Multiple sequence alignment - TraesCS5D01G000300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G000300 chr5D 100.000 2333 0 0 1 2333 359377 361709 0.000000e+00 4309
1 TraesCS5D01G000300 chr5D 98.243 2333 34 5 1 2333 144367 146692 0.000000e+00 4074
2 TraesCS5D01G000300 chr5D 97.085 2333 60 5 1 2333 104419 106743 0.000000e+00 3925
3 TraesCS5D01G000300 chr5D 95.146 618 24 3 1 616 99390 100003 0.000000e+00 970
4 TraesCS5D01G000300 chr5D 95.130 616 26 1 1 616 98671 99282 0.000000e+00 968
5 TraesCS5D01G000300 chr5D 95.130 616 26 1 1 616 101549 102160 0.000000e+00 968
6 TraesCS5D01G000300 chr5D 95.130 616 26 1 1 616 102983 103594 0.000000e+00 968
7 TraesCS5D01G000300 chr5D 94.814 617 27 2 1 616 100110 100722 0.000000e+00 957
8 TraesCS5D01G000300 chr5D 94.805 616 28 1 1 616 100830 101441 0.000000e+00 957
9 TraesCS5D01G000300 chr5D 94.805 616 24 5 2 616 103703 104311 0.000000e+00 953
10 TraesCS5D01G000300 chr5D 95.699 93 4 0 812 904 98008 98100 1.440000e-32 150
11 TraesCS5D01G000300 chr5B 88.272 1424 78 24 601 1994 1579022 1580386 0.000000e+00 1622
12 TraesCS5D01G000300 chr5B 91.429 1120 55 7 907 2000 2016646 2015542 0.000000e+00 1498
13 TraesCS5D01G000300 chr5B 87.834 937 49 22 601 1531 5920396 5919519 0.000000e+00 1038
14 TraesCS5D01G000300 chr5B 97.682 302 6 1 2033 2333 2015541 2015240 3.440000e-143 518
15 TraesCS5D01G000300 chr5B 90.645 310 17 6 2033 2333 1580393 1580699 3.610000e-108 401
16 TraesCS5D01G000300 chrUn 88.112 1430 81 24 601 2000 144676051 144674681 0.000000e+00 1616
17 TraesCS5D01G000300 chrUn 88.132 1424 80 24 601 1994 222147372 222148736 0.000000e+00 1611
18 TraesCS5D01G000300 chrUn 87.972 1430 80 25 601 2000 162185686 162184319 0.000000e+00 1604
19 TraesCS5D01G000300 chrUn 88.221 832 45 16 1194 2000 162181826 162181023 0.000000e+00 944
20 TraesCS5D01G000300 chrUn 100.000 391 0 0 970 1360 479850125 479850515 0.000000e+00 723
21 TraesCS5D01G000300 chrUn 90.645 310 17 6 2033 2333 144674680 144674374 3.610000e-108 401
22 TraesCS5D01G000300 chrUn 90.645 310 17 6 2033 2333 162184318 162184012 3.610000e-108 401
23 TraesCS5D01G000300 chrUn 90.323 310 18 6 2033 2333 222148743 222149049 1.680000e-106 396
24 TraesCS5D01G000300 chrUn 83.030 330 24 15 2033 2333 162181022 162180696 1.060000e-68 270
25 TraesCS5D01G000300 chr5A 91.935 1116 53 6 907 2000 306989 305889 0.000000e+00 1528
26 TraesCS5D01G000300 chr5A 97.674 301 6 1 2033 2333 305888 305589 1.240000e-142 516


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G000300 chr5D 359377 361709 2332 False 4309.000000 4309 100.000000 1 2333 1 chr5D.!!$F2 2332
1 TraesCS5D01G000300 chr5D 144367 146692 2325 False 4074.000000 4074 98.243000 1 2333 1 chr5D.!!$F1 2332
2 TraesCS5D01G000300 chr5D 98008 106743 8735 False 1201.777778 3925 95.304889 1 2333 9 chr5D.!!$F3 2332
3 TraesCS5D01G000300 chr5B 5919519 5920396 877 True 1038.000000 1038 87.834000 601 1531 1 chr5B.!!$R1 930
4 TraesCS5D01G000300 chr5B 1579022 1580699 1677 False 1011.500000 1622 89.458500 601 2333 2 chr5B.!!$F1 1732
5 TraesCS5D01G000300 chr5B 2015240 2016646 1406 True 1008.000000 1498 94.555500 907 2333 2 chr5B.!!$R2 1426
6 TraesCS5D01G000300 chrUn 144674374 144676051 1677 True 1008.500000 1616 89.378500 601 2333 2 chrUn.!!$R1 1732
7 TraesCS5D01G000300 chrUn 222147372 222149049 1677 False 1003.500000 1611 89.227500 601 2333 2 chrUn.!!$F2 1732
8 TraesCS5D01G000300 chrUn 162180696 162185686 4990 True 804.750000 1604 87.467000 601 2333 4 chrUn.!!$R2 1732
9 TraesCS5D01G000300 chr5A 305589 306989 1400 True 1022.000000 1528 94.804500 907 2333 2 chr5A.!!$R1 1426

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
291 6704 2.286772 CGCACCGGCCAAACTAAATATC 60.287 50.0 0.0 0.0 36.38 1.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1957 8434 1.20258 AGATTAAGCGCGATTGCCTCT 60.203 47.619 21.53 15.04 38.08 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 693 7.712264 TTAACTGTGCCAATGATTTTTCAAG 57.288 32.000 0.00 0.00 0.00 3.02
187 4449 7.073215 TCCCCACATAAATATAGCTTGGTTAGT 59.927 37.037 0.00 0.00 0.00 2.24
237 4499 2.678836 CCCACCAAATCAACGCGTTATA 59.321 45.455 26.11 16.32 0.00 0.98
238 4500 3.127203 CCCACCAAATCAACGCGTTATAA 59.873 43.478 26.11 13.60 0.00 0.98
239 4501 4.379603 CCCACCAAATCAACGCGTTATAAA 60.380 41.667 26.11 10.95 0.00 1.40
240 4502 5.336744 CCACCAAATCAACGCGTTATAAAT 58.663 37.500 26.11 12.79 0.00 1.40
241 4503 6.458478 CCCACCAAATCAACGCGTTATAAATA 60.458 38.462 26.11 6.48 0.00 1.40
276 6689 2.331805 CTATCGTCTCCCGCACCG 59.668 66.667 0.00 0.00 36.19 4.94
291 6704 2.286772 CGCACCGGCCAAACTAAATATC 60.287 50.000 0.00 0.00 36.38 1.63
705 7118 2.755469 AATGACCCCGTGCATGCC 60.755 61.111 16.68 5.63 0.00 4.40
1505 7940 1.078709 ATGACGACATGCTTGTTCCG 58.921 50.000 6.70 9.17 35.79 4.30
1673 8140 5.829924 ACTTGAGGATGTGTGAAAACAATCT 59.170 36.000 0.00 0.00 32.81 2.40
1957 8434 2.770447 TCTATAATCCCCACAGCCACA 58.230 47.619 0.00 0.00 0.00 4.17
1974 8451 0.391130 ACAGAGGCAATCGCGCTTAA 60.391 50.000 5.56 0.00 39.92 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 693 1.875963 CCGGTTGCTGGTGATTGAC 59.124 57.895 0.00 0.00 0.00 3.18
96 3639 5.938279 ACAATATCACATGATGAGGCTTCT 58.062 37.500 0.00 0.00 41.91 2.85
102 3645 8.822652 TTAGTGCTACAATATCACATGATGAG 57.177 34.615 0.00 0.00 41.91 2.90
187 4449 7.189079 TCCTGGTGTGATTATGTGTTATACA 57.811 36.000 0.00 0.00 44.87 2.29
276 6689 5.140454 ACTGATGGGATATTTAGTTTGGCC 58.860 41.667 0.00 0.00 0.00 5.36
291 6704 6.136155 ACCCCTTATATTTGAAACTGATGGG 58.864 40.000 0.00 0.00 0.00 4.00
535 6948 8.160765 TGGGTTTCTCAACAAATAATCACTCTA 58.839 33.333 0.00 0.00 34.15 2.43
705 7118 8.335532 TGGTTCAAGTAAATGTTATGAGGAAG 57.664 34.615 0.00 0.00 0.00 3.46
1505 7940 3.493767 AAACAGAGAAAGGGAGTCACC 57.506 47.619 0.00 0.00 38.08 4.02
1673 8140 7.013750 TGCCTAAATTGTTGTTGAATGTAGACA 59.986 33.333 0.00 0.00 0.00 3.41
1957 8434 1.202580 AGATTAAGCGCGATTGCCTCT 60.203 47.619 21.53 15.04 38.08 3.69
2073 8552 5.759273 TGTGTAATTTTAGCGGTACAGTTGT 59.241 36.000 0.00 0.00 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.