAGAGTTATTTTGGAATGCATT 58.244 29.630 12.83 12.83 0.00 3.56
1754 4649 2.130395 CGCAAGCATACGACTCATCAT 58.870 47.619 0.00 0.00 0.00 2.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
266 3150 4.772100 TCCAATTTCAATTTGACCTCCTCC 59.228 41.667 0.00 0.00 0.00 4.30
316 3200 9.817809 ATCTATTTTATGTCGAAGCAGAGTAAA 57.182 29.630 0.00 0.00 0.00 2.01
357 3242 2.933495 TGTCGTAGGTTCGAATCCTG 57.067 50.000 22.04 11.39 41.47 3.86
364 3249 0.171903 AACCCGATGTCGTAGGTTCG 59.828 55.000 9.36 0.00 38.79 3.95
670 3555 5.445069 TGTGGAAAAGAAGACAGGAATTGA 58.555 37.500 0.00 0.00 0.00 2.57
1324 4213 5.946942 TTCTATGCTCTGATTTCTGAGGT 57.053 39.130 14.05 0.00 40.79 3.85
1551 4444 4.058124 GCCATGAACCTCCTTTTGTTTTC 58.942 43.478 0.00 0.00 0.00 2.29
1556 4449 1.631405 TGGCCATGAACCTCCTTTTG 58.369 50.000 0.00 0.00 0.00 2.44
1616 4509 2.614983 GGCACCTTTTCGAACACAACTA 59.385 45.455 0.00 0.00 0.00 2.24
1754 4649 9.226606 ACACGATGTTCCTATTTCTTTATTTCA 57.773 29.630 0.00 0.00 0.00 2.69
2071 4993 6.518369 GCTTGGATTTACTAAAGGGTTGCTTT 60.518 38.462 0.00 0.00 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.