Multiple sequence alignment - TraesCS5B01G563200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G563200 chr5B 100.000 2729 0 0 1 2729 708881422 708878694 0.000000e+00 5040.0
1 TraesCS5B01G563200 chr5B 80.892 628 95 14 1087 1699 708953964 708954581 3.180000e-129 472.0
2 TraesCS5B01G563200 chr3D 90.315 413 20 4 2332 2729 517443234 517442827 8.660000e-145 523.0
3 TraesCS5B01G563200 chr3D 88.767 365 29 7 2372 2729 41050096 41049737 1.160000e-118 436.0
4 TraesCS5B01G563200 chr3D 81.068 206 39 0 1 206 181574514 181574309 6.050000e-37 165.0
5 TraesCS5B01G563200 chr1B 96.774 310 9 1 529 838 588322719 588322411 1.450000e-142 516.0
6 TraesCS5B01G563200 chr1B 86.747 166 22 0 40 205 150578675 150578840 4.640000e-43 185.0
7 TraesCS5B01G563200 chr7A 96.753 308 9 1 530 837 4785068 4784762 1.870000e-141 512.0
8 TraesCS5B01G563200 chr7A 87.000 400 33 11 2336 2729 115646889 115646503 1.500000e-117 433.0
9 TraesCS5B01G563200 chr5A 96.743 307 9 1 530 836 139481495 139481190 6.740000e-141 510.0
10 TraesCS5B01G563200 chr5A 88.350 412 25 9 2335 2729 75300105 75299700 8.840000e-130 473.0
11 TraesCS5B01G563200 chr5A 86.750 400 32 11 2336 2729 464849008 464849392 2.510000e-115 425.0
12 TraesCS5B01G563200 chr3B 96.743 307 9 1 530 836 536901300 536900995 6.740000e-141 510.0
13 TraesCS5B01G563200 chr3B 95.833 312 13 0 531 842 8463027 8462716 3.140000e-139 505.0
14 TraesCS5B01G563200 chr3B 86.124 418 24 12 2336 2729 815120340 815120747 1.170000e-113 420.0
15 TraesCS5B01G563200 chr5D 80.137 730 105 18 1097 1809 564830843 564831549 2.420000e-140 508.0
16 TraesCS5B01G563200 chr5D 89.268 410 24 8 2335 2729 468084060 468084464 1.890000e-136 496.0
17 TraesCS5B01G563200 chr5D 83.981 206 29 4 2 205 467447131 467446928 7.710000e-46 195.0
18 TraesCS5B01G563200 chr1A 96.429 308 10 1 530 837 42226162 42225856 8.720000e-140 507.0
19 TraesCS5B01G563200 chr7B 96.129 310 10 2 527 836 463037287 463037594 3.140000e-139 505.0
20 TraesCS5B01G563200 chr7B 94.172 326 17 2 515 839 717329227 717328903 1.890000e-136 496.0
21 TraesCS5B01G563200 chr7B 85.714 203 29 0 3 205 167447395 167447597 5.920000e-52 215.0
22 TraesCS5B01G563200 chr6B 95.046 323 12 4 511 832 634640308 634640627 3.140000e-139 505.0
23 TraesCS5B01G563200 chr7D 87.255 408 29 17 2336 2727 62217771 62217371 6.930000e-121 444.0
24 TraesCS5B01G563200 chr2B 86.139 404 39 11 2336 2729 792479965 792479569 1.170000e-113 420.0
25 TraesCS5B01G563200 chr2B 79.947 374 70 5 1136 1506 709848532 709848161 1.250000e-68 270.0
26 TraesCS5B01G563200 chr2B 85.577 208 26 4 1 206 165123221 165123016 5.920000e-52 215.0
27 TraesCS5B01G563200 chr2B 78.125 224 41 5 1970 2192 733049932 733050148 4.740000e-28 135.0
28 TraesCS5B01G563200 chr2B 75.776 161 39 0 1152 1312 790850264 790850424 6.260000e-12 82.4
29 TraesCS5B01G563200 chr6A 84.841 409 36 11 2336 2729 14083934 14083537 3.300000e-104 388.0
30 TraesCS5B01G563200 chr2D 85.139 397 27 20 2335 2729 630223583 630223949 7.130000e-101 377.0
31 TraesCS5B01G563200 chr2D 79.235 366 72 4 1143 1506 587306070 587305707 4.510000e-63 252.0
32 TraesCS5B01G563200 chr2D 77.632 304 59 7 1923 2223 602689327 602689624 2.790000e-40 176.0
33 TraesCS5B01G563200 chr6D 94.583 240 11 2 2490 2729 35751741 35751978 1.190000e-98 370.0
34 TraesCS5B01G563200 chr6D 80.488 205 40 0 1 205 8031172 8031376 1.010000e-34 158.0
35 TraesCS5B01G563200 chr4B 89.116 294 24 6 2437 2729 667633441 667633727 2.580000e-95 359.0
36 TraesCS5B01G563200 chr4B 82.609 207 32 1 1 203 5817317 5817111 2.160000e-41 180.0
37 TraesCS5B01G563200 chr4D 82.212 208 33 3 1 206 327712508 327712303 2.790000e-40 176.0
38 TraesCS5B01G563200 chr1D 81.863 204 37 0 1 204 42973227 42973430 3.610000e-39 172.0
39 TraesCS5B01G563200 chr2A 75.155 161 40 0 1152 1312 770146958 770146798 2.910000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G563200 chr5B 708878694 708881422 2728 True 5040 5040 100.000 1 2729 1 chr5B.!!$R1 2728
1 TraesCS5B01G563200 chr5B 708953964 708954581 617 False 472 472 80.892 1087 1699 1 chr5B.!!$F1 612
2 TraesCS5B01G563200 chr5D 564830843 564831549 706 False 508 508 80.137 1097 1809 1 chr5D.!!$F2 712


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
744 745 0.033601 AGTCTCTCGGAGGTGCTCAT 60.034 55.0 4.96 0.0 31.08 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2345 2362 0.033503 CCGGGACAATAGGCCCTTTT 60.034 55.0 4.64 0.0 42.4 2.27 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 2.423926 CGGAGGGTATGATCTGTTCG 57.576 55.000 0.00 0.00 0.00 3.95
28 29 1.681793 CGGAGGGTATGATCTGTTCGT 59.318 52.381 0.00 0.00 0.00 3.85
29 30 2.543861 CGGAGGGTATGATCTGTTCGTG 60.544 54.545 0.00 0.00 0.00 4.35
30 31 2.224066 GGAGGGTATGATCTGTTCGTGG 60.224 54.545 0.00 0.00 0.00 4.94
31 32 1.139058 AGGGTATGATCTGTTCGTGGC 59.861 52.381 0.00 0.00 0.00 5.01
32 33 1.139058 GGGTATGATCTGTTCGTGGCT 59.861 52.381 0.00 0.00 0.00 4.75
33 34 2.474816 GGTATGATCTGTTCGTGGCTC 58.525 52.381 0.00 0.00 0.00 4.70
34 35 2.120232 GTATGATCTGTTCGTGGCTCG 58.880 52.381 1.94 1.94 41.41 5.03
35 36 0.532573 ATGATCTGTTCGTGGCTCGT 59.467 50.000 8.94 0.00 40.80 4.18
36 37 0.317160 TGATCTGTTCGTGGCTCGTT 59.683 50.000 8.94 0.00 40.80 3.85
37 38 1.270094 TGATCTGTTCGTGGCTCGTTT 60.270 47.619 8.94 0.00 40.80 3.60
38 39 2.029739 TGATCTGTTCGTGGCTCGTTTA 60.030 45.455 8.94 0.00 40.80 2.01
39 40 1.774639 TCTGTTCGTGGCTCGTTTAC 58.225 50.000 8.94 6.74 40.80 2.01
40 41 1.338973 TCTGTTCGTGGCTCGTTTACT 59.661 47.619 8.94 0.00 40.80 2.24
41 42 1.719780 CTGTTCGTGGCTCGTTTACTC 59.280 52.381 8.94 0.00 40.80 2.59
42 43 0.706729 GTTCGTGGCTCGTTTACTCG 59.293 55.000 8.94 0.00 40.80 4.18
43 44 0.311790 TTCGTGGCTCGTTTACTCGT 59.688 50.000 8.94 0.00 40.80 4.18
44 45 0.311790 TCGTGGCTCGTTTACTCGTT 59.688 50.000 8.94 0.00 40.80 3.85
45 46 0.706729 CGTGGCTCGTTTACTCGTTC 59.293 55.000 0.00 0.00 34.52 3.95
46 47 1.774639 GTGGCTCGTTTACTCGTTCA 58.225 50.000 0.00 0.00 0.00 3.18
47 48 2.129607 GTGGCTCGTTTACTCGTTCAA 58.870 47.619 0.00 0.00 0.00 2.69
48 49 2.155155 GTGGCTCGTTTACTCGTTCAAG 59.845 50.000 0.00 0.00 0.00 3.02
49 50 2.223876 TGGCTCGTTTACTCGTTCAAGT 60.224 45.455 0.00 0.00 0.00 3.16
50 51 2.155155 GGCTCGTTTACTCGTTCAAGTG 59.845 50.000 0.00 0.00 0.00 3.16
51 52 2.409879 GCTCGTTTACTCGTTCAAGTGC 60.410 50.000 0.00 0.00 0.00 4.40
52 53 3.050619 CTCGTTTACTCGTTCAAGTGCT 58.949 45.455 0.00 0.00 0.00 4.40
53 54 2.792674 TCGTTTACTCGTTCAAGTGCTG 59.207 45.455 0.00 0.00 0.00 4.41
54 55 2.096909 CGTTTACTCGTTCAAGTGCTGG 60.097 50.000 0.00 0.00 0.00 4.85
55 56 1.508632 TTACTCGTTCAAGTGCTGGC 58.491 50.000 0.00 0.00 0.00 4.85
56 57 0.320421 TACTCGTTCAAGTGCTGGCC 60.320 55.000 0.00 0.00 0.00 5.36
57 58 1.597854 CTCGTTCAAGTGCTGGCCA 60.598 57.895 4.71 4.71 0.00 5.36
58 59 0.957395 CTCGTTCAAGTGCTGGCCAT 60.957 55.000 5.51 0.00 0.00 4.40
59 60 0.323302 TCGTTCAAGTGCTGGCCATA 59.677 50.000 5.51 0.00 0.00 2.74
60 61 1.065491 TCGTTCAAGTGCTGGCCATAT 60.065 47.619 5.51 0.00 0.00 1.78
61 62 2.169561 TCGTTCAAGTGCTGGCCATATA 59.830 45.455 5.51 0.00 0.00 0.86
62 63 3.141398 CGTTCAAGTGCTGGCCATATAT 58.859 45.455 5.51 0.00 0.00 0.86
63 64 4.039852 TCGTTCAAGTGCTGGCCATATATA 59.960 41.667 5.51 0.00 0.00 0.86
64 65 4.937620 CGTTCAAGTGCTGGCCATATATAT 59.062 41.667 5.51 0.00 0.00 0.86
65 66 5.163824 CGTTCAAGTGCTGGCCATATATATG 60.164 44.000 5.51 14.78 0.00 1.78
66 67 5.503634 TCAAGTGCTGGCCATATATATGT 57.496 39.130 19.11 0.00 31.82 2.29
67 68 5.879763 TCAAGTGCTGGCCATATATATGTT 58.120 37.500 19.11 4.09 31.82 2.71
68 69 6.306199 TCAAGTGCTGGCCATATATATGTTT 58.694 36.000 19.11 0.00 31.82 2.83
69 70 6.777091 TCAAGTGCTGGCCATATATATGTTTT 59.223 34.615 19.11 2.24 31.82 2.43
70 71 7.287466 TCAAGTGCTGGCCATATATATGTTTTT 59.713 33.333 19.11 2.67 31.82 1.94
71 72 7.219484 AGTGCTGGCCATATATATGTTTTTC 57.781 36.000 19.11 7.85 31.82 2.29
72 73 6.777091 AGTGCTGGCCATATATATGTTTTTCA 59.223 34.615 19.11 9.90 31.82 2.69
73 74 7.452501 AGTGCTGGCCATATATATGTTTTTCAT 59.547 33.333 19.11 0.00 40.25 2.57
74 75 8.739039 GTGCTGGCCATATATATGTTTTTCATA 58.261 33.333 19.11 0.00 42.30 2.15
75 76 8.959548 TGCTGGCCATATATATGTTTTTCATAG 58.040 33.333 19.11 8.46 41.55 2.23
76 77 9.177608 GCTGGCCATATATATGTTTTTCATAGA 57.822 33.333 19.11 0.00 41.55 1.98
103 104 5.348418 TCGGTTCTATGTACTATACGTGC 57.652 43.478 0.00 0.00 0.00 5.34
104 105 5.059161 TCGGTTCTATGTACTATACGTGCT 58.941 41.667 0.00 0.00 0.00 4.40
105 106 5.528690 TCGGTTCTATGTACTATACGTGCTT 59.471 40.000 0.00 0.00 0.00 3.91
106 107 6.705825 TCGGTTCTATGTACTATACGTGCTTA 59.294 38.462 0.00 0.00 0.00 3.09
107 108 6.794158 CGGTTCTATGTACTATACGTGCTTAC 59.206 42.308 0.00 0.00 0.00 2.34
108 109 7.518848 CGGTTCTATGTACTATACGTGCTTACA 60.519 40.741 0.00 0.82 0.00 2.41
109 110 8.295288 GGTTCTATGTACTATACGTGCTTACAT 58.705 37.037 14.44 14.44 37.23 2.29
110 111 9.114965 GTTCTATGTACTATACGTGCTTACATG 57.885 37.037 17.37 0.00 35.50 3.21
111 112 7.303261 TCTATGTACTATACGTGCTTACATGC 58.697 38.462 17.37 0.00 35.50 4.06
112 113 5.509716 TGTACTATACGTGCTTACATGCT 57.490 39.130 0.00 0.00 36.15 3.79
113 114 5.898174 TGTACTATACGTGCTTACATGCTT 58.102 37.500 0.00 0.00 36.15 3.91
114 115 7.030075 TGTACTATACGTGCTTACATGCTTA 57.970 36.000 0.00 0.00 36.15 3.09
115 116 7.136772 TGTACTATACGTGCTTACATGCTTAG 58.863 38.462 0.00 0.00 36.15 2.18
116 117 5.529791 ACTATACGTGCTTACATGCTTAGG 58.470 41.667 0.00 0.00 36.15 2.69
117 118 2.762535 ACGTGCTTACATGCTTAGGT 57.237 45.000 0.00 0.00 36.15 3.08
118 119 3.880047 ACGTGCTTACATGCTTAGGTA 57.120 42.857 0.00 0.00 36.15 3.08
119 120 4.402056 ACGTGCTTACATGCTTAGGTAT 57.598 40.909 0.00 0.00 36.15 2.73
120 121 4.369182 ACGTGCTTACATGCTTAGGTATC 58.631 43.478 0.00 0.00 36.15 2.24
121 122 3.425525 CGTGCTTACATGCTTAGGTATCG 59.574 47.826 0.00 0.00 0.00 2.92
122 123 4.617959 GTGCTTACATGCTTAGGTATCGA 58.382 43.478 0.00 0.00 0.00 3.59
123 124 5.230942 GTGCTTACATGCTTAGGTATCGAT 58.769 41.667 2.16 2.16 0.00 3.59
124 125 6.387465 GTGCTTACATGCTTAGGTATCGATA 58.613 40.000 0.00 0.00 0.00 2.92
125 126 7.036220 GTGCTTACATGCTTAGGTATCGATAT 58.964 38.462 8.66 0.00 0.00 1.63
126 127 8.188799 GTGCTTACATGCTTAGGTATCGATATA 58.811 37.037 8.66 0.00 0.00 0.86
127 128 8.745590 TGCTTACATGCTTAGGTATCGATATAA 58.254 33.333 8.66 3.56 0.00 0.98
128 129 9.239002 GCTTACATGCTTAGGTATCGATATAAG 57.761 37.037 16.47 16.47 0.00 1.73
129 130 9.737427 CTTACATGCTTAGGTATCGATATAAGG 57.263 37.037 19.95 10.87 0.00 2.69
130 131 7.719871 ACATGCTTAGGTATCGATATAAGGT 57.280 36.000 19.95 11.31 0.00 3.50
131 132 7.548097 ACATGCTTAGGTATCGATATAAGGTG 58.452 38.462 19.95 10.81 0.00 4.00
132 133 5.962433 TGCTTAGGTATCGATATAAGGTGC 58.038 41.667 19.95 15.18 0.00 5.01
133 134 5.479027 TGCTTAGGTATCGATATAAGGTGCA 59.521 40.000 19.95 16.86 0.00 4.57
134 135 6.154534 TGCTTAGGTATCGATATAAGGTGCAT 59.845 38.462 19.95 4.37 0.00 3.96
135 136 7.340999 TGCTTAGGTATCGATATAAGGTGCATA 59.659 37.037 19.95 3.60 0.00 3.14
136 137 8.361139 GCTTAGGTATCGATATAAGGTGCATAT 58.639 37.037 19.95 0.00 0.00 1.78
137 138 9.900710 CTTAGGTATCGATATAAGGTGCATATC 57.099 37.037 8.66 0.00 33.73 1.63
146 147 2.914379 GGTGCATATCGTACCTGCC 58.086 57.895 0.00 0.00 46.32 4.85
147 148 0.105964 GGTGCATATCGTACCTGCCA 59.894 55.000 0.00 0.00 46.32 4.92
148 149 1.502231 GTGCATATCGTACCTGCCAG 58.498 55.000 0.00 0.00 35.02 4.85
149 150 0.392706 TGCATATCGTACCTGCCAGG 59.607 55.000 9.83 9.83 42.49 4.45
162 163 2.817844 CCTGCCAGGTTTACTGTTTACC 59.182 50.000 1.39 3.57 46.06 2.85
163 164 2.817844 CTGCCAGGTTTACTGTTTACCC 59.182 50.000 7.22 0.00 46.06 3.69
164 165 1.808343 GCCAGGTTTACTGTTTACCCG 59.192 52.381 7.22 0.00 46.06 5.28
165 166 2.429478 CCAGGTTTACTGTTTACCCGG 58.571 52.381 0.00 0.00 46.06 5.73
166 167 2.038820 CCAGGTTTACTGTTTACCCGGA 59.961 50.000 0.73 0.00 46.06 5.14
167 168 3.332034 CAGGTTTACTGTTTACCCGGAG 58.668 50.000 0.73 0.00 42.42 4.63
168 169 3.007182 CAGGTTTACTGTTTACCCGGAGA 59.993 47.826 0.73 0.00 42.42 3.71
169 170 3.842436 AGGTTTACTGTTTACCCGGAGAT 59.158 43.478 0.73 0.00 32.20 2.75
170 171 4.287845 AGGTTTACTGTTTACCCGGAGATT 59.712 41.667 0.73 0.00 32.20 2.40
171 172 5.484998 AGGTTTACTGTTTACCCGGAGATTA 59.515 40.000 0.73 0.00 32.20 1.75
172 173 5.814188 GGTTTACTGTTTACCCGGAGATTAG 59.186 44.000 0.73 0.00 0.00 1.73
173 174 6.401394 GTTTACTGTTTACCCGGAGATTAGT 58.599 40.000 0.73 2.60 0.00 2.24
174 175 4.732672 ACTGTTTACCCGGAGATTAGTC 57.267 45.455 0.73 0.00 0.00 2.59
175 176 4.351127 ACTGTTTACCCGGAGATTAGTCT 58.649 43.478 0.73 0.00 37.42 3.24
176 177 5.513233 ACTGTTTACCCGGAGATTAGTCTA 58.487 41.667 0.73 0.00 33.97 2.59
177 178 5.954150 ACTGTTTACCCGGAGATTAGTCTAA 59.046 40.000 0.73 0.00 33.97 2.10
178 179 6.610425 ACTGTTTACCCGGAGATTAGTCTAAT 59.390 38.462 0.73 4.71 33.97 1.73
179 180 7.047460 TGTTTACCCGGAGATTAGTCTAATC 57.953 40.000 20.67 20.67 43.77 1.75
192 193 8.644318 GATTAGTCTAATCGAAAAGGTGCTAA 57.356 34.615 15.23 1.71 35.68 3.09
193 194 9.262358 GATTAGTCTAATCGAAAAGGTGCTAAT 57.738 33.333 15.23 14.61 35.68 1.73
197 198 9.614792 AGTCTAATCGAAAAGGTGCTAATATTT 57.385 29.630 0.00 0.00 0.00 1.40
198 199 9.865484 GTCTAATCGAAAAGGTGCTAATATTTC 57.135 33.333 0.00 0.00 0.00 2.17
199 200 9.052759 TCTAATCGAAAAGGTGCTAATATTTCC 57.947 33.333 0.00 0.00 0.00 3.13
200 201 7.639113 AATCGAAAAGGTGCTAATATTTCCA 57.361 32.000 0.00 0.00 0.00 3.53
201 202 7.639113 ATCGAAAAGGTGCTAATATTTCCAA 57.361 32.000 0.00 0.00 0.00 3.53
202 203 6.848451 TCGAAAAGGTGCTAATATTTCCAAC 58.152 36.000 0.00 0.00 0.00 3.77
203 204 6.431543 TCGAAAAGGTGCTAATATTTCCAACA 59.568 34.615 0.00 0.00 0.00 3.33
204 205 7.040340 TCGAAAAGGTGCTAATATTTCCAACAA 60.040 33.333 0.00 0.00 0.00 2.83
205 206 7.061789 CGAAAAGGTGCTAATATTTCCAACAAC 59.938 37.037 0.00 0.00 0.00 3.32
206 207 6.909550 AAGGTGCTAATATTTCCAACAACA 57.090 33.333 0.00 0.00 0.00 3.33
207 208 6.515272 AGGTGCTAATATTTCCAACAACAG 57.485 37.500 0.00 0.00 0.00 3.16
208 209 6.010219 AGGTGCTAATATTTCCAACAACAGT 58.990 36.000 0.00 0.00 0.00 3.55
209 210 6.493458 AGGTGCTAATATTTCCAACAACAGTT 59.507 34.615 0.00 0.00 0.00 3.16
210 211 6.586082 GGTGCTAATATTTCCAACAACAGTTG 59.414 38.462 12.03 12.03 41.74 3.16
211 212 6.089417 GTGCTAATATTTCCAACAACAGTTGC 59.911 38.462 13.56 0.00 40.95 4.17
212 213 6.155827 GCTAATATTTCCAACAACAGTTGCA 58.844 36.000 13.56 0.00 40.95 4.08
213 214 6.813152 GCTAATATTTCCAACAACAGTTGCAT 59.187 34.615 13.56 0.00 40.95 3.96
214 215 7.201461 GCTAATATTTCCAACAACAGTTGCATG 60.201 37.037 13.56 12.16 40.95 4.06
215 216 2.222007 TTCCAACAACAGTTGCATGC 57.778 45.000 11.82 11.82 40.95 4.06
216 217 1.109609 TCCAACAACAGTTGCATGCA 58.890 45.000 18.46 18.46 40.95 3.96
217 218 1.479730 TCCAACAACAGTTGCATGCAA 59.520 42.857 28.80 28.80 40.95 4.08
218 219 2.093816 TCCAACAACAGTTGCATGCAAA 60.094 40.909 33.42 15.81 40.95 3.68
219 220 2.030701 CCAACAACAGTTGCATGCAAAC 59.969 45.455 33.42 25.12 40.95 2.93
220 221 1.558741 ACAACAGTTGCATGCAAACG 58.441 45.000 33.42 27.11 37.70 3.60
221 222 1.133982 ACAACAGTTGCATGCAAACGA 59.866 42.857 33.42 10.51 37.70 3.85
222 223 2.191802 CAACAGTTGCATGCAAACGAA 58.808 42.857 33.42 10.08 37.70 3.85
223 224 1.838913 ACAGTTGCATGCAAACGAAC 58.161 45.000 33.42 21.65 37.70 3.95
224 225 1.130955 CAGTTGCATGCAAACGAACC 58.869 50.000 33.42 19.90 37.70 3.62
225 226 0.743688 AGTTGCATGCAAACGAACCA 59.256 45.000 33.42 7.59 37.70 3.67
226 227 1.130955 GTTGCATGCAAACGAACCAG 58.869 50.000 33.42 0.00 37.70 4.00
227 228 0.597118 TTGCATGCAAACGAACCAGC 60.597 50.000 30.19 0.00 32.44 4.85
228 229 1.734117 GCATGCAAACGAACCAGCC 60.734 57.895 14.21 0.00 0.00 4.85
229 230 1.959085 CATGCAAACGAACCAGCCT 59.041 52.632 0.00 0.00 0.00 4.58
230 231 0.387622 CATGCAAACGAACCAGCCTG 60.388 55.000 0.00 0.00 0.00 4.85
231 232 0.537143 ATGCAAACGAACCAGCCTGA 60.537 50.000 0.00 0.00 0.00 3.86
232 233 1.165907 TGCAAACGAACCAGCCTGAG 61.166 55.000 0.00 0.00 0.00 3.35
233 234 1.576421 CAAACGAACCAGCCTGAGC 59.424 57.895 0.00 0.00 40.32 4.26
234 235 1.148273 AAACGAACCAGCCTGAGCA 59.852 52.632 0.00 0.00 43.56 4.26
235 236 0.250901 AAACGAACCAGCCTGAGCAT 60.251 50.000 0.00 0.00 43.56 3.79
236 237 0.957395 AACGAACCAGCCTGAGCATG 60.957 55.000 0.00 0.00 43.56 4.06
237 238 1.376424 CGAACCAGCCTGAGCATGT 60.376 57.895 0.00 0.00 43.56 3.21
238 239 0.108186 CGAACCAGCCTGAGCATGTA 60.108 55.000 0.00 0.00 43.56 2.29
239 240 1.473965 CGAACCAGCCTGAGCATGTAT 60.474 52.381 0.00 0.00 43.56 2.29
240 241 2.224042 CGAACCAGCCTGAGCATGTATA 60.224 50.000 0.00 0.00 43.56 1.47
241 242 3.555795 CGAACCAGCCTGAGCATGTATAT 60.556 47.826 0.00 0.00 43.56 0.86
242 243 3.413846 ACCAGCCTGAGCATGTATATG 57.586 47.619 0.00 0.00 43.56 1.78
261 262 9.739276 TGTATATGCCTGATCCTAAAATTAAGG 57.261 33.333 1.08 1.08 35.26 2.69
262 263 9.178758 GTATATGCCTGATCCTAAAATTAAGGG 57.821 37.037 6.87 0.00 34.66 3.95
263 264 5.725551 TGCCTGATCCTAAAATTAAGGGA 57.274 39.130 6.87 2.15 34.66 4.20
264 265 6.279813 TGCCTGATCCTAAAATTAAGGGAT 57.720 37.500 6.87 6.37 40.77 3.85
272 273 8.794335 ATCCTAAAATTAAGGGATCGAATAGC 57.206 34.615 6.87 0.00 33.83 2.97
273 274 7.741785 TCCTAAAATTAAGGGATCGAATAGCA 58.258 34.615 6.87 0.00 34.66 3.49
274 275 7.660208 TCCTAAAATTAAGGGATCGAATAGCAC 59.340 37.037 6.87 0.00 34.66 4.40
275 276 7.444183 CCTAAAATTAAGGGATCGAATAGCACA 59.556 37.037 0.00 0.00 0.00 4.57
276 277 7.823745 AAAATTAAGGGATCGAATAGCACAT 57.176 32.000 0.00 0.00 0.00 3.21
277 278 8.918202 AAAATTAAGGGATCGAATAGCACATA 57.082 30.769 0.00 0.00 0.00 2.29
278 279 8.553459 AAATTAAGGGATCGAATAGCACATAG 57.447 34.615 0.00 0.00 0.00 2.23
279 280 6.911250 TTAAGGGATCGAATAGCACATAGA 57.089 37.500 0.00 0.00 0.00 1.98
280 281 4.792521 AGGGATCGAATAGCACATAGAC 57.207 45.455 0.00 0.00 0.00 2.59
281 282 4.411927 AGGGATCGAATAGCACATAGACT 58.588 43.478 0.00 0.00 0.00 3.24
282 283 4.835615 AGGGATCGAATAGCACATAGACTT 59.164 41.667 0.00 0.00 0.00 3.01
283 284 6.010850 AGGGATCGAATAGCACATAGACTTA 58.989 40.000 0.00 0.00 0.00 2.24
284 285 6.665680 AGGGATCGAATAGCACATAGACTTAT 59.334 38.462 0.00 0.00 0.00 1.73
285 286 6.975772 GGGATCGAATAGCACATAGACTTATC 59.024 42.308 0.00 0.00 0.00 1.75
286 287 7.147983 GGGATCGAATAGCACATAGACTTATCT 60.148 40.741 0.00 0.00 39.15 1.98
287 288 8.894731 GGATCGAATAGCACATAGACTTATCTA 58.105 37.037 0.00 0.00 41.76 1.98
294 295 7.747155 AGCACATAGACTTATCTATACACGT 57.253 36.000 0.00 0.00 44.89 4.49
295 296 8.167605 AGCACATAGACTTATCTATACACGTT 57.832 34.615 0.00 0.00 44.89 3.99
296 297 8.291032 AGCACATAGACTTATCTATACACGTTC 58.709 37.037 0.00 0.00 44.89 3.95
297 298 8.291032 GCACATAGACTTATCTATACACGTTCT 58.709 37.037 0.00 0.00 44.89 3.01
298 299 9.814507 CACATAGACTTATCTATACACGTTCTC 57.185 37.037 0.00 0.00 44.89 2.87
299 300 9.001542 ACATAGACTTATCTATACACGTTCTCC 57.998 37.037 0.00 0.00 44.89 3.71
300 301 9.000486 CATAGACTTATCTATACACGTTCTCCA 58.000 37.037 0.00 0.00 44.89 3.86
301 302 7.261829 AGACTTATCTATACACGTTCTCCAC 57.738 40.000 0.00 0.00 31.46 4.02
302 303 6.262720 AGACTTATCTATACACGTTCTCCACC 59.737 42.308 0.00 0.00 31.46 4.61
303 304 5.889853 ACTTATCTATACACGTTCTCCACCA 59.110 40.000 0.00 0.00 0.00 4.17
304 305 6.550108 ACTTATCTATACACGTTCTCCACCAT 59.450 38.462 0.00 0.00 0.00 3.55
305 306 4.649088 TCTATACACGTTCTCCACCATG 57.351 45.455 0.00 0.00 0.00 3.66
306 307 2.024176 ATACACGTTCTCCACCATGC 57.976 50.000 0.00 0.00 0.00 4.06
307 308 0.682292 TACACGTTCTCCACCATGCA 59.318 50.000 0.00 0.00 0.00 3.96
308 309 0.036732 ACACGTTCTCCACCATGCAT 59.963 50.000 0.00 0.00 0.00 3.96
309 310 0.448990 CACGTTCTCCACCATGCATG 59.551 55.000 20.19 20.19 0.00 4.06
310 311 0.036732 ACGTTCTCCACCATGCATGT 59.963 50.000 24.58 10.59 0.00 3.21
311 312 1.277842 ACGTTCTCCACCATGCATGTA 59.722 47.619 24.58 6.98 0.00 2.29
312 313 1.935873 CGTTCTCCACCATGCATGTAG 59.064 52.381 24.58 15.89 0.00 2.74
313 314 2.677902 CGTTCTCCACCATGCATGTAGT 60.678 50.000 24.58 13.80 0.00 2.73
314 315 3.430236 CGTTCTCCACCATGCATGTAGTA 60.430 47.826 24.58 8.08 0.00 1.82
315 316 4.708177 GTTCTCCACCATGCATGTAGTAT 58.292 43.478 24.58 2.64 0.00 2.12
316 317 5.508994 CGTTCTCCACCATGCATGTAGTATA 60.509 44.000 24.58 7.46 0.00 1.47
317 318 5.468540 TCTCCACCATGCATGTAGTATAC 57.531 43.478 24.58 0.00 43.42 1.47
330 331 4.682787 TGTAGTATACACATGTCTGCAGC 58.317 43.478 9.47 4.92 46.14 5.25
331 332 4.402474 TGTAGTATACACATGTCTGCAGCT 59.598 41.667 9.47 0.00 46.14 4.24
332 333 4.478206 AGTATACACATGTCTGCAGCTT 57.522 40.909 9.47 0.00 0.00 3.74
333 334 4.437239 AGTATACACATGTCTGCAGCTTC 58.563 43.478 9.47 2.59 0.00 3.86
334 335 2.837532 TACACATGTCTGCAGCTTCA 57.162 45.000 9.47 8.63 0.00 3.02
335 336 1.971481 ACACATGTCTGCAGCTTCAA 58.029 45.000 9.47 0.00 0.00 2.69
336 337 2.511659 ACACATGTCTGCAGCTTCAAT 58.488 42.857 9.47 0.00 0.00 2.57
337 338 3.678289 ACACATGTCTGCAGCTTCAATA 58.322 40.909 9.47 0.00 0.00 1.90
338 339 3.688185 ACACATGTCTGCAGCTTCAATAG 59.312 43.478 9.47 5.77 0.00 1.73
339 340 3.937079 CACATGTCTGCAGCTTCAATAGA 59.063 43.478 9.47 0.00 0.00 1.98
340 341 4.393990 CACATGTCTGCAGCTTCAATAGAA 59.606 41.667 9.47 0.00 0.00 2.10
356 357 8.771920 TTCAATAGAAGTTGTGTATGTACCTG 57.228 34.615 0.00 0.00 0.00 4.00
357 358 7.903145 TCAATAGAAGTTGTGTATGTACCTGT 58.097 34.615 0.00 0.00 0.00 4.00
358 359 7.817478 TCAATAGAAGTTGTGTATGTACCTGTG 59.183 37.037 0.00 0.00 0.00 3.66
359 360 5.801531 AGAAGTTGTGTATGTACCTGTGA 57.198 39.130 0.00 0.00 0.00 3.58
360 361 6.169557 AGAAGTTGTGTATGTACCTGTGAA 57.830 37.500 0.00 0.00 0.00 3.18
361 362 6.588204 AGAAGTTGTGTATGTACCTGTGAAA 58.412 36.000 0.00 0.00 0.00 2.69
362 363 7.224297 AGAAGTTGTGTATGTACCTGTGAAAT 58.776 34.615 0.00 0.00 0.00 2.17
363 364 7.719633 AGAAGTTGTGTATGTACCTGTGAAATT 59.280 33.333 0.00 0.00 0.00 1.82
364 365 7.202016 AGTTGTGTATGTACCTGTGAAATTG 57.798 36.000 0.00 0.00 0.00 2.32
365 366 6.770785 AGTTGTGTATGTACCTGTGAAATTGT 59.229 34.615 0.00 0.00 0.00 2.71
366 367 6.795098 TGTGTATGTACCTGTGAAATTGTC 57.205 37.500 0.00 0.00 0.00 3.18
367 368 6.292150 TGTGTATGTACCTGTGAAATTGTCA 58.708 36.000 0.00 0.00 0.00 3.58
368 369 6.768381 TGTGTATGTACCTGTGAAATTGTCAA 59.232 34.615 0.00 0.00 38.23 3.18
369 370 7.041440 TGTGTATGTACCTGTGAAATTGTCAAG 60.041 37.037 0.00 0.00 38.23 3.02
370 371 6.995686 TGTATGTACCTGTGAAATTGTCAAGT 59.004 34.615 0.00 0.00 38.23 3.16
371 372 6.959639 ATGTACCTGTGAAATTGTCAAGTT 57.040 33.333 0.00 0.00 38.23 2.66
372 373 6.767524 TGTACCTGTGAAATTGTCAAGTTT 57.232 33.333 0.00 0.00 38.23 2.66
373 374 6.559810 TGTACCTGTGAAATTGTCAAGTTTG 58.440 36.000 0.00 0.00 38.23 2.93
374 375 5.659440 ACCTGTGAAATTGTCAAGTTTGT 57.341 34.783 0.00 0.00 38.23 2.83
375 376 5.410067 ACCTGTGAAATTGTCAAGTTTGTG 58.590 37.500 0.00 0.00 38.23 3.33
376 377 4.805192 CCTGTGAAATTGTCAAGTTTGTGG 59.195 41.667 0.00 0.00 38.23 4.17
377 378 5.394005 CCTGTGAAATTGTCAAGTTTGTGGA 60.394 40.000 0.00 0.00 38.23 4.02
378 379 6.219417 TGTGAAATTGTCAAGTTTGTGGAT 57.781 33.333 0.00 0.00 38.23 3.41
379 380 6.638610 TGTGAAATTGTCAAGTTTGTGGATT 58.361 32.000 0.00 0.00 38.23 3.01
380 381 6.534436 TGTGAAATTGTCAAGTTTGTGGATTG 59.466 34.615 0.00 0.00 38.23 2.67
381 382 6.534793 GTGAAATTGTCAAGTTTGTGGATTGT 59.465 34.615 0.00 0.00 38.23 2.71
382 383 7.704472 GTGAAATTGTCAAGTTTGTGGATTGTA 59.296 33.333 0.00 0.00 38.23 2.41
383 384 8.420222 TGAAATTGTCAAGTTTGTGGATTGTAT 58.580 29.630 0.00 0.00 31.51 2.29
384 385 8.592105 AAATTGTCAAGTTTGTGGATTGTATG 57.408 30.769 0.00 0.00 0.00 2.39
385 386 5.703978 TGTCAAGTTTGTGGATTGTATGG 57.296 39.130 0.00 0.00 0.00 2.74
386 387 5.380900 TGTCAAGTTTGTGGATTGTATGGA 58.619 37.500 0.00 0.00 0.00 3.41
387 388 5.473162 TGTCAAGTTTGTGGATTGTATGGAG 59.527 40.000 0.00 0.00 0.00 3.86
388 389 5.473504 GTCAAGTTTGTGGATTGTATGGAGT 59.526 40.000 0.00 0.00 0.00 3.85
389 390 6.653320 GTCAAGTTTGTGGATTGTATGGAGTA 59.347 38.462 0.00 0.00 0.00 2.59
390 391 7.336931 GTCAAGTTTGTGGATTGTATGGAGTAT 59.663 37.037 0.00 0.00 0.00 2.12
391 392 7.888021 TCAAGTTTGTGGATTGTATGGAGTATT 59.112 33.333 0.00 0.00 0.00 1.89
392 393 9.173021 CAAGTTTGTGGATTGTATGGAGTATTA 57.827 33.333 0.00 0.00 0.00 0.98
393 394 9.747898 AAGTTTGTGGATTGTATGGAGTATTAA 57.252 29.630 0.00 0.00 0.00 1.40
394 395 9.920946 AGTTTGTGGATTGTATGGAGTATTAAT 57.079 29.630 0.00 0.00 0.00 1.40
425 426 9.062524 TGAACAAGTATATACCACATATTTGGC 57.937 33.333 7.86 3.97 40.77 4.52
426 427 7.667043 ACAAGTATATACCACATATTTGGCG 57.333 36.000 7.86 0.00 40.77 5.69
427 428 7.446769 ACAAGTATATACCACATATTTGGCGA 58.553 34.615 7.86 0.00 40.77 5.54
428 429 8.100791 ACAAGTATATACCACATATTTGGCGAT 58.899 33.333 7.86 4.73 40.77 4.58
429 430 8.390354 CAAGTATATACCACATATTTGGCGATG 58.610 37.037 7.86 0.00 40.77 3.84
430 431 7.847096 AGTATATACCACATATTTGGCGATGA 58.153 34.615 7.86 0.00 40.77 2.92
431 432 7.981789 AGTATATACCACATATTTGGCGATGAG 59.018 37.037 7.86 0.00 40.77 2.90
432 433 3.281727 ACCACATATTTGGCGATGAGT 57.718 42.857 7.86 0.00 40.77 3.41
433 434 4.415881 ACCACATATTTGGCGATGAGTA 57.584 40.909 7.86 0.00 40.77 2.59
434 435 4.973168 ACCACATATTTGGCGATGAGTAT 58.027 39.130 7.86 0.00 40.77 2.12
435 436 4.997395 ACCACATATTTGGCGATGAGTATC 59.003 41.667 7.86 0.00 40.77 2.24
436 437 4.393062 CCACATATTTGGCGATGAGTATCC 59.607 45.833 0.00 0.00 0.00 2.59
437 438 5.240891 CACATATTTGGCGATGAGTATCCT 58.759 41.667 0.00 0.00 0.00 3.24
438 439 5.702670 CACATATTTGGCGATGAGTATCCTT 59.297 40.000 0.00 0.00 0.00 3.36
439 440 6.205464 CACATATTTGGCGATGAGTATCCTTT 59.795 38.462 0.00 0.00 0.00 3.11
440 441 6.772716 ACATATTTGGCGATGAGTATCCTTTT 59.227 34.615 0.00 0.00 0.00 2.27
441 442 7.285401 ACATATTTGGCGATGAGTATCCTTTTT 59.715 33.333 0.00 0.00 0.00 1.94
471 472 1.963172 AAAGTCGACCAAGTTGTCCC 58.037 50.000 13.01 0.00 31.35 4.46
472 473 0.108019 AAGTCGACCAAGTTGTCCCC 59.892 55.000 13.01 0.00 31.35 4.81
473 474 0.763223 AGTCGACCAAGTTGTCCCCT 60.763 55.000 13.01 0.00 31.35 4.79
474 475 0.971386 GTCGACCAAGTTGTCCCCTA 59.029 55.000 3.51 0.00 31.35 3.53
475 476 1.345415 GTCGACCAAGTTGTCCCCTAA 59.655 52.381 3.51 0.00 31.35 2.69
476 477 2.048601 TCGACCAAGTTGTCCCCTAAA 58.951 47.619 1.45 0.00 31.35 1.85
477 478 2.438763 TCGACCAAGTTGTCCCCTAAAA 59.561 45.455 1.45 0.00 31.35 1.52
478 479 3.117963 TCGACCAAGTTGTCCCCTAAAAA 60.118 43.478 1.45 0.00 31.35 1.94
499 500 5.479716 AAAAACTCGACCAAGTTGTGTAG 57.520 39.130 1.45 0.79 39.40 2.74
500 501 4.395959 AAACTCGACCAAGTTGTGTAGA 57.604 40.909 1.45 4.92 39.40 2.59
501 502 3.644884 ACTCGACCAAGTTGTGTAGAG 57.355 47.619 21.60 21.60 39.31 2.43
502 503 3.220110 ACTCGACCAAGTTGTGTAGAGA 58.780 45.455 26.08 13.82 37.57 3.10
503 504 3.827302 ACTCGACCAAGTTGTGTAGAGAT 59.173 43.478 26.08 15.42 37.57 2.75
504 505 4.281182 ACTCGACCAAGTTGTGTAGAGATT 59.719 41.667 26.08 12.61 37.57 2.40
505 506 4.556233 TCGACCAAGTTGTGTAGAGATTG 58.444 43.478 1.45 0.00 0.00 2.67
506 507 3.123621 CGACCAAGTTGTGTAGAGATTGC 59.876 47.826 1.45 0.00 0.00 3.56
507 508 3.067106 ACCAAGTTGTGTAGAGATTGCG 58.933 45.455 1.45 0.00 0.00 4.85
508 509 3.244078 ACCAAGTTGTGTAGAGATTGCGA 60.244 43.478 1.45 0.00 0.00 5.10
509 510 3.123621 CCAAGTTGTGTAGAGATTGCGAC 59.876 47.826 1.45 0.00 0.00 5.19
510 511 3.944055 AGTTGTGTAGAGATTGCGACT 57.056 42.857 0.00 0.00 0.00 4.18
511 512 5.161358 CAAGTTGTGTAGAGATTGCGACTA 58.839 41.667 0.00 0.00 0.00 2.59
512 513 5.386958 AGTTGTGTAGAGATTGCGACTAA 57.613 39.130 0.00 0.00 0.00 2.24
513 514 5.779922 AGTTGTGTAGAGATTGCGACTAAA 58.220 37.500 0.00 0.00 0.00 1.85
514 515 6.220930 AGTTGTGTAGAGATTGCGACTAAAA 58.779 36.000 0.00 0.00 0.00 1.52
515 516 6.704493 AGTTGTGTAGAGATTGCGACTAAAAA 59.296 34.615 0.00 0.00 0.00 1.94
516 517 6.706055 TGTGTAGAGATTGCGACTAAAAAG 57.294 37.500 0.00 0.00 0.00 2.27
517 518 6.452242 TGTGTAGAGATTGCGACTAAAAAGA 58.548 36.000 0.00 0.00 0.00 2.52
518 519 6.926826 TGTGTAGAGATTGCGACTAAAAAGAA 59.073 34.615 0.00 0.00 0.00 2.52
519 520 7.439955 TGTGTAGAGATTGCGACTAAAAAGAAA 59.560 33.333 0.00 0.00 0.00 2.52
520 521 7.952637 GTGTAGAGATTGCGACTAAAAAGAAAG 59.047 37.037 0.00 0.00 0.00 2.62
521 522 7.656137 TGTAGAGATTGCGACTAAAAAGAAAGT 59.344 33.333 0.00 0.00 0.00 2.66
522 523 7.497925 AGAGATTGCGACTAAAAAGAAAGTT 57.502 32.000 0.00 0.00 0.00 2.66
523 524 7.355778 AGAGATTGCGACTAAAAAGAAAGTTG 58.644 34.615 0.00 0.00 0.00 3.16
524 525 7.012421 AGAGATTGCGACTAAAAAGAAAGTTGT 59.988 33.333 0.00 0.00 30.93 3.32
525 526 6.912591 AGATTGCGACTAAAAAGAAAGTTGTG 59.087 34.615 0.00 0.00 30.93 3.33
526 527 5.554822 TGCGACTAAAAAGAAAGTTGTGT 57.445 34.783 0.00 0.00 30.93 3.72
527 528 6.665474 TGCGACTAAAAAGAAAGTTGTGTA 57.335 33.333 0.00 0.00 30.93 2.90
528 529 6.711579 TGCGACTAAAAAGAAAGTTGTGTAG 58.288 36.000 0.00 0.00 30.93 2.74
529 530 6.134061 GCGACTAAAAAGAAAGTTGTGTAGG 58.866 40.000 0.00 0.00 30.93 3.18
530 531 6.134061 CGACTAAAAAGAAAGTTGTGTAGGC 58.866 40.000 0.00 0.00 0.00 3.93
531 532 6.056428 ACTAAAAAGAAAGTTGTGTAGGCG 57.944 37.500 0.00 0.00 0.00 5.52
532 533 5.818857 ACTAAAAAGAAAGTTGTGTAGGCGA 59.181 36.000 0.00 0.00 0.00 5.54
533 534 5.570234 AAAAAGAAAGTTGTGTAGGCGAA 57.430 34.783 0.00 0.00 0.00 4.70
534 535 5.767816 AAAAGAAAGTTGTGTAGGCGAAT 57.232 34.783 0.00 0.00 0.00 3.34
535 536 5.358298 AAAGAAAGTTGTGTAGGCGAATC 57.642 39.130 0.00 0.00 0.00 2.52
536 537 4.002906 AGAAAGTTGTGTAGGCGAATCA 57.997 40.909 0.00 0.00 0.00 2.57
537 538 4.385825 AGAAAGTTGTGTAGGCGAATCAA 58.614 39.130 0.00 0.00 0.00 2.57
538 539 4.213482 AGAAAGTTGTGTAGGCGAATCAAC 59.787 41.667 9.36 9.36 38.69 3.18
539 540 3.120321 AGTTGTGTAGGCGAATCAACA 57.880 42.857 16.03 0.00 40.19 3.33
540 541 3.674997 AGTTGTGTAGGCGAATCAACAT 58.325 40.909 16.03 4.40 40.19 2.71
541 542 3.436704 AGTTGTGTAGGCGAATCAACATG 59.563 43.478 16.03 0.00 40.19 3.21
542 543 3.052455 TGTGTAGGCGAATCAACATGT 57.948 42.857 0.00 0.00 0.00 3.21
543 544 2.741517 TGTGTAGGCGAATCAACATGTG 59.258 45.455 0.00 0.00 0.00 3.21
544 545 2.095853 GTGTAGGCGAATCAACATGTGG 59.904 50.000 0.00 0.00 0.00 4.17
545 546 2.290008 TGTAGGCGAATCAACATGTGGT 60.290 45.455 0.00 0.00 0.00 4.16
546 547 1.909700 AGGCGAATCAACATGTGGTT 58.090 45.000 0.00 0.00 41.47 3.67
558 559 3.486383 ACATGTGGTTGAGTTGGTTAGG 58.514 45.455 0.00 0.00 0.00 2.69
559 560 3.117663 ACATGTGGTTGAGTTGGTTAGGT 60.118 43.478 0.00 0.00 0.00 3.08
560 561 2.925724 TGTGGTTGAGTTGGTTAGGTG 58.074 47.619 0.00 0.00 0.00 4.00
561 562 2.227194 GTGGTTGAGTTGGTTAGGTGG 58.773 52.381 0.00 0.00 0.00 4.61
562 563 2.128535 TGGTTGAGTTGGTTAGGTGGA 58.871 47.619 0.00 0.00 0.00 4.02
563 564 2.158726 TGGTTGAGTTGGTTAGGTGGAC 60.159 50.000 0.00 0.00 0.00 4.02
564 565 2.158726 GGTTGAGTTGGTTAGGTGGACA 60.159 50.000 0.00 0.00 0.00 4.02
565 566 3.139077 GTTGAGTTGGTTAGGTGGACAG 58.861 50.000 0.00 0.00 0.00 3.51
566 567 2.404559 TGAGTTGGTTAGGTGGACAGT 58.595 47.619 0.00 0.00 0.00 3.55
567 568 2.104111 TGAGTTGGTTAGGTGGACAGTG 59.896 50.000 0.00 0.00 0.00 3.66
568 569 1.420138 AGTTGGTTAGGTGGACAGTGG 59.580 52.381 0.00 0.00 0.00 4.00
569 570 1.142262 GTTGGTTAGGTGGACAGTGGT 59.858 52.381 0.00 0.00 0.00 4.16
570 571 2.369532 GTTGGTTAGGTGGACAGTGGTA 59.630 50.000 0.00 0.00 0.00 3.25
571 572 2.910544 TGGTTAGGTGGACAGTGGTAT 58.089 47.619 0.00 0.00 0.00 2.73
572 573 2.835764 TGGTTAGGTGGACAGTGGTATC 59.164 50.000 0.00 0.00 0.00 2.24
573 574 3.105283 GGTTAGGTGGACAGTGGTATCT 58.895 50.000 0.00 0.00 0.00 1.98
574 575 3.132467 GGTTAGGTGGACAGTGGTATCTC 59.868 52.174 0.00 0.00 0.00 2.75
575 576 1.867363 AGGTGGACAGTGGTATCTCC 58.133 55.000 0.00 0.00 0.00 3.71
576 577 1.078823 AGGTGGACAGTGGTATCTCCA 59.921 52.381 0.00 0.00 45.01 3.86
584 585 3.503974 TGGTATCTCCAACCCACCA 57.496 52.632 0.00 0.00 44.12 4.17
585 586 1.285280 TGGTATCTCCAACCCACCAG 58.715 55.000 0.00 0.00 44.12 4.00
586 587 0.546598 GGTATCTCCAACCCACCAGG 59.453 60.000 0.00 0.00 37.70 4.45
602 603 3.363787 AGGGTTCAAATCCTGGTGC 57.636 52.632 0.00 0.00 38.36 5.01
603 604 0.779997 AGGGTTCAAATCCTGGTGCT 59.220 50.000 0.00 0.00 38.36 4.40
604 605 1.177401 GGGTTCAAATCCTGGTGCTC 58.823 55.000 0.00 0.00 0.00 4.26
605 606 0.804989 GGTTCAAATCCTGGTGCTCG 59.195 55.000 0.00 0.00 0.00 5.03
606 607 0.169009 GTTCAAATCCTGGTGCTCGC 59.831 55.000 0.00 0.00 0.00 5.03
607 608 0.250684 TTCAAATCCTGGTGCTCGCA 60.251 50.000 0.00 0.00 0.00 5.10
608 609 0.035152 TCAAATCCTGGTGCTCGCAT 60.035 50.000 0.00 0.00 0.00 4.73
609 610 0.813184 CAAATCCTGGTGCTCGCATT 59.187 50.000 0.00 0.00 0.00 3.56
610 611 2.016318 CAAATCCTGGTGCTCGCATTA 58.984 47.619 0.00 0.00 0.00 1.90
611 612 2.620115 CAAATCCTGGTGCTCGCATTAT 59.380 45.455 0.00 0.00 0.00 1.28
612 613 2.645838 ATCCTGGTGCTCGCATTATT 57.354 45.000 0.00 0.00 0.00 1.40
613 614 1.953559 TCCTGGTGCTCGCATTATTC 58.046 50.000 0.00 0.00 0.00 1.75
614 615 0.947244 CCTGGTGCTCGCATTATTCC 59.053 55.000 0.00 0.00 0.00 3.01
615 616 1.475751 CCTGGTGCTCGCATTATTCCT 60.476 52.381 0.00 0.00 0.00 3.36
616 617 1.600957 CTGGTGCTCGCATTATTCCTG 59.399 52.381 0.00 0.00 0.00 3.86
617 618 0.947244 GGTGCTCGCATTATTCCTGG 59.053 55.000 0.00 0.00 0.00 4.45
618 619 1.475034 GGTGCTCGCATTATTCCTGGA 60.475 52.381 0.00 0.00 0.00 3.86
619 620 2.498167 GTGCTCGCATTATTCCTGGAT 58.502 47.619 0.00 0.00 0.00 3.41
620 621 2.880890 GTGCTCGCATTATTCCTGGATT 59.119 45.455 0.00 0.00 0.00 3.01
621 622 3.316308 GTGCTCGCATTATTCCTGGATTT 59.684 43.478 0.00 0.00 0.00 2.17
622 623 4.515191 GTGCTCGCATTATTCCTGGATTTA 59.485 41.667 0.00 0.00 0.00 1.40
623 624 5.182001 GTGCTCGCATTATTCCTGGATTTAT 59.818 40.000 0.00 0.00 0.00 1.40
624 625 5.769662 TGCTCGCATTATTCCTGGATTTATT 59.230 36.000 0.00 0.00 0.00 1.40
625 626 6.265196 TGCTCGCATTATTCCTGGATTTATTT 59.735 34.615 0.00 0.00 0.00 1.40
626 627 6.803807 GCTCGCATTATTCCTGGATTTATTTC 59.196 38.462 0.00 0.00 0.00 2.17
627 628 7.522073 GCTCGCATTATTCCTGGATTTATTTCA 60.522 37.037 0.00 0.00 0.00 2.69
628 629 7.874940 TCGCATTATTCCTGGATTTATTTCAG 58.125 34.615 0.00 0.00 0.00 3.02
629 630 7.040478 TCGCATTATTCCTGGATTTATTTCAGG 60.040 37.037 0.00 0.00 46.91 3.86
637 638 6.076981 CTGGATTTATTTCAGGATTTCGGG 57.923 41.667 0.00 0.00 0.00 5.14
638 639 5.515106 TGGATTTATTTCAGGATTTCGGGT 58.485 37.500 0.00 0.00 0.00 5.28
639 640 5.359576 TGGATTTATTTCAGGATTTCGGGTG 59.640 40.000 0.00 0.00 0.00 4.61
640 641 5.592688 GGATTTATTTCAGGATTTCGGGTGA 59.407 40.000 0.00 0.00 0.00 4.02
641 642 6.265422 GGATTTATTTCAGGATTTCGGGTGAT 59.735 38.462 0.00 0.00 0.00 3.06
642 643 6.449635 TTTATTTCAGGATTTCGGGTGATG 57.550 37.500 0.00 0.00 0.00 3.07
643 644 3.433306 TTTCAGGATTTCGGGTGATGT 57.567 42.857 0.00 0.00 0.00 3.06
644 645 2.401583 TCAGGATTTCGGGTGATGTG 57.598 50.000 0.00 0.00 0.00 3.21
645 646 0.734889 CAGGATTTCGGGTGATGTGC 59.265 55.000 0.00 0.00 0.00 4.57
646 647 0.620556 AGGATTTCGGGTGATGTGCT 59.379 50.000 0.00 0.00 0.00 4.40
647 648 1.004745 AGGATTTCGGGTGATGTGCTT 59.995 47.619 0.00 0.00 0.00 3.91
648 649 1.818674 GGATTTCGGGTGATGTGCTTT 59.181 47.619 0.00 0.00 0.00 3.51
649 650 2.159379 GGATTTCGGGTGATGTGCTTTC 60.159 50.000 0.00 0.00 0.00 2.62
650 651 1.974265 TTTCGGGTGATGTGCTTTCA 58.026 45.000 0.00 0.00 0.00 2.69
651 652 1.522668 TTCGGGTGATGTGCTTTCAG 58.477 50.000 0.00 0.00 0.00 3.02
652 653 0.396435 TCGGGTGATGTGCTTTCAGT 59.604 50.000 0.00 0.00 0.00 3.41
653 654 0.518636 CGGGTGATGTGCTTTCAGTG 59.481 55.000 0.00 0.00 0.00 3.66
654 655 0.883833 GGGTGATGTGCTTTCAGTGG 59.116 55.000 0.00 0.00 0.00 4.00
655 656 0.883833 GGTGATGTGCTTTCAGTGGG 59.116 55.000 0.00 0.00 0.00 4.61
656 657 1.545428 GGTGATGTGCTTTCAGTGGGA 60.545 52.381 0.00 0.00 0.00 4.37
657 658 1.808945 GTGATGTGCTTTCAGTGGGAG 59.191 52.381 0.00 0.00 0.00 4.30
658 659 1.271543 TGATGTGCTTTCAGTGGGAGG 60.272 52.381 0.00 0.00 0.00 4.30
659 660 1.003580 GATGTGCTTTCAGTGGGAGGA 59.996 52.381 0.00 0.00 0.00 3.71
660 661 0.397941 TGTGCTTTCAGTGGGAGGAG 59.602 55.000 0.00 0.00 0.00 3.69
661 662 0.687354 GTGCTTTCAGTGGGAGGAGA 59.313 55.000 0.00 0.00 0.00 3.71
662 663 0.687354 TGCTTTCAGTGGGAGGAGAC 59.313 55.000 0.00 0.00 0.00 3.36
663 664 0.390472 GCTTTCAGTGGGAGGAGACG 60.390 60.000 0.00 0.00 0.00 4.18
664 665 0.969894 CTTTCAGTGGGAGGAGACGT 59.030 55.000 0.00 0.00 0.00 4.34
665 666 1.344763 CTTTCAGTGGGAGGAGACGTT 59.655 52.381 0.00 0.00 0.00 3.99
666 667 0.966920 TTCAGTGGGAGGAGACGTTC 59.033 55.000 0.00 0.00 0.00 3.95
674 675 4.790861 GGAGACGTTCCCGCCGAC 62.791 72.222 0.00 0.00 40.37 4.79
689 690 4.883300 GACGACGAGGCGCCTACG 62.883 72.222 32.91 32.91 44.07 3.51
692 693 4.849329 GACGAGGCGCCTACGGTG 62.849 72.222 34.97 23.88 40.57 4.94
694 695 4.849329 CGAGGCGCCTACGGTGAC 62.849 72.222 32.97 14.51 42.50 3.67
697 698 2.047560 GGCGCCTACGGTGACTTT 60.048 61.111 22.15 0.00 38.38 2.66
698 699 2.388232 GGCGCCTACGGTGACTTTG 61.388 63.158 22.15 0.00 38.38 2.77
699 700 1.666872 GCGCCTACGGTGACTTTGT 60.667 57.895 0.00 0.00 40.57 2.83
700 701 0.388907 GCGCCTACGGTGACTTTGTA 60.389 55.000 0.00 0.00 40.57 2.41
701 702 1.936203 GCGCCTACGGTGACTTTGTAA 60.936 52.381 0.00 0.00 40.57 2.41
702 703 2.406130 CGCCTACGGTGACTTTGTAAA 58.594 47.619 0.00 0.00 34.74 2.01
703 704 2.997986 CGCCTACGGTGACTTTGTAAAT 59.002 45.455 0.00 0.00 34.74 1.40
704 705 3.061697 CGCCTACGGTGACTTTGTAAATC 59.938 47.826 0.00 0.00 34.74 2.17
705 706 4.251268 GCCTACGGTGACTTTGTAAATCT 58.749 43.478 0.00 0.00 0.00 2.40
706 707 4.329256 GCCTACGGTGACTTTGTAAATCTC 59.671 45.833 0.00 0.00 0.00 2.75
707 708 5.475719 CCTACGGTGACTTTGTAAATCTCA 58.524 41.667 0.00 0.00 0.00 3.27
708 709 5.929992 CCTACGGTGACTTTGTAAATCTCAA 59.070 40.000 0.00 0.00 0.00 3.02
709 710 5.924475 ACGGTGACTTTGTAAATCTCAAG 57.076 39.130 0.00 0.00 0.00 3.02
710 711 5.607477 ACGGTGACTTTGTAAATCTCAAGA 58.393 37.500 0.00 0.00 0.00 3.02
711 712 6.231211 ACGGTGACTTTGTAAATCTCAAGAT 58.769 36.000 0.00 0.00 36.07 2.40
712 713 6.147821 ACGGTGACTTTGTAAATCTCAAGATG 59.852 38.462 0.00 0.00 34.49 2.90
713 714 6.368791 CGGTGACTTTGTAAATCTCAAGATGA 59.631 38.462 0.00 0.00 34.49 2.92
714 715 7.065085 CGGTGACTTTGTAAATCTCAAGATGAT 59.935 37.037 0.00 0.00 34.49 2.45
715 716 9.383519 GGTGACTTTGTAAATCTCAAGATGATA 57.616 33.333 0.00 0.00 34.49 2.15
718 719 9.875675 GACTTTGTAAATCTCAAGATGATATGC 57.124 33.333 0.00 0.00 34.49 3.14
719 720 8.844244 ACTTTGTAAATCTCAAGATGATATGCC 58.156 33.333 0.00 0.00 34.49 4.40
720 721 7.425577 TTGTAAATCTCAAGATGATATGCCG 57.574 36.000 0.00 0.00 34.49 5.69
721 722 5.934043 TGTAAATCTCAAGATGATATGCCGG 59.066 40.000 0.00 0.00 34.49 6.13
722 723 2.462456 TCTCAAGATGATATGCCGGC 57.538 50.000 22.73 22.73 0.00 6.13
723 724 1.973515 TCTCAAGATGATATGCCGGCT 59.026 47.619 29.70 15.76 0.00 5.52
724 725 2.028658 TCTCAAGATGATATGCCGGCTC 60.029 50.000 29.70 17.89 0.00 4.70
725 726 1.693606 TCAAGATGATATGCCGGCTCA 59.306 47.619 29.70 23.34 0.00 4.26
726 727 2.074576 CAAGATGATATGCCGGCTCAG 58.925 52.381 29.70 7.35 0.00 3.35
727 728 1.346062 AGATGATATGCCGGCTCAGT 58.654 50.000 29.70 13.44 0.00 3.41
728 729 1.274728 AGATGATATGCCGGCTCAGTC 59.725 52.381 29.70 19.55 0.00 3.51
729 730 1.274728 GATGATATGCCGGCTCAGTCT 59.725 52.381 29.70 8.26 0.00 3.24
730 731 0.676184 TGATATGCCGGCTCAGTCTC 59.324 55.000 29.70 15.31 0.00 3.36
731 732 0.965439 GATATGCCGGCTCAGTCTCT 59.035 55.000 29.70 3.16 0.00 3.10
732 733 0.965439 ATATGCCGGCTCAGTCTCTC 59.035 55.000 29.70 0.00 0.00 3.20
733 734 1.448119 TATGCCGGCTCAGTCTCTCG 61.448 60.000 29.70 0.00 0.00 4.04
734 735 4.200283 GCCGGCTCAGTCTCTCGG 62.200 72.222 22.15 0.00 43.13 4.63
735 736 2.438614 CCGGCTCAGTCTCTCGGA 60.439 66.667 0.00 0.00 42.94 4.55
736 737 2.477176 CCGGCTCAGTCTCTCGGAG 61.477 68.421 0.00 0.00 42.94 4.63
737 738 2.477176 CGGCTCAGTCTCTCGGAGG 61.477 68.421 4.96 0.00 38.48 4.30
738 739 1.379309 GGCTCAGTCTCTCGGAGGT 60.379 63.158 4.96 0.00 38.48 3.85
739 740 1.662438 GGCTCAGTCTCTCGGAGGTG 61.662 65.000 4.96 0.00 38.48 4.00
740 741 1.806568 CTCAGTCTCTCGGAGGTGC 59.193 63.158 4.96 0.00 35.32 5.01
741 742 0.679640 CTCAGTCTCTCGGAGGTGCT 60.680 60.000 4.96 0.00 35.32 4.40
742 743 0.678366 TCAGTCTCTCGGAGGTGCTC 60.678 60.000 4.96 0.00 0.00 4.26
743 744 0.962855 CAGTCTCTCGGAGGTGCTCA 60.963 60.000 4.96 0.00 31.08 4.26
744 745 0.033601 AGTCTCTCGGAGGTGCTCAT 60.034 55.000 4.96 0.00 31.08 2.90
745 746 1.213182 AGTCTCTCGGAGGTGCTCATA 59.787 52.381 4.96 0.00 31.08 2.15
746 747 1.606668 GTCTCTCGGAGGTGCTCATAG 59.393 57.143 4.96 0.00 31.08 2.23
747 748 0.958091 CTCTCGGAGGTGCTCATAGG 59.042 60.000 4.96 0.00 31.08 2.57
748 749 0.468214 TCTCGGAGGTGCTCATAGGG 60.468 60.000 4.96 0.00 31.08 3.53
749 750 1.457643 TCGGAGGTGCTCATAGGGG 60.458 63.158 0.00 0.00 31.08 4.79
750 751 1.762460 CGGAGGTGCTCATAGGGGT 60.762 63.158 0.00 0.00 31.08 4.95
751 752 0.469331 CGGAGGTGCTCATAGGGGTA 60.469 60.000 0.00 0.00 31.08 3.69
752 753 1.343069 GGAGGTGCTCATAGGGGTAG 58.657 60.000 0.00 0.00 31.08 3.18
753 754 1.343069 GAGGTGCTCATAGGGGTAGG 58.657 60.000 0.00 0.00 0.00 3.18
754 755 0.104934 AGGTGCTCATAGGGGTAGGG 60.105 60.000 0.00 0.00 0.00 3.53
755 756 0.400093 GGTGCTCATAGGGGTAGGGT 60.400 60.000 0.00 0.00 0.00 4.34
756 757 0.759346 GTGCTCATAGGGGTAGGGTG 59.241 60.000 0.00 0.00 0.00 4.61
757 758 0.341961 TGCTCATAGGGGTAGGGTGT 59.658 55.000 0.00 0.00 0.00 4.16
758 759 0.759346 GCTCATAGGGGTAGGGTGTG 59.241 60.000 0.00 0.00 0.00 3.82
759 760 0.759346 CTCATAGGGGTAGGGTGTGC 59.241 60.000 0.00 0.00 0.00 4.57
760 761 1.046472 TCATAGGGGTAGGGTGTGCG 61.046 60.000 0.00 0.00 0.00 5.34
761 762 1.002533 ATAGGGGTAGGGTGTGCGT 59.997 57.895 0.00 0.00 0.00 5.24
762 763 1.335132 ATAGGGGTAGGGTGTGCGTG 61.335 60.000 0.00 0.00 0.00 5.34
763 764 2.735151 TAGGGGTAGGGTGTGCGTGT 62.735 60.000 0.00 0.00 0.00 4.49
764 765 2.358247 GGGTAGGGTGTGCGTGTG 60.358 66.667 0.00 0.00 0.00 3.82
765 766 2.424302 GGTAGGGTGTGCGTGTGT 59.576 61.111 0.00 0.00 0.00 3.72
766 767 1.959226 GGTAGGGTGTGCGTGTGTG 60.959 63.158 0.00 0.00 0.00 3.82
767 768 2.280524 TAGGGTGTGCGTGTGTGC 60.281 61.111 0.00 0.00 0.00 4.57
770 771 3.871574 GGTGTGCGTGTGTGCGTT 61.872 61.111 0.00 0.00 37.81 4.84
771 772 2.350760 GTGTGCGTGTGTGCGTTC 60.351 61.111 0.00 0.00 37.81 3.95
772 773 2.815647 TGTGCGTGTGTGCGTTCA 60.816 55.556 0.00 0.00 37.81 3.18
773 774 2.176926 TGTGCGTGTGTGCGTTCAT 61.177 52.632 0.00 0.00 37.81 2.57
774 775 0.876342 TGTGCGTGTGTGCGTTCATA 60.876 50.000 0.00 0.00 37.81 2.15
775 776 0.179250 GTGCGTGTGTGCGTTCATAG 60.179 55.000 0.00 0.00 37.81 2.23
776 777 1.288419 TGCGTGTGTGCGTTCATAGG 61.288 55.000 0.00 0.00 37.81 2.57
777 778 1.966493 GCGTGTGTGCGTTCATAGGG 61.966 60.000 0.00 0.00 0.00 3.53
778 779 0.389296 CGTGTGTGCGTTCATAGGGA 60.389 55.000 0.00 0.00 0.00 4.20
779 780 1.739035 CGTGTGTGCGTTCATAGGGAT 60.739 52.381 0.00 0.00 0.00 3.85
780 781 1.665679 GTGTGTGCGTTCATAGGGATG 59.334 52.381 0.00 0.00 0.00 3.51
781 782 1.552792 TGTGTGCGTTCATAGGGATGA 59.447 47.619 0.00 0.00 40.45 2.92
782 783 2.205074 GTGTGCGTTCATAGGGATGAG 58.795 52.381 0.00 0.00 43.03 2.90
783 784 1.831106 TGTGCGTTCATAGGGATGAGT 59.169 47.619 0.00 0.00 43.03 3.41
784 785 2.205074 GTGCGTTCATAGGGATGAGTG 58.795 52.381 0.00 0.00 43.03 3.51
785 786 1.831106 TGCGTTCATAGGGATGAGTGT 59.169 47.619 0.00 0.00 43.03 3.55
786 787 3.028130 TGCGTTCATAGGGATGAGTGTA 58.972 45.455 0.00 0.00 43.03 2.90
787 788 3.641436 TGCGTTCATAGGGATGAGTGTAT 59.359 43.478 0.00 0.00 43.03 2.29
788 789 3.990469 GCGTTCATAGGGATGAGTGTATG 59.010 47.826 0.00 0.00 43.03 2.39
789 790 3.990469 CGTTCATAGGGATGAGTGTATGC 59.010 47.826 0.00 0.00 43.03 3.14
790 791 3.942130 TCATAGGGATGAGTGTATGCG 57.058 47.619 0.00 0.00 37.15 4.73
791 792 2.029020 TCATAGGGATGAGTGTATGCGC 60.029 50.000 0.00 0.00 37.15 6.09
792 793 0.313987 TAGGGATGAGTGTATGCGCG 59.686 55.000 0.00 0.00 0.00 6.86
793 794 1.227263 GGGATGAGTGTATGCGCGT 60.227 57.895 8.43 7.55 0.00 6.01
794 795 1.490693 GGGATGAGTGTATGCGCGTG 61.491 60.000 13.61 0.00 0.00 5.34
795 796 0.806102 GGATGAGTGTATGCGCGTGT 60.806 55.000 13.61 0.00 0.00 4.49
796 797 1.535226 GGATGAGTGTATGCGCGTGTA 60.535 52.381 13.61 0.00 0.00 2.90
797 798 2.394708 GATGAGTGTATGCGCGTGTAT 58.605 47.619 13.61 4.63 0.00 2.29
798 799 3.561503 GATGAGTGTATGCGCGTGTATA 58.438 45.455 13.61 2.40 0.00 1.47
799 800 3.636282 TGAGTGTATGCGCGTGTATAT 57.364 42.857 13.61 0.00 0.00 0.86
800 801 3.305110 TGAGTGTATGCGCGTGTATATG 58.695 45.455 13.61 0.00 0.00 1.78
801 802 3.003897 TGAGTGTATGCGCGTGTATATGA 59.996 43.478 13.61 0.00 0.00 2.15
802 803 3.565516 AGTGTATGCGCGTGTATATGAG 58.434 45.455 13.61 0.00 0.00 2.90
803 804 2.090658 GTGTATGCGCGTGTATATGAGC 59.909 50.000 13.61 0.41 38.85 4.26
806 807 4.228451 CGCGTGTATATGAGCGCT 57.772 55.556 11.27 11.27 46.56 5.92
807 808 2.506544 CGCGTGTATATGAGCGCTT 58.493 52.632 13.26 0.00 46.56 4.68
808 809 1.681825 CGCGTGTATATGAGCGCTTA 58.318 50.000 13.26 8.30 46.56 3.09
809 810 2.251040 CGCGTGTATATGAGCGCTTAT 58.749 47.619 19.33 19.33 46.56 1.73
810 811 2.026860 CGCGTGTATATGAGCGCTTATG 59.973 50.000 23.64 7.66 46.56 1.90
811 812 2.987149 GCGTGTATATGAGCGCTTATGT 59.013 45.455 23.64 19.44 45.48 2.29
812 813 3.059570 GCGTGTATATGAGCGCTTATGTC 59.940 47.826 23.64 13.69 45.48 3.06
813 814 4.476862 CGTGTATATGAGCGCTTATGTCT 58.523 43.478 23.64 11.09 0.00 3.41
814 815 4.322009 CGTGTATATGAGCGCTTATGTCTG 59.678 45.833 23.64 5.88 0.00 3.51
815 816 5.223382 GTGTATATGAGCGCTTATGTCTGT 58.777 41.667 23.64 7.75 0.00 3.41
816 817 6.379386 GTGTATATGAGCGCTTATGTCTGTA 58.621 40.000 23.64 3.74 0.00 2.74
817 818 6.305877 GTGTATATGAGCGCTTATGTCTGTAC 59.694 42.308 23.64 16.58 0.00 2.90
818 819 5.713792 ATATGAGCGCTTATGTCTGTACT 57.286 39.130 23.64 0.00 0.00 2.73
819 820 3.150848 TGAGCGCTTATGTCTGTACTG 57.849 47.619 13.26 0.00 0.00 2.74
820 821 2.752903 TGAGCGCTTATGTCTGTACTGA 59.247 45.455 13.26 0.00 0.00 3.41
821 822 3.381590 TGAGCGCTTATGTCTGTACTGAT 59.618 43.478 13.26 0.00 0.00 2.90
822 823 3.711086 AGCGCTTATGTCTGTACTGATG 58.289 45.455 2.64 0.00 0.00 3.07
823 824 2.219674 GCGCTTATGTCTGTACTGATGC 59.780 50.000 0.00 5.48 0.00 3.91
824 825 3.711086 CGCTTATGTCTGTACTGATGCT 58.289 45.455 5.69 0.00 0.00 3.79
825 826 4.793028 GCGCTTATGTCTGTACTGATGCTA 60.793 45.833 0.00 0.00 0.00 3.49
826 827 5.281727 CGCTTATGTCTGTACTGATGCTAA 58.718 41.667 5.69 4.27 0.00 3.09
827 828 5.748630 CGCTTATGTCTGTACTGATGCTAAA 59.251 40.000 5.69 0.00 0.00 1.85
828 829 6.255670 CGCTTATGTCTGTACTGATGCTAAAA 59.744 38.462 5.69 0.00 0.00 1.52
829 830 7.201522 CGCTTATGTCTGTACTGATGCTAAAAA 60.202 37.037 5.69 0.00 0.00 1.94
860 861 8.908786 AAAAGAAAGTTGTGTAGAGATGATCA 57.091 30.769 0.00 0.00 0.00 2.92
861 862 7.897575 AAGAAAGTTGTGTAGAGATGATCAC 57.102 36.000 0.00 0.00 0.00 3.06
862 863 6.997655 AGAAAGTTGTGTAGAGATGATCACA 58.002 36.000 0.00 0.00 38.71 3.58
863 864 6.870965 AGAAAGTTGTGTAGAGATGATCACAC 59.129 38.462 0.00 7.38 39.89 3.82
864 865 5.728637 AGTTGTGTAGAGATGATCACACA 57.271 39.130 11.69 11.69 42.72 3.72
865 866 5.473931 AGTTGTGTAGAGATGATCACACAC 58.526 41.667 14.41 14.06 43.40 3.82
866 867 4.096732 TGTGTAGAGATGATCACACACG 57.903 45.455 11.69 0.00 43.69 4.49
867 868 3.506067 TGTGTAGAGATGATCACACACGT 59.494 43.478 11.69 0.00 43.69 4.49
868 869 4.698304 TGTGTAGAGATGATCACACACGTA 59.302 41.667 11.69 0.00 43.69 3.57
869 870 5.029014 GTGTAGAGATGATCACACACGTAC 58.971 45.833 0.00 0.00 38.62 3.67
870 871 3.406728 AGAGATGATCACACACGTACG 57.593 47.619 15.01 15.01 0.00 3.67
871 872 3.007635 AGAGATGATCACACACGTACGA 58.992 45.455 24.41 0.00 0.00 3.43
872 873 3.099362 GAGATGATCACACACGTACGAC 58.901 50.000 24.41 3.35 0.00 4.34
873 874 2.159421 AGATGATCACACACGTACGACC 60.159 50.000 24.41 2.09 0.00 4.79
874 875 0.953003 TGATCACACACGTACGACCA 59.047 50.000 24.41 4.63 0.00 4.02
875 876 1.337387 TGATCACACACGTACGACCAA 59.663 47.619 24.41 2.27 0.00 3.67
876 877 2.223758 TGATCACACACGTACGACCAAA 60.224 45.455 24.41 2.85 0.00 3.28
877 878 1.842720 TCACACACGTACGACCAAAG 58.157 50.000 24.41 7.13 0.00 2.77
878 879 1.404748 TCACACACGTACGACCAAAGA 59.595 47.619 24.41 9.41 0.00 2.52
879 880 2.159268 TCACACACGTACGACCAAAGAA 60.159 45.455 24.41 0.00 0.00 2.52
880 881 2.604011 CACACACGTACGACCAAAGAAA 59.396 45.455 24.41 0.00 0.00 2.52
881 882 3.246699 CACACACGTACGACCAAAGAAAT 59.753 43.478 24.41 0.00 0.00 2.17
882 883 3.872771 ACACACGTACGACCAAAGAAATT 59.127 39.130 24.41 0.00 0.00 1.82
883 884 4.025480 ACACACGTACGACCAAAGAAATTC 60.025 41.667 24.41 0.00 0.00 2.17
884 885 4.210537 CACACGTACGACCAAAGAAATTCT 59.789 41.667 24.41 0.00 0.00 2.40
885 886 5.403166 CACACGTACGACCAAAGAAATTCTA 59.597 40.000 24.41 0.00 0.00 2.10
886 887 6.090358 CACACGTACGACCAAAGAAATTCTAT 59.910 38.462 24.41 0.00 0.00 1.98
887 888 7.274033 CACACGTACGACCAAAGAAATTCTATA 59.726 37.037 24.41 0.00 0.00 1.31
888 889 7.814107 ACACGTACGACCAAAGAAATTCTATAA 59.186 33.333 24.41 0.00 0.00 0.98
889 890 8.106348 CACGTACGACCAAAGAAATTCTATAAC 58.894 37.037 24.41 0.00 0.00 1.89
890 891 7.814107 ACGTACGACCAAAGAAATTCTATAACA 59.186 33.333 24.41 0.00 0.00 2.41
891 892 8.106348 CGTACGACCAAAGAAATTCTATAACAC 58.894 37.037 10.44 0.00 0.00 3.32
892 893 7.972832 ACGACCAAAGAAATTCTATAACACA 57.027 32.000 0.00 0.00 0.00 3.72
893 894 8.561738 ACGACCAAAGAAATTCTATAACACAT 57.438 30.769 0.00 0.00 0.00 3.21
894 895 9.010029 ACGACCAAAGAAATTCTATAACACATT 57.990 29.630 0.00 0.00 0.00 2.71
895 896 9.840427 CGACCAAAGAAATTCTATAACACATTT 57.160 29.630 0.00 0.00 0.00 2.32
897 898 9.423061 ACCAAAGAAATTCTATAACACATTTGC 57.577 29.630 0.00 0.00 0.00 3.68
898 899 9.421806 CCAAAGAAATTCTATAACACATTTGCA 57.578 29.630 0.00 0.00 0.00 4.08
914 915 3.893572 CATGTGCATGCGTCCTGA 58.106 55.556 14.09 0.00 31.39 3.86
915 916 1.426621 CATGTGCATGCGTCCTGAC 59.573 57.895 14.09 4.85 31.39 3.51
916 917 1.746615 ATGTGCATGCGTCCTGACC 60.747 57.895 14.09 0.00 0.00 4.02
917 918 3.127533 GTGCATGCGTCCTGACCC 61.128 66.667 14.09 0.00 0.00 4.46
918 919 3.321648 TGCATGCGTCCTGACCCT 61.322 61.111 14.09 0.00 0.00 4.34
919 920 2.512515 GCATGCGTCCTGACCCTC 60.513 66.667 0.00 0.00 0.00 4.30
920 921 2.981302 CATGCGTCCTGACCCTCA 59.019 61.111 0.00 0.00 0.00 3.86
921 922 1.296392 CATGCGTCCTGACCCTCAA 59.704 57.895 0.00 0.00 0.00 3.02
922 923 0.107508 CATGCGTCCTGACCCTCAAT 60.108 55.000 0.00 0.00 0.00 2.57
923 924 0.179000 ATGCGTCCTGACCCTCAATC 59.821 55.000 0.00 0.00 0.00 2.67
924 925 1.519455 GCGTCCTGACCCTCAATCG 60.519 63.158 0.00 0.00 0.00 3.34
925 926 1.519455 CGTCCTGACCCTCAATCGC 60.519 63.158 0.00 0.00 0.00 4.58
926 927 1.153349 GTCCTGACCCTCAATCGCC 60.153 63.158 0.00 0.00 0.00 5.54
927 928 1.612146 TCCTGACCCTCAATCGCCA 60.612 57.895 0.00 0.00 0.00 5.69
928 929 1.153289 CCTGACCCTCAATCGCCAG 60.153 63.158 0.00 0.00 0.00 4.85
929 930 1.153289 CTGACCCTCAATCGCCAGG 60.153 63.158 0.00 0.00 0.00 4.45
930 931 1.612146 TGACCCTCAATCGCCAGGA 60.612 57.895 0.00 0.00 30.32 3.86
931 932 1.144936 GACCCTCAATCGCCAGGAG 59.855 63.158 0.00 0.00 30.32 3.69
932 933 2.317149 GACCCTCAATCGCCAGGAGG 62.317 65.000 0.00 0.00 46.24 4.30
936 937 1.876322 CTCAATCGCCAGGAGGAATC 58.124 55.000 0.00 0.00 36.89 2.52
937 938 1.415659 CTCAATCGCCAGGAGGAATCT 59.584 52.381 0.00 0.00 36.89 2.40
938 939 1.139654 TCAATCGCCAGGAGGAATCTG 59.860 52.381 0.00 0.00 36.89 2.90
939 940 0.179034 AATCGCCAGGAGGAATCTGC 60.179 55.000 0.00 0.00 36.89 4.26
940 941 1.340399 ATCGCCAGGAGGAATCTGCA 61.340 55.000 0.00 0.00 36.89 4.41
941 942 1.078214 CGCCAGGAGGAATCTGCAA 60.078 57.895 0.00 0.00 36.89 4.08
942 943 1.094073 CGCCAGGAGGAATCTGCAAG 61.094 60.000 0.00 0.00 36.89 4.01
943 944 1.382692 GCCAGGAGGAATCTGCAAGC 61.383 60.000 0.00 0.00 36.89 4.01
944 945 0.034767 CCAGGAGGAATCTGCAAGCA 60.035 55.000 0.00 0.00 36.89 3.91
945 946 1.380524 CAGGAGGAATCTGCAAGCAG 58.619 55.000 15.67 15.67 44.86 4.24
946 947 0.255318 AGGAGGAATCTGCAAGCAGG 59.745 55.000 20.78 3.98 43.75 4.85
947 948 0.750911 GGAGGAATCTGCAAGCAGGG 60.751 60.000 20.78 0.00 43.75 4.45
948 949 0.750911 GAGGAATCTGCAAGCAGGGG 60.751 60.000 20.78 0.00 43.75 4.79
949 950 2.421399 GGAATCTGCAAGCAGGGGC 61.421 63.158 20.78 10.43 43.75 5.80
950 951 1.679977 GAATCTGCAAGCAGGGGCA 60.680 57.895 20.78 3.03 43.75 5.36
951 952 1.941999 GAATCTGCAAGCAGGGGCAC 61.942 60.000 20.78 6.16 43.75 5.01
954 955 4.349503 TGCAAGCAGGGGCACGAT 62.350 61.111 0.00 0.00 44.61 3.73
955 956 2.124736 GCAAGCAGGGGCACGATA 60.125 61.111 0.00 0.00 44.61 2.92
956 957 1.748879 GCAAGCAGGGGCACGATAA 60.749 57.895 0.00 0.00 44.61 1.75
957 958 1.312371 GCAAGCAGGGGCACGATAAA 61.312 55.000 0.00 0.00 44.61 1.40
958 959 1.173043 CAAGCAGGGGCACGATAAAA 58.827 50.000 0.00 0.00 44.61 1.52
959 960 1.135402 CAAGCAGGGGCACGATAAAAC 60.135 52.381 0.00 0.00 44.61 2.43
960 961 0.328258 AGCAGGGGCACGATAAAACT 59.672 50.000 0.00 0.00 44.61 2.66
961 962 1.173913 GCAGGGGCACGATAAAACTT 58.826 50.000 0.00 0.00 40.72 2.66
962 963 1.132453 GCAGGGGCACGATAAAACTTC 59.868 52.381 0.00 0.00 40.72 3.01
963 964 1.743394 CAGGGGCACGATAAAACTTCC 59.257 52.381 0.00 0.00 0.00 3.46
964 965 0.730840 GGGGCACGATAAAACTTCCG 59.269 55.000 0.00 0.00 0.00 4.30
965 966 1.676615 GGGGCACGATAAAACTTCCGA 60.677 52.381 0.00 0.00 0.00 4.55
966 967 1.395954 GGGCACGATAAAACTTCCGAC 59.604 52.381 0.00 0.00 0.00 4.79
967 968 1.395954 GGCACGATAAAACTTCCGACC 59.604 52.381 0.00 0.00 0.00 4.79
968 969 1.395954 GCACGATAAAACTTCCGACCC 59.604 52.381 0.00 0.00 0.00 4.46
969 970 2.004733 CACGATAAAACTTCCGACCCC 58.995 52.381 0.00 0.00 0.00 4.95
970 971 1.283736 CGATAAAACTTCCGACCCCG 58.716 55.000 0.00 0.00 0.00 5.73
971 972 1.135024 CGATAAAACTTCCGACCCCGA 60.135 52.381 0.00 0.00 38.22 5.14
972 973 2.674747 CGATAAAACTTCCGACCCCGAA 60.675 50.000 0.00 0.00 38.22 4.30
973 974 3.538591 GATAAAACTTCCGACCCCGAAT 58.461 45.455 0.00 0.00 38.22 3.34
974 975 1.817357 AAAACTTCCGACCCCGAATC 58.183 50.000 0.00 0.00 38.22 2.52
975 976 0.688487 AAACTTCCGACCCCGAATCA 59.312 50.000 0.00 0.00 38.22 2.57
976 977 0.249398 AACTTCCGACCCCGAATCAG 59.751 55.000 0.00 0.00 38.22 2.90
977 978 1.144057 CTTCCGACCCCGAATCAGG 59.856 63.158 0.00 0.00 38.22 3.86
978 979 2.925162 CTTCCGACCCCGAATCAGGC 62.925 65.000 0.00 0.00 38.22 4.85
979 980 4.891727 CCGACCCCGAATCAGGCG 62.892 72.222 0.00 0.00 38.22 5.52
999 1000 2.676471 GCCGCCAATGACCACCTT 60.676 61.111 0.00 0.00 0.00 3.50
1000 1001 2.993471 GCCGCCAATGACCACCTTG 61.993 63.158 0.00 0.00 0.00 3.61
1001 1002 2.342650 CCGCCAATGACCACCTTGG 61.343 63.158 0.00 0.00 45.02 3.61
1003 1004 3.277133 CCAATGACCACCTTGGCG 58.723 61.111 0.00 0.00 42.67 5.69
1004 1005 1.603455 CCAATGACCACCTTGGCGT 60.603 57.895 0.00 0.00 42.67 5.68
1005 1006 1.178534 CCAATGACCACCTTGGCGTT 61.179 55.000 0.00 0.00 42.67 4.84
1006 1007 0.039256 CAATGACCACCTTGGCGTTG 60.039 55.000 0.00 0.53 42.67 4.10
1007 1008 1.805428 AATGACCACCTTGGCGTTGC 61.805 55.000 0.00 0.00 42.67 4.17
1022 1023 3.038280 TGCCGCAGCACGATTTTT 58.962 50.000 0.00 0.00 46.52 1.94
1023 1024 2.248741 TGCCGCAGCACGATTTTTA 58.751 47.368 0.00 0.00 46.52 1.52
1024 1025 0.167908 TGCCGCAGCACGATTTTTAG 59.832 50.000 0.00 0.00 46.52 1.85
1025 1026 3.132550 TGCCGCAGCACGATTTTTAGG 62.133 52.381 0.00 0.00 46.52 2.69
1028 1029 2.544480 GCAGCACGATTTTTAGGGTC 57.456 50.000 0.00 0.00 0.00 4.46
1029 1030 1.202031 GCAGCACGATTTTTAGGGTCG 60.202 52.381 0.00 0.00 40.91 4.79
1030 1031 2.343101 CAGCACGATTTTTAGGGTCGA 58.657 47.619 0.69 0.00 38.63 4.20
1031 1032 2.936498 CAGCACGATTTTTAGGGTCGAT 59.064 45.455 0.69 0.00 38.63 3.59
1032 1033 3.001330 CAGCACGATTTTTAGGGTCGATC 59.999 47.826 0.69 0.00 38.63 3.69
1033 1034 2.034001 GCACGATTTTTAGGGTCGATCG 60.034 50.000 9.36 9.36 43.65 3.69
1034 1035 3.515330 ACGATTTTTAGGGTCGATCGT 57.485 42.857 15.94 4.10 45.39 3.73
1035 1036 3.242248 CACGATTTTTAGGGTCGATCGTC 59.758 47.826 15.94 9.66 46.76 4.20
1036 1037 3.119388 ACGATTTTTAGGGTCGATCGTCA 60.119 43.478 15.94 0.00 46.76 4.35
1037 1038 3.861113 CGATTTTTAGGGTCGATCGTCAA 59.139 43.478 15.94 0.00 37.55 3.18
1038 1039 4.026804 CGATTTTTAGGGTCGATCGTCAAG 60.027 45.833 15.94 0.00 37.55 3.02
1039 1040 2.288961 TTTAGGGTCGATCGTCAAGC 57.711 50.000 15.94 5.44 0.00 4.01
1040 1041 0.458669 TTAGGGTCGATCGTCAAGCC 59.541 55.000 15.94 14.77 0.00 4.35
1041 1042 1.721664 TAGGGTCGATCGTCAAGCCG 61.722 60.000 15.94 0.00 35.72 5.52
1042 1043 3.255379 GGTCGATCGTCAAGCCGC 61.255 66.667 15.94 0.00 0.00 6.53
1043 1044 2.506217 GTCGATCGTCAAGCCGCA 60.506 61.111 15.94 0.00 0.00 5.69
1044 1045 1.878522 GTCGATCGTCAAGCCGCAT 60.879 57.895 15.94 0.00 0.00 4.73
1045 1046 1.878069 TCGATCGTCAAGCCGCATG 60.878 57.895 15.94 0.00 0.00 4.06
1046 1047 1.878069 CGATCGTCAAGCCGCATGA 60.878 57.895 7.03 0.00 0.00 3.07
1047 1048 1.217585 CGATCGTCAAGCCGCATGAT 61.218 55.000 7.03 0.00 0.00 2.45
1048 1049 0.234106 GATCGTCAAGCCGCATGATG 59.766 55.000 10.88 10.88 35.57 3.07
1049 1050 0.462581 ATCGTCAAGCCGCATGATGT 60.463 50.000 15.48 3.30 35.70 3.06
1050 1051 1.083806 TCGTCAAGCCGCATGATGTC 61.084 55.000 15.48 0.00 35.70 3.06
1051 1052 1.360931 CGTCAAGCCGCATGATGTCA 61.361 55.000 9.24 0.00 0.00 3.58
1052 1053 1.019673 GTCAAGCCGCATGATGTCAT 58.980 50.000 0.97 0.00 36.96 3.06
1053 1054 1.003116 GTCAAGCCGCATGATGTCATC 60.003 52.381 5.83 5.83 33.61 2.92
1054 1055 0.041576 CAAGCCGCATGATGTCATCG 60.042 55.000 8.29 0.00 33.61 3.84
1055 1056 0.462581 AAGCCGCATGATGTCATCGT 60.463 50.000 8.29 5.00 33.61 3.73
1056 1057 0.877649 AGCCGCATGATGTCATCGTC 60.878 55.000 4.46 0.55 33.61 4.20
1057 1058 1.153597 GCCGCATGATGTCATCGTCA 61.154 55.000 4.46 0.00 42.71 4.35
1058 1059 1.289276 CCGCATGATGTCATCGTCAA 58.711 50.000 4.46 0.00 41.98 3.18
1059 1060 1.259770 CCGCATGATGTCATCGTCAAG 59.740 52.381 4.46 0.27 41.98 3.02
1060 1061 1.332640 CGCATGATGTCATCGTCAAGC 60.333 52.381 4.46 5.35 45.20 4.01
1061 1062 1.003116 GCATGATGTCATCGTCAAGCC 60.003 52.381 4.46 0.00 43.87 4.35
1062 1063 1.259770 CATGATGTCATCGTCAAGCCG 59.740 52.381 4.46 0.00 41.98 5.52
1063 1064 1.083806 TGATGTCATCGTCAAGCCGC 61.084 55.000 8.29 0.00 36.76 6.53
1064 1065 1.079197 ATGTCATCGTCAAGCCGCA 60.079 52.632 0.00 0.00 0.00 5.69
1065 1066 1.086067 ATGTCATCGTCAAGCCGCAG 61.086 55.000 0.00 0.00 0.00 5.18
1066 1067 2.815211 TCATCGTCAAGCCGCAGC 60.815 61.111 0.00 0.00 40.32 5.25
1067 1068 3.120385 CATCGTCAAGCCGCAGCA 61.120 61.111 0.00 0.00 43.56 4.41
1068 1069 3.121030 ATCGTCAAGCCGCAGCAC 61.121 61.111 0.00 0.00 43.56 4.40
1129 1130 4.426112 TCGCTGCACGGAGAGCTG 62.426 66.667 0.00 0.00 46.38 4.24
1132 1133 2.814341 CTGCACGGAGAGCTGCTG 60.814 66.667 7.01 0.00 46.38 4.41
1133 1134 4.383861 TGCACGGAGAGCTGCTGG 62.384 66.667 7.01 0.00 46.38 4.85
1134 1135 4.074526 GCACGGAGAGCTGCTGGA 62.075 66.667 7.01 0.00 41.95 3.86
1342 1346 3.179265 CTGCGCGATTTCGTCCGT 61.179 61.111 12.10 0.00 42.22 4.69
1350 1354 2.472397 GCGATTTCGTCCGTTTCTTCAG 60.472 50.000 1.55 0.00 42.22 3.02
1395 1399 0.105039 GTCCACCTCCCGCTATTCAG 59.895 60.000 0.00 0.00 0.00 3.02
1408 1412 1.264749 TATTCAGGGACCACTGCGCT 61.265 55.000 9.73 0.00 38.36 5.92
1432 1436 1.330655 ACTCCATCGACGGCATCCTT 61.331 55.000 0.00 0.00 0.00 3.36
1480 1488 1.675641 CCGCCTCCTCAACCCTTTG 60.676 63.158 0.00 0.00 0.00 2.77
1483 1491 0.955919 GCCTCCTCAACCCTTTGACG 60.956 60.000 0.00 0.00 36.79 4.35
1493 1501 2.452813 CCTTTGACGGGCGACATCG 61.453 63.158 0.00 0.00 43.27 3.84
1506 1514 0.731514 GACATCGTCGACTTTCCGCA 60.732 55.000 14.70 0.00 0.00 5.69
1510 1518 1.089112 TCGTCGACTTTCCGCATCTA 58.911 50.000 14.70 0.00 0.00 1.98
1511 1519 1.674441 TCGTCGACTTTCCGCATCTAT 59.326 47.619 14.70 0.00 0.00 1.98
1512 1520 1.781429 CGTCGACTTTCCGCATCTATG 59.219 52.381 14.70 0.00 0.00 2.23
1513 1521 2.540973 CGTCGACTTTCCGCATCTATGA 60.541 50.000 14.70 0.00 0.00 2.15
1514 1522 3.046390 GTCGACTTTCCGCATCTATGAG 58.954 50.000 8.70 0.00 0.00 2.90
1542 1559 2.503158 CGCGACGTCGTTGGATGA 60.503 61.111 35.48 0.00 42.22 2.92
1543 1560 1.872234 CGCGACGTCGTTGGATGAT 60.872 57.895 35.48 0.00 42.22 2.45
1553 1570 4.000988 GTCGTTGGATGATAAGTGGTGTT 58.999 43.478 0.00 0.00 0.00 3.32
1558 1575 6.238103 CGTTGGATGATAAGTGGTGTTGTATC 60.238 42.308 0.00 0.00 0.00 2.24
1569 1586 6.873997 AGTGGTGTTGTATCAGAAATATCGA 58.126 36.000 0.00 0.00 0.00 3.59
1573 1590 6.425114 GGTGTTGTATCAGAAATATCGATGCT 59.575 38.462 8.54 0.00 0.00 3.79
1584 1601 0.035036 ATCGATGCTGCCTCCATGAG 59.965 55.000 0.00 0.00 0.00 2.90
1586 1603 1.153025 GATGCTGCCTCCATGAGCA 60.153 57.895 8.32 8.32 46.32 4.26
1609 1626 1.323271 GGGCAGATGGAGTCGTCTCA 61.323 60.000 11.73 0.00 42.05 3.27
1611 1628 0.528017 GCAGATGGAGTCGTCTCACA 59.472 55.000 11.73 7.50 42.05 3.58
1619 1636 3.182967 GGAGTCGTCTCACACATGATTC 58.817 50.000 11.73 0.00 42.05 2.52
1622 1639 2.926200 GTCGTCTCACACATGATTCTGG 59.074 50.000 0.00 0.00 33.22 3.86
1623 1640 2.094026 TCGTCTCACACATGATTCTGGG 60.094 50.000 0.00 0.00 33.22 4.45
1629 1646 2.908940 CATGATTCTGGGGGCGCC 60.909 66.667 21.18 21.18 0.00 6.53
1630 1647 3.099170 ATGATTCTGGGGGCGCCT 61.099 61.111 28.56 3.45 0.00 5.52
1666 1683 1.251251 CCTTTGCAACCTCCCAAGAG 58.749 55.000 0.00 0.00 40.09 2.85
1668 1685 0.106268 TTTGCAACCTCCCAAGAGCA 60.106 50.000 0.00 0.00 38.96 4.26
1681 1698 1.542915 CAAGAGCAACAATGGAGGGTG 59.457 52.381 0.00 0.00 0.00 4.61
1692 1709 1.003233 GGAGGGTGTCAAGCTGGTC 60.003 63.158 0.00 0.00 0.00 4.02
1693 1710 1.484444 GGAGGGTGTCAAGCTGGTCT 61.484 60.000 0.00 0.00 0.00 3.85
1694 1711 0.036858 GAGGGTGTCAAGCTGGTCTC 60.037 60.000 0.00 0.00 0.00 3.36
1695 1712 0.472734 AGGGTGTCAAGCTGGTCTCT 60.473 55.000 0.00 0.00 0.00 3.10
1697 1714 0.036858 GGTGTCAAGCTGGTCTCTCC 60.037 60.000 0.00 0.00 0.00 3.71
1698 1715 0.972883 GTGTCAAGCTGGTCTCTCCT 59.027 55.000 0.00 0.00 37.07 3.69
1699 1716 1.346068 GTGTCAAGCTGGTCTCTCCTT 59.654 52.381 0.00 0.00 37.07 3.36
1701 1718 1.620819 GTCAAGCTGGTCTCTCCTTCA 59.379 52.381 0.00 0.00 37.07 3.02
1704 1721 3.328931 TCAAGCTGGTCTCTCCTTCAAAT 59.671 43.478 0.00 0.00 37.07 2.32
1707 1724 5.505181 AGCTGGTCTCTCCTTCAAATTTA 57.495 39.130 0.00 0.00 37.07 1.40
1709 1726 7.200434 AGCTGGTCTCTCCTTCAAATTTATA 57.800 36.000 0.00 0.00 37.07 0.98
1710 1727 7.278875 AGCTGGTCTCTCCTTCAAATTTATAG 58.721 38.462 0.00 0.00 37.07 1.31
1711 1728 6.484977 GCTGGTCTCTCCTTCAAATTTATAGG 59.515 42.308 10.22 10.22 37.07 2.57
1712 1729 6.357367 TGGTCTCTCCTTCAAATTTATAGGC 58.643 40.000 11.24 0.66 37.07 3.93
1713 1730 5.765677 GGTCTCTCCTTCAAATTTATAGGCC 59.234 44.000 11.24 0.00 0.00 5.19
1714 1731 5.765677 GTCTCTCCTTCAAATTTATAGGCCC 59.234 44.000 0.00 0.00 0.00 5.80
1715 1732 5.061721 TCTCCTTCAAATTTATAGGCCCC 57.938 43.478 0.00 0.00 0.00 5.80
1716 1733 4.480537 TCTCCTTCAAATTTATAGGCCCCA 59.519 41.667 0.00 0.00 0.00 4.96
1717 1734 5.043732 TCTCCTTCAAATTTATAGGCCCCAA 60.044 40.000 0.00 0.00 0.00 4.12
1718 1735 5.787327 TCCTTCAAATTTATAGGCCCCAAT 58.213 37.500 0.00 0.00 0.00 3.16
1719 1736 6.209026 TCCTTCAAATTTATAGGCCCCAATT 58.791 36.000 0.00 0.00 0.00 2.32
1720 1737 6.676189 TCCTTCAAATTTATAGGCCCCAATTT 59.324 34.615 0.00 2.47 30.56 1.82
1721 1738 7.183657 TCCTTCAAATTTATAGGCCCCAATTTT 59.816 33.333 0.00 0.00 28.44 1.82
1722 1739 8.490311 CCTTCAAATTTATAGGCCCCAATTTTA 58.510 33.333 0.00 0.00 28.44 1.52
1741 1758 4.730949 TTATAGTCCAACCTCGTTCCAG 57.269 45.455 0.00 0.00 0.00 3.86
1744 1761 2.359975 CCAACCTCGTTCCAGGGC 60.360 66.667 0.00 0.00 37.96 5.19
1753 1770 3.555168 CCTCGTTCCAGGGCAAGATATAC 60.555 52.174 0.00 0.00 0.00 1.47
1755 1772 2.223971 CGTTCCAGGGCAAGATATACGT 60.224 50.000 0.00 0.00 0.00 3.57
1759 1776 2.483876 CAGGGCAAGATATACGTGGTG 58.516 52.381 0.00 0.00 0.00 4.17
1760 1777 1.416401 AGGGCAAGATATACGTGGTGG 59.584 52.381 0.00 0.00 0.00 4.61
1767 1784 5.007332 GCAAGATATACGTGGTGGGTTTTAG 59.993 44.000 0.00 0.00 0.00 1.85
1768 1785 5.286267 AGATATACGTGGTGGGTTTTAGG 57.714 43.478 0.00 0.00 0.00 2.69
1770 1787 5.426185 AGATATACGTGGTGGGTTTTAGGAA 59.574 40.000 0.00 0.00 0.00 3.36
1778 1795 5.024118 TGGTGGGTTTTAGGAAAAGTTTCA 58.976 37.500 6.15 0.00 38.92 2.69
1785 1802 6.399743 GTTTTAGGAAAAGTTTCACCCAACA 58.600 36.000 6.15 0.00 38.92 3.33
1796 1813 1.523758 CACCCAACAAGAGGTGCTAC 58.476 55.000 0.00 0.00 46.55 3.58
1800 1817 2.026822 CCCAACAAGAGGTGCTACAGAT 60.027 50.000 0.00 0.00 0.00 2.90
1801 1818 3.197766 CCCAACAAGAGGTGCTACAGATA 59.802 47.826 0.00 0.00 0.00 1.98
1809 1826 0.830648 GTGCTACAGATAGGCCCACA 59.169 55.000 0.00 0.00 0.00 4.17
1810 1827 0.830648 TGCTACAGATAGGCCCACAC 59.169 55.000 0.00 0.00 0.00 3.82
1811 1828 0.106894 GCTACAGATAGGCCCACACC 59.893 60.000 0.00 0.00 0.00 4.16
1812 1829 0.389391 CTACAGATAGGCCCACACCG 59.611 60.000 0.00 0.00 33.69 4.94
1813 1830 0.032912 TACAGATAGGCCCACACCGA 60.033 55.000 0.00 0.00 33.69 4.69
1814 1831 0.691078 ACAGATAGGCCCACACCGAT 60.691 55.000 0.00 0.00 33.69 4.18
1815 1832 0.469917 CAGATAGGCCCACACCGATT 59.530 55.000 0.00 0.00 33.69 3.34
1816 1833 1.691976 CAGATAGGCCCACACCGATTA 59.308 52.381 0.00 0.00 33.69 1.75
1817 1834 2.303022 CAGATAGGCCCACACCGATTAT 59.697 50.000 0.00 0.00 33.69 1.28
1818 1835 2.979678 AGATAGGCCCACACCGATTATT 59.020 45.455 0.00 0.00 33.69 1.40
1819 1836 4.020573 CAGATAGGCCCACACCGATTATTA 60.021 45.833 0.00 0.00 33.69 0.98
1820 1837 2.930826 AGGCCCACACCGATTATTAG 57.069 50.000 0.00 0.00 33.69 1.73
1821 1838 2.404559 AGGCCCACACCGATTATTAGA 58.595 47.619 0.00 0.00 33.69 2.10
1822 1839 2.979678 AGGCCCACACCGATTATTAGAT 59.020 45.455 0.00 0.00 33.69 1.98
1823 1840 3.394606 AGGCCCACACCGATTATTAGATT 59.605 43.478 0.00 0.00 33.69 2.40
1824 1841 4.141251 AGGCCCACACCGATTATTAGATTT 60.141 41.667 0.00 0.00 33.69 2.17
1825 1842 5.072600 AGGCCCACACCGATTATTAGATTTA 59.927 40.000 0.00 0.00 33.69 1.40
1826 1843 5.180680 GGCCCACACCGATTATTAGATTTAC 59.819 44.000 0.00 0.00 0.00 2.01
1827 1844 5.107220 GCCCACACCGATTATTAGATTTACG 60.107 44.000 0.00 0.00 0.00 3.18
1828 1845 5.407387 CCCACACCGATTATTAGATTTACGG 59.593 44.000 0.00 0.00 43.61 4.02
1829 1846 5.107220 CCACACCGATTATTAGATTTACGGC 60.107 44.000 0.00 0.00 42.09 5.68
1830 1847 5.464057 CACACCGATTATTAGATTTACGGCA 59.536 40.000 0.00 0.00 42.09 5.69
1831 1848 6.018588 CACACCGATTATTAGATTTACGGCAA 60.019 38.462 0.00 0.00 42.09 4.52
1832 1849 6.708949 ACACCGATTATTAGATTTACGGCAAT 59.291 34.615 0.00 0.00 42.09 3.56
1833 1850 7.095355 ACACCGATTATTAGATTTACGGCAATC 60.095 37.037 0.00 1.52 42.09 2.67
1834 1851 6.932400 ACCGATTATTAGATTTACGGCAATCA 59.068 34.615 0.00 0.00 42.09 2.57
1835 1852 7.095355 ACCGATTATTAGATTTACGGCAATCAC 60.095 37.037 0.00 0.00 42.09 3.06
1836 1853 7.095397 CCGATTATTAGATTTACGGCAATCACA 60.095 37.037 10.46 0.00 35.85 3.58
1837 1854 7.740346 CGATTATTAGATTTACGGCAATCACAC 59.260 37.037 10.46 0.00 35.85 3.82
1838 1855 5.751243 ATTAGATTTACGGCAATCACACC 57.249 39.130 10.46 0.00 35.85 4.16
1839 1856 2.365582 AGATTTACGGCAATCACACCC 58.634 47.619 10.46 0.00 35.85 4.61
1840 1857 2.088423 GATTTACGGCAATCACACCCA 58.912 47.619 4.42 0.00 33.87 4.51
1841 1858 1.529226 TTTACGGCAATCACACCCAG 58.471 50.000 0.00 0.00 0.00 4.45
1842 1859 0.958382 TTACGGCAATCACACCCAGC 60.958 55.000 0.00 0.00 0.00 4.85
1843 1860 2.118233 TACGGCAATCACACCCAGCA 62.118 55.000 0.00 0.00 0.00 4.41
1844 1861 2.267351 CGGCAATCACACCCAGCAA 61.267 57.895 0.00 0.00 0.00 3.91
1845 1862 1.290009 GGCAATCACACCCAGCAAC 59.710 57.895 0.00 0.00 0.00 4.17
1846 1863 1.462731 GGCAATCACACCCAGCAACA 61.463 55.000 0.00 0.00 0.00 3.33
1847 1864 0.038892 GCAATCACACCCAGCAACAG 60.039 55.000 0.00 0.00 0.00 3.16
1848 1865 1.321474 CAATCACACCCAGCAACAGT 58.679 50.000 0.00 0.00 0.00 3.55
1849 1866 1.682854 CAATCACACCCAGCAACAGTT 59.317 47.619 0.00 0.00 0.00 3.16
1850 1867 1.321474 ATCACACCCAGCAACAGTTG 58.679 50.000 9.12 9.12 0.00 3.16
1851 1868 0.034574 TCACACCCAGCAACAGTTGT 60.035 50.000 14.88 0.00 0.00 3.32
1852 1869 1.210722 TCACACCCAGCAACAGTTGTA 59.789 47.619 14.88 0.00 0.00 2.41
1853 1870 2.158682 TCACACCCAGCAACAGTTGTAT 60.159 45.455 14.88 1.41 0.00 2.29
1854 1871 2.226437 CACACCCAGCAACAGTTGTATC 59.774 50.000 14.88 0.00 0.00 2.24
1855 1872 2.106511 ACACCCAGCAACAGTTGTATCT 59.893 45.455 14.88 0.77 0.00 1.98
1856 1873 3.326588 ACACCCAGCAACAGTTGTATCTA 59.673 43.478 14.88 0.00 0.00 1.98
1857 1874 3.684788 CACCCAGCAACAGTTGTATCTAC 59.315 47.826 14.88 0.00 0.00 2.59
1858 1875 3.270877 CCCAGCAACAGTTGTATCTACC 58.729 50.000 14.88 0.00 0.00 3.18
1859 1876 3.307410 CCCAGCAACAGTTGTATCTACCA 60.307 47.826 14.88 0.00 0.00 3.25
1860 1877 4.517285 CCAGCAACAGTTGTATCTACCAT 58.483 43.478 14.88 0.00 0.00 3.55
1861 1878 4.572389 CCAGCAACAGTTGTATCTACCATC 59.428 45.833 14.88 0.00 0.00 3.51
1862 1879 5.423015 CAGCAACAGTTGTATCTACCATCT 58.577 41.667 14.88 0.00 0.00 2.90
1863 1880 5.292834 CAGCAACAGTTGTATCTACCATCTG 59.707 44.000 14.88 5.65 0.00 2.90
1864 1881 4.572389 GCAACAGTTGTATCTACCATCTGG 59.428 45.833 14.88 0.00 42.17 3.86
1874 1891 4.054085 CCATCTGGTAGCATGCGG 57.946 61.111 13.01 0.23 0.00 5.69
1875 1892 2.256591 CCATCTGGTAGCATGCGGC 61.257 63.158 13.01 9.03 45.30 6.53
1876 1893 2.111878 ATCTGGTAGCATGCGGCC 59.888 61.111 21.55 21.55 46.50 6.13
1877 1894 2.446848 ATCTGGTAGCATGCGGCCT 61.447 57.895 26.05 8.50 46.50 5.19
1878 1895 1.121407 ATCTGGTAGCATGCGGCCTA 61.121 55.000 26.05 17.82 46.50 3.93
1879 1896 1.301244 CTGGTAGCATGCGGCCTAG 60.301 63.158 26.05 19.36 46.50 3.02
1880 1897 1.748329 CTGGTAGCATGCGGCCTAGA 61.748 60.000 26.05 11.60 46.50 2.43
1881 1898 1.005630 GGTAGCATGCGGCCTAGAG 60.006 63.158 21.21 0.00 46.50 2.43
1882 1899 1.464376 GGTAGCATGCGGCCTAGAGA 61.464 60.000 21.21 0.00 46.50 3.10
1883 1900 0.605589 GTAGCATGCGGCCTAGAGAT 59.394 55.000 13.01 0.00 46.50 2.75
1884 1901 0.891373 TAGCATGCGGCCTAGAGATC 59.109 55.000 13.01 0.00 46.50 2.75
1885 1902 1.375268 GCATGCGGCCTAGAGATCC 60.375 63.158 0.00 0.00 36.11 3.36
1886 1903 1.825281 GCATGCGGCCTAGAGATCCT 61.825 60.000 0.00 0.00 36.11 3.24
1887 1904 0.037512 CATGCGGCCTAGAGATCCTG 60.038 60.000 0.00 0.00 0.00 3.86
1888 1905 1.190833 ATGCGGCCTAGAGATCCTGG 61.191 60.000 0.00 0.00 0.00 4.45
1889 1906 3.055580 CGGCCTAGAGATCCTGGC 58.944 66.667 0.00 7.17 44.22 4.85
1890 1907 2.925262 CGGCCTAGAGATCCTGGCG 61.925 68.421 0.00 0.00 45.75 5.69
1891 1908 2.578714 GGCCTAGAGATCCTGGCGG 61.579 68.421 0.00 0.00 45.75 6.13
1892 1909 1.834822 GCCTAGAGATCCTGGCGGT 60.835 63.158 0.00 0.00 35.79 5.68
1893 1910 1.811645 GCCTAGAGATCCTGGCGGTC 61.812 65.000 0.00 0.00 35.79 4.79
1894 1911 0.178975 CCTAGAGATCCTGGCGGTCT 60.179 60.000 0.00 0.00 0.00 3.85
1895 1912 1.243902 CTAGAGATCCTGGCGGTCTC 58.756 60.000 12.69 12.69 37.55 3.36
1896 1913 0.847373 TAGAGATCCTGGCGGTCTCT 59.153 55.000 21.43 21.43 43.70 3.10
1897 1914 0.467290 AGAGATCCTGGCGGTCTCTC 60.467 60.000 15.73 11.15 40.59 3.20
1898 1915 0.467290 GAGATCCTGGCGGTCTCTCT 60.467 60.000 12.66 0.91 37.29 3.10
1899 1916 0.467290 AGATCCTGGCGGTCTCTCTC 60.467 60.000 0.00 0.00 0.00 3.20
1900 1917 1.456705 ATCCTGGCGGTCTCTCTCC 60.457 63.158 0.00 0.00 0.00 3.71
1901 1918 2.230189 ATCCTGGCGGTCTCTCTCCA 62.230 60.000 0.00 0.00 0.00 3.86
1902 1919 2.716017 CCTGGCGGTCTCTCTCCAC 61.716 68.421 0.00 0.00 0.00 4.02
1903 1920 3.057547 CTGGCGGTCTCTCTCCACG 62.058 68.421 0.00 0.00 0.00 4.94
1904 1921 2.750637 GGCGGTCTCTCTCCACGA 60.751 66.667 0.00 0.00 0.00 4.35
1905 1922 2.486042 GCGGTCTCTCTCCACGAC 59.514 66.667 0.00 0.00 0.00 4.34
1906 1923 2.041686 GCGGTCTCTCTCCACGACT 61.042 63.158 0.00 0.00 0.00 4.18
1907 1924 1.797441 CGGTCTCTCTCCACGACTG 59.203 63.158 0.00 0.00 0.00 3.51
1908 1925 0.956410 CGGTCTCTCTCCACGACTGT 60.956 60.000 0.00 0.00 31.17 3.55
1909 1926 1.249407 GGTCTCTCTCCACGACTGTT 58.751 55.000 0.00 0.00 0.00 3.16
1910 1927 1.068194 GGTCTCTCTCCACGACTGTTG 60.068 57.143 0.00 0.00 0.00 3.33
1911 1928 0.598562 TCTCTCTCCACGACTGTTGC 59.401 55.000 0.00 0.00 0.00 4.17
1912 1929 0.730834 CTCTCTCCACGACTGTTGCG 60.731 60.000 0.00 0.00 0.00 4.85
1913 1930 1.170290 TCTCTCCACGACTGTTGCGA 61.170 55.000 0.00 0.00 0.00 5.10
1914 1931 0.730834 CTCTCCACGACTGTTGCGAG 60.731 60.000 0.00 6.45 0.00 5.03
1915 1932 1.170290 TCTCCACGACTGTTGCGAGA 61.170 55.000 10.04 10.04 0.00 4.04
1916 1933 0.318699 CTCCACGACTGTTGCGAGAA 60.319 55.000 6.83 0.00 0.00 2.87
1917 1934 0.318699 TCCACGACTGTTGCGAGAAG 60.319 55.000 0.00 0.00 0.00 2.85
1918 1935 0.318699 CCACGACTGTTGCGAGAAGA 60.319 55.000 0.00 0.00 0.00 2.87
1919 1936 0.778815 CACGACTGTTGCGAGAAGAC 59.221 55.000 0.00 0.00 0.00 3.01
1920 1937 0.384309 ACGACTGTTGCGAGAAGACA 59.616 50.000 0.00 0.00 0.00 3.41
1921 1938 1.000163 ACGACTGTTGCGAGAAGACAT 60.000 47.619 0.00 0.00 0.00 3.06
1922 1939 1.651138 CGACTGTTGCGAGAAGACATC 59.349 52.381 0.00 0.00 0.00 3.06
1923 1940 2.677199 GACTGTTGCGAGAAGACATCA 58.323 47.619 0.00 0.00 0.00 3.07
1924 1941 2.665537 GACTGTTGCGAGAAGACATCAG 59.334 50.000 0.00 0.00 38.81 2.90
1925 1942 2.036475 ACTGTTGCGAGAAGACATCAGT 59.964 45.455 0.00 0.00 40.35 3.41
1926 1943 2.407090 TGTTGCGAGAAGACATCAGTG 58.593 47.619 0.00 0.00 0.00 3.66
1927 1944 2.224042 TGTTGCGAGAAGACATCAGTGT 60.224 45.455 0.00 0.00 42.49 3.55
1928 1945 3.005367 TGTTGCGAGAAGACATCAGTGTA 59.995 43.478 0.00 0.00 39.09 2.90
1929 1946 3.217599 TGCGAGAAGACATCAGTGTAC 57.782 47.619 0.00 0.00 39.09 2.90
1930 1947 2.556622 TGCGAGAAGACATCAGTGTACA 59.443 45.455 0.00 0.00 39.09 2.90
1931 1948 3.175152 GCGAGAAGACATCAGTGTACAG 58.825 50.000 0.00 0.00 39.09 2.74
1932 1949 3.119814 GCGAGAAGACATCAGTGTACAGA 60.120 47.826 0.00 0.00 39.09 3.41
1933 1950 4.407818 CGAGAAGACATCAGTGTACAGAC 58.592 47.826 0.00 0.00 39.09 3.51
1934 1951 4.155099 CGAGAAGACATCAGTGTACAGACT 59.845 45.833 0.00 0.00 39.09 3.24
1935 1952 5.351740 CGAGAAGACATCAGTGTACAGACTA 59.648 44.000 0.00 0.00 39.09 2.59
1936 1953 6.456315 CGAGAAGACATCAGTGTACAGACTAG 60.456 46.154 0.00 0.00 39.09 2.57
1937 1954 4.974368 AGACATCAGTGTACAGACTAGC 57.026 45.455 0.00 0.00 39.09 3.42
1938 1955 4.594970 AGACATCAGTGTACAGACTAGCT 58.405 43.478 0.00 0.00 39.09 3.32
1939 1956 4.397730 AGACATCAGTGTACAGACTAGCTG 59.602 45.833 0.00 11.23 43.98 4.24
1940 1957 4.396478 GACATCAGTGTACAGACTAGCTGA 59.604 45.833 17.52 12.40 42.29 4.26
1941 1958 5.067153 GACATCAGTGTACAGACTAGCTGAT 59.933 44.000 15.15 15.15 42.29 2.90
1942 1959 6.731876 GACATCAGTGTACAGACTAGCTGATC 60.732 46.154 17.10 8.35 42.29 2.92
1943 1960 8.808264 GACATCAGTGTACAGACTAGCTGATCT 61.808 44.444 17.10 9.39 42.29 2.75
1951 1968 4.870123 AGACTAGCTGATCTTATGCTGG 57.130 45.455 0.00 10.87 40.39 4.85
1952 1969 3.577848 AGACTAGCTGATCTTATGCTGGG 59.422 47.826 0.00 9.42 39.17 4.45
1953 1970 3.576118 GACTAGCTGATCTTATGCTGGGA 59.424 47.826 0.00 0.00 39.17 4.37
1954 1971 3.969976 ACTAGCTGATCTTATGCTGGGAA 59.030 43.478 0.00 0.00 39.17 3.97
1955 1972 3.488778 AGCTGATCTTATGCTGGGAAG 57.511 47.619 0.00 0.00 35.54 3.46
1956 1973 2.106166 AGCTGATCTTATGCTGGGAAGG 59.894 50.000 0.00 0.00 35.54 3.46
1957 1974 2.105477 GCTGATCTTATGCTGGGAAGGA 59.895 50.000 0.00 0.00 0.00 3.36
1958 1975 3.737850 CTGATCTTATGCTGGGAAGGAC 58.262 50.000 0.00 0.00 0.00 3.85
1959 1976 2.439507 TGATCTTATGCTGGGAAGGACC 59.560 50.000 0.00 0.00 38.08 4.46
1960 1977 1.965414 TCTTATGCTGGGAAGGACCA 58.035 50.000 0.00 0.00 41.20 4.02
1961 1978 1.559682 TCTTATGCTGGGAAGGACCAC 59.440 52.381 0.00 0.00 41.20 4.16
1962 1979 1.281867 CTTATGCTGGGAAGGACCACA 59.718 52.381 0.00 0.00 41.20 4.17
1963 1980 0.618458 TATGCTGGGAAGGACCACAC 59.382 55.000 0.00 0.00 41.20 3.82
1964 1981 2.358737 GCTGGGAAGGACCACACG 60.359 66.667 0.00 0.00 41.20 4.49
1965 1982 2.347490 CTGGGAAGGACCACACGG 59.653 66.667 0.00 0.00 41.20 4.94
1966 1983 2.122769 TGGGAAGGACCACACGGA 60.123 61.111 0.00 0.00 41.20 4.69
1967 1984 1.537889 TGGGAAGGACCACACGGAT 60.538 57.895 0.00 0.00 41.20 4.18
1968 1985 0.252330 TGGGAAGGACCACACGGATA 60.252 55.000 0.00 0.00 41.20 2.59
1969 1986 0.906775 GGGAAGGACCACACGGATAA 59.093 55.000 0.00 0.00 41.20 1.75
1970 1987 1.406477 GGGAAGGACCACACGGATAAC 60.406 57.143 0.00 0.00 41.20 1.89
1971 1988 1.276989 GGAAGGACCACACGGATAACA 59.723 52.381 0.00 0.00 38.79 2.41
1972 1989 2.093128 GGAAGGACCACACGGATAACAT 60.093 50.000 0.00 0.00 38.79 2.71
1973 1990 2.691409 AGGACCACACGGATAACATG 57.309 50.000 0.00 0.00 35.59 3.21
1974 1991 1.014352 GGACCACACGGATAACATGC 58.986 55.000 0.00 0.00 35.59 4.06
1975 1992 1.677518 GGACCACACGGATAACATGCA 60.678 52.381 0.00 0.00 35.59 3.96
1976 1993 2.288666 GACCACACGGATAACATGCAT 58.711 47.619 0.00 0.00 35.59 3.96
1977 1994 2.287915 GACCACACGGATAACATGCATC 59.712 50.000 0.00 0.00 35.59 3.91
1978 1995 1.261354 CCACACGGATAACATGCATCG 59.739 52.381 0.00 0.00 0.00 3.84
1979 1996 1.261354 CACACGGATAACATGCATCGG 59.739 52.381 0.00 11.62 0.00 4.18
1980 1997 1.134521 ACACGGATAACATGCATCGGT 60.135 47.619 12.59 12.59 36.67 4.69
1981 1998 1.261354 CACGGATAACATGCATCGGTG 59.739 52.381 22.78 22.78 43.08 4.94
1982 1999 0.867746 CGGATAACATGCATCGGTGG 59.132 55.000 0.00 0.00 0.00 4.61
1983 2000 0.593128 GGATAACATGCATCGGTGGC 59.407 55.000 0.00 0.00 0.00 5.01
1984 2001 1.308047 GATAACATGCATCGGTGGCA 58.692 50.000 0.00 0.00 46.66 4.92
1985 2002 1.675483 GATAACATGCATCGGTGGCAA 59.325 47.619 0.00 0.00 45.60 4.52
1986 2003 0.808125 TAACATGCATCGGTGGCAAC 59.192 50.000 0.00 0.00 45.60 4.17
1987 2004 2.100797 CATGCATCGGTGGCAACG 59.899 61.111 20.91 20.91 45.60 4.10
1988 2005 3.814268 ATGCATCGGTGGCAACGC 61.814 61.111 22.24 7.05 45.60 4.84
1996 2013 3.345808 GTGGCAACGCGCTCTTCA 61.346 61.111 5.73 0.00 41.91 3.02
1997 2014 2.358615 TGGCAACGCGCTCTTCAT 60.359 55.556 5.73 0.00 41.91 2.57
1998 2015 2.390599 TGGCAACGCGCTCTTCATC 61.391 57.895 5.73 0.00 41.91 2.92
1999 2016 2.401195 GCAACGCGCTCTTCATCC 59.599 61.111 5.73 0.00 37.77 3.51
2000 2017 2.390599 GCAACGCGCTCTTCATCCA 61.391 57.895 5.73 0.00 37.77 3.41
2001 2018 1.911293 GCAACGCGCTCTTCATCCAA 61.911 55.000 5.73 0.00 37.77 3.53
2002 2019 0.095935 CAACGCGCTCTTCATCCAAG 59.904 55.000 5.73 0.00 0.00 3.61
2003 2020 1.021390 AACGCGCTCTTCATCCAAGG 61.021 55.000 5.73 0.00 32.22 3.61
2004 2021 2.176273 CGCGCTCTTCATCCAAGGG 61.176 63.158 5.56 0.00 35.35 3.95
2005 2022 1.221840 GCGCTCTTCATCCAAGGGA 59.778 57.895 0.00 0.00 33.82 4.20
2006 2023 0.813210 GCGCTCTTCATCCAAGGGAG 60.813 60.000 0.00 0.00 33.82 4.30
2007 2024 0.179062 CGCTCTTCATCCAAGGGAGG 60.179 60.000 0.00 0.00 33.82 4.30
2008 2025 1.207791 GCTCTTCATCCAAGGGAGGA 58.792 55.000 0.00 0.00 40.93 3.71
2009 2026 1.134250 GCTCTTCATCCAAGGGAGGAC 60.134 57.143 0.00 0.00 42.40 3.85
2010 2027 1.137872 CTCTTCATCCAAGGGAGGACG 59.862 57.143 0.00 0.00 42.40 4.79
2011 2028 1.195115 CTTCATCCAAGGGAGGACGA 58.805 55.000 0.00 0.00 42.40 4.20
2012 2029 1.765314 CTTCATCCAAGGGAGGACGAT 59.235 52.381 0.00 0.00 42.40 3.73
2013 2030 2.767644 TCATCCAAGGGAGGACGATA 57.232 50.000 0.00 0.00 37.61 2.92
2014 2031 3.260269 TCATCCAAGGGAGGACGATAT 57.740 47.619 0.00 0.00 37.61 1.63
2015 2032 2.899900 TCATCCAAGGGAGGACGATATG 59.100 50.000 0.00 0.00 37.61 1.78
2016 2033 2.471815 TCCAAGGGAGGACGATATGT 57.528 50.000 0.00 0.00 31.23 2.29
2017 2034 2.039418 TCCAAGGGAGGACGATATGTG 58.961 52.381 0.00 0.00 31.23 3.21
2018 2035 1.762957 CCAAGGGAGGACGATATGTGT 59.237 52.381 0.00 0.00 0.00 3.72
2019 2036 2.224066 CCAAGGGAGGACGATATGTGTC 60.224 54.545 0.00 0.00 35.60 3.67
2020 2037 2.430694 CAAGGGAGGACGATATGTGTCA 59.569 50.000 6.94 0.00 38.10 3.58
2021 2038 2.311463 AGGGAGGACGATATGTGTCAG 58.689 52.381 6.94 0.00 38.10 3.51
2022 2039 1.269831 GGGAGGACGATATGTGTCAGC 60.270 57.143 6.94 0.00 38.10 4.26
2023 2040 1.683917 GGAGGACGATATGTGTCAGCT 59.316 52.381 6.94 0.00 38.10 4.24
2024 2041 2.287909 GGAGGACGATATGTGTCAGCTC 60.288 54.545 6.94 5.29 38.10 4.09
2025 2042 1.683917 AGGACGATATGTGTCAGCTCC 59.316 52.381 6.94 0.00 38.10 4.70
2026 2043 1.409064 GGACGATATGTGTCAGCTCCA 59.591 52.381 6.94 0.00 38.10 3.86
2027 2044 2.159099 GGACGATATGTGTCAGCTCCAA 60.159 50.000 6.94 0.00 38.10 3.53
2028 2045 3.119291 GACGATATGTGTCAGCTCCAAG 58.881 50.000 0.00 0.00 36.37 3.61
2029 2046 2.159043 ACGATATGTGTCAGCTCCAAGG 60.159 50.000 0.00 0.00 0.00 3.61
2030 2047 2.216898 GATATGTGTCAGCTCCAAGGC 58.783 52.381 0.00 0.00 0.00 4.35
2031 2048 0.108186 TATGTGTCAGCTCCAAGGCG 60.108 55.000 0.00 0.00 37.29 5.52
2032 2049 2.031163 GTGTCAGCTCCAAGGCGT 59.969 61.111 0.00 0.00 37.29 5.68
2033 2050 1.598130 GTGTCAGCTCCAAGGCGTT 60.598 57.895 0.00 0.00 37.29 4.84
2034 2051 1.148273 TGTCAGCTCCAAGGCGTTT 59.852 52.632 0.00 0.00 37.29 3.60
2035 2052 0.884704 TGTCAGCTCCAAGGCGTTTC 60.885 55.000 0.00 0.00 37.29 2.78
2036 2053 1.302511 TCAGCTCCAAGGCGTTTCC 60.303 57.895 0.00 0.00 37.29 3.13
2038 2055 0.036388 CAGCTCCAAGGCGTTTCCTA 60.036 55.000 0.00 0.00 46.94 2.94
2039 2056 0.036294 AGCTCCAAGGCGTTTCCTAC 60.036 55.000 0.00 0.00 46.94 3.18
2040 2057 1.025113 GCTCCAAGGCGTTTCCTACC 61.025 60.000 0.00 0.00 46.94 3.18
2041 2058 0.323629 CTCCAAGGCGTTTCCTACCA 59.676 55.000 0.00 0.00 46.94 3.25
2042 2059 0.988832 TCCAAGGCGTTTCCTACCAT 59.011 50.000 0.00 0.00 46.94 3.55
2043 2060 1.353022 TCCAAGGCGTTTCCTACCATT 59.647 47.619 0.00 0.00 46.94 3.16
2044 2061 1.472480 CCAAGGCGTTTCCTACCATTG 59.528 52.381 0.00 0.00 46.94 2.82
2045 2062 2.159382 CAAGGCGTTTCCTACCATTGT 58.841 47.619 0.00 0.00 46.94 2.71
2046 2063 1.821216 AGGCGTTTCCTACCATTGTG 58.179 50.000 0.00 0.00 45.41 3.33
2047 2064 0.808755 GGCGTTTCCTACCATTGTGG 59.191 55.000 0.00 0.00 45.02 4.17
2048 2065 1.612199 GGCGTTTCCTACCATTGTGGA 60.612 52.381 2.45 0.00 40.96 4.02
2049 2066 2.365582 GCGTTTCCTACCATTGTGGAT 58.634 47.619 2.45 0.00 40.96 3.41
2050 2067 2.097466 GCGTTTCCTACCATTGTGGATG 59.903 50.000 2.45 0.00 40.96 3.51
2051 2068 3.605634 CGTTTCCTACCATTGTGGATGA 58.394 45.455 2.45 0.00 40.96 2.92
2052 2069 3.374058 CGTTTCCTACCATTGTGGATGAC 59.626 47.826 2.45 0.00 40.96 3.06
2053 2070 4.331968 GTTTCCTACCATTGTGGATGACA 58.668 43.478 2.45 0.00 40.96 3.58
2067 2084 1.936547 GATGACACCATCCTCTTTCGC 59.063 52.381 0.00 0.00 42.55 4.70
2068 2085 0.684535 TGACACCATCCTCTTTCGCA 59.315 50.000 0.00 0.00 0.00 5.10
2069 2086 1.071542 TGACACCATCCTCTTTCGCAA 59.928 47.619 0.00 0.00 0.00 4.85
2070 2087 2.151202 GACACCATCCTCTTTCGCAAA 58.849 47.619 0.00 0.00 0.00 3.68
2071 2088 2.749621 GACACCATCCTCTTTCGCAAAT 59.250 45.455 0.00 0.00 0.00 2.32
2072 2089 2.489329 ACACCATCCTCTTTCGCAAATG 59.511 45.455 0.00 0.00 0.00 2.32
2073 2090 2.094675 ACCATCCTCTTTCGCAAATGG 58.905 47.619 0.00 0.00 39.62 3.16
2074 2091 2.094675 CCATCCTCTTTCGCAAATGGT 58.905 47.619 0.00 0.00 31.15 3.55
2075 2092 2.493278 CCATCCTCTTTCGCAAATGGTT 59.507 45.455 0.00 0.00 31.15 3.67
2076 2093 3.056607 CCATCCTCTTTCGCAAATGGTTT 60.057 43.478 0.00 0.00 31.15 3.27
2077 2094 3.915437 TCCTCTTTCGCAAATGGTTTC 57.085 42.857 0.00 0.00 0.00 2.78
2078 2095 3.218453 TCCTCTTTCGCAAATGGTTTCA 58.782 40.909 0.00 0.00 0.00 2.69
2079 2096 3.634448 TCCTCTTTCGCAAATGGTTTCAA 59.366 39.130 0.00 0.00 0.00 2.69
2080 2097 3.983344 CCTCTTTCGCAAATGGTTTCAAG 59.017 43.478 0.00 0.00 0.00 3.02
2081 2098 4.261572 CCTCTTTCGCAAATGGTTTCAAGA 60.262 41.667 0.00 0.00 0.00 3.02
2082 2099 5.452078 TCTTTCGCAAATGGTTTCAAGAT 57.548 34.783 0.00 0.00 0.00 2.40
2083 2100 5.221880 TCTTTCGCAAATGGTTTCAAGATG 58.778 37.500 0.00 0.00 0.00 2.90
2084 2101 4.844998 TTCGCAAATGGTTTCAAGATGA 57.155 36.364 0.00 0.00 0.00 2.92
2085 2102 5.389859 TTCGCAAATGGTTTCAAGATGAT 57.610 34.783 0.00 0.00 0.00 2.45
2086 2103 4.985413 TCGCAAATGGTTTCAAGATGATC 58.015 39.130 0.00 0.00 0.00 2.92
2087 2104 4.701651 TCGCAAATGGTTTCAAGATGATCT 59.298 37.500 0.00 0.00 0.00 2.75
2088 2105 5.183713 TCGCAAATGGTTTCAAGATGATCTT 59.816 36.000 0.97 0.97 37.14 2.40
2100 2117 6.057627 CAAGATGATCTTGCTCAATACCAC 57.942 41.667 20.85 0.00 46.03 4.16
2101 2118 4.712476 AGATGATCTTGCTCAATACCACC 58.288 43.478 0.00 0.00 0.00 4.61
2102 2119 4.411540 AGATGATCTTGCTCAATACCACCT 59.588 41.667 0.00 0.00 0.00 4.00
2103 2120 4.142609 TGATCTTGCTCAATACCACCTC 57.857 45.455 0.00 0.00 0.00 3.85
2104 2121 2.672961 TCTTGCTCAATACCACCTCG 57.327 50.000 0.00 0.00 0.00 4.63
2105 2122 1.207089 TCTTGCTCAATACCACCTCGG 59.793 52.381 0.00 0.00 42.50 4.63
2106 2123 0.392461 TTGCTCAATACCACCTCGGC 60.392 55.000 0.00 0.00 39.03 5.54
2107 2124 1.220749 GCTCAATACCACCTCGGCA 59.779 57.895 0.00 0.00 39.03 5.69
2108 2125 0.811616 GCTCAATACCACCTCGGCAG 60.812 60.000 0.00 0.00 39.03 4.85
2109 2126 0.811616 CTCAATACCACCTCGGCAGC 60.812 60.000 0.00 0.00 39.03 5.25
2110 2127 2.173669 CAATACCACCTCGGCAGCG 61.174 63.158 0.00 0.00 39.03 5.18
2111 2128 3.385749 AATACCACCTCGGCAGCGG 62.386 63.158 0.00 0.00 39.03 5.52
2115 2132 4.697756 CACCTCGGCAGCGGGAAA 62.698 66.667 0.00 0.00 0.00 3.13
2116 2133 3.717294 ACCTCGGCAGCGGGAAAT 61.717 61.111 0.00 0.00 0.00 2.17
2117 2134 2.438434 CCTCGGCAGCGGGAAATT 60.438 61.111 0.00 0.00 0.00 1.82
2118 2135 2.764314 CCTCGGCAGCGGGAAATTG 61.764 63.158 0.00 0.00 0.00 2.32
2119 2136 2.033448 TCGGCAGCGGGAAATTGT 59.967 55.556 0.00 0.00 0.00 2.71
2120 2137 1.586154 CTCGGCAGCGGGAAATTGTT 61.586 55.000 0.00 0.00 0.00 2.83
2121 2138 1.444212 CGGCAGCGGGAAATTGTTG 60.444 57.895 0.00 0.00 0.00 3.33
2122 2139 1.737735 GGCAGCGGGAAATTGTTGC 60.738 57.895 0.00 0.00 40.98 4.17
2123 2140 1.737735 GCAGCGGGAAATTGTTGCC 60.738 57.895 0.00 0.00 41.71 4.52
2124 2141 1.664873 CAGCGGGAAATTGTTGCCA 59.335 52.632 0.00 0.00 45.30 4.92
2125 2142 0.247185 CAGCGGGAAATTGTTGCCAT 59.753 50.000 0.00 0.00 45.30 4.40
2126 2143 0.532115 AGCGGGAAATTGTTGCCATC 59.468 50.000 0.00 0.00 45.30 3.51
2127 2144 0.246086 GCGGGAAATTGTTGCCATCA 59.754 50.000 0.00 0.00 45.30 3.07
2128 2145 1.337635 GCGGGAAATTGTTGCCATCAA 60.338 47.619 0.00 0.00 45.30 2.57
2129 2146 2.336667 CGGGAAATTGTTGCCATCAAC 58.663 47.619 1.54 1.54 45.30 3.18
2142 2159 4.968259 TGCCATCAACATATACACCTACC 58.032 43.478 0.00 0.00 0.00 3.18
2143 2160 3.994392 GCCATCAACATATACACCTACCG 59.006 47.826 0.00 0.00 0.00 4.02
2144 2161 4.566004 CCATCAACATATACACCTACCGG 58.434 47.826 0.00 0.00 0.00 5.28
2145 2162 4.282449 CCATCAACATATACACCTACCGGA 59.718 45.833 9.46 0.00 0.00 5.14
2146 2163 4.924305 TCAACATATACACCTACCGGAC 57.076 45.455 9.46 0.00 0.00 4.79
2147 2164 4.539726 TCAACATATACACCTACCGGACT 58.460 43.478 9.46 0.00 0.00 3.85
2148 2165 5.693961 TCAACATATACACCTACCGGACTA 58.306 41.667 9.46 0.00 0.00 2.59
2149 2166 6.309357 TCAACATATACACCTACCGGACTAT 58.691 40.000 9.46 0.00 0.00 2.12
2150 2167 7.460910 TCAACATATACACCTACCGGACTATA 58.539 38.462 9.46 0.00 0.00 1.31
2151 2168 8.111545 TCAACATATACACCTACCGGACTATAT 58.888 37.037 9.46 0.62 0.00 0.86
2152 2169 7.876936 ACATATACACCTACCGGACTATATG 57.123 40.000 9.46 13.85 39.27 1.78
2153 2170 6.320672 ACATATACACCTACCGGACTATATGC 59.679 42.308 9.46 0.00 38.32 3.14
2154 2171 2.245582 ACACCTACCGGACTATATGCC 58.754 52.381 9.46 0.00 0.00 4.40
2155 2172 2.244695 CACCTACCGGACTATATGCCA 58.755 52.381 9.46 0.00 0.00 4.92
2156 2173 2.832129 CACCTACCGGACTATATGCCAT 59.168 50.000 9.46 0.00 0.00 4.40
2157 2174 2.832129 ACCTACCGGACTATATGCCATG 59.168 50.000 9.46 0.00 0.00 3.66
2158 2175 3.096852 CCTACCGGACTATATGCCATGA 58.903 50.000 9.46 0.00 0.00 3.07
2159 2176 3.119101 CCTACCGGACTATATGCCATGAC 60.119 52.174 9.46 0.00 0.00 3.06
2160 2177 2.325484 ACCGGACTATATGCCATGACA 58.675 47.619 9.46 0.00 0.00 3.58
2161 2178 2.703536 ACCGGACTATATGCCATGACAA 59.296 45.455 9.46 0.00 0.00 3.18
2162 2179 3.244215 ACCGGACTATATGCCATGACAAG 60.244 47.826 9.46 0.00 0.00 3.16
2163 2180 3.244215 CCGGACTATATGCCATGACAAGT 60.244 47.826 0.00 0.00 0.00 3.16
2164 2181 3.990469 CGGACTATATGCCATGACAAGTC 59.010 47.826 4.29 4.29 32.92 3.01
2165 2182 4.319177 GGACTATATGCCATGACAAGTCC 58.681 47.826 13.53 13.53 43.27 3.85
2166 2183 4.040952 GGACTATATGCCATGACAAGTCCT 59.959 45.833 18.87 0.00 45.20 3.85
2167 2184 5.455326 GGACTATATGCCATGACAAGTCCTT 60.455 44.000 18.87 0.00 45.20 3.36
2168 2185 5.371526 ACTATATGCCATGACAAGTCCTTG 58.628 41.667 5.51 5.51 45.58 3.61
2180 2197 3.930336 CAAGTCCTTGTAGCATCACTGA 58.070 45.455 0.00 0.00 35.92 3.41
2181 2198 3.601443 AGTCCTTGTAGCATCACTGAC 57.399 47.619 0.00 0.00 0.00 3.51
2182 2199 2.234908 AGTCCTTGTAGCATCACTGACC 59.765 50.000 0.00 0.00 0.00 4.02
2183 2200 2.028112 GTCCTTGTAGCATCACTGACCA 60.028 50.000 0.00 0.00 0.00 4.02
2184 2201 2.840038 TCCTTGTAGCATCACTGACCAT 59.160 45.455 0.00 0.00 0.00 3.55
2185 2202 4.030216 TCCTTGTAGCATCACTGACCATA 58.970 43.478 0.00 0.00 0.00 2.74
2186 2203 4.655649 TCCTTGTAGCATCACTGACCATAT 59.344 41.667 0.00 0.00 0.00 1.78
2187 2204 4.993584 CCTTGTAGCATCACTGACCATATC 59.006 45.833 0.00 0.00 0.00 1.63
2188 2205 5.221601 CCTTGTAGCATCACTGACCATATCT 60.222 44.000 0.00 0.00 0.00 1.98
2189 2206 6.015095 CCTTGTAGCATCACTGACCATATCTA 60.015 42.308 0.00 0.00 0.00 1.98
2190 2207 6.332735 TGTAGCATCACTGACCATATCTAC 57.667 41.667 0.00 0.00 0.00 2.59
2191 2208 5.833131 TGTAGCATCACTGACCATATCTACA 59.167 40.000 0.00 0.00 33.68 2.74
2192 2209 5.207110 AGCATCACTGACCATATCTACAC 57.793 43.478 0.00 0.00 0.00 2.90
2193 2210 4.651045 AGCATCACTGACCATATCTACACA 59.349 41.667 0.00 0.00 0.00 3.72
2194 2211 5.306419 AGCATCACTGACCATATCTACACAT 59.694 40.000 0.00 0.00 0.00 3.21
2195 2212 5.407691 GCATCACTGACCATATCTACACATG 59.592 44.000 0.00 0.00 0.00 3.21
2196 2213 6.519382 CATCACTGACCATATCTACACATGT 58.481 40.000 0.00 0.00 0.00 3.21
2197 2214 6.544928 TCACTGACCATATCTACACATGTT 57.455 37.500 0.00 0.00 0.00 2.71
2198 2215 6.340522 TCACTGACCATATCTACACATGTTG 58.659 40.000 0.00 0.00 0.00 3.33
2199 2216 5.007039 CACTGACCATATCTACACATGTTGC 59.993 44.000 0.00 0.00 0.00 4.17
2200 2217 5.104776 ACTGACCATATCTACACATGTTGCT 60.105 40.000 0.00 0.00 0.00 3.91
2201 2218 6.098266 ACTGACCATATCTACACATGTTGCTA 59.902 38.462 0.00 0.00 0.00 3.49
2202 2219 7.066307 TGACCATATCTACACATGTTGCTAT 57.934 36.000 0.00 0.00 0.00 2.97
2203 2220 7.154656 TGACCATATCTACACATGTTGCTATC 58.845 38.462 0.00 0.00 0.00 2.08
2204 2221 6.159293 ACCATATCTACACATGTTGCTATCG 58.841 40.000 0.00 0.00 0.00 2.92
2205 2222 5.062683 CCATATCTACACATGTTGCTATCGC 59.937 44.000 0.00 0.00 0.00 4.58
2206 2223 2.821546 TCTACACATGTTGCTATCGCC 58.178 47.619 0.00 0.00 34.43 5.54
2207 2224 2.167487 TCTACACATGTTGCTATCGCCA 59.833 45.455 0.00 0.00 34.43 5.69
2208 2225 1.819928 ACACATGTTGCTATCGCCAA 58.180 45.000 0.00 0.00 34.43 4.52
2209 2226 2.158559 ACACATGTTGCTATCGCCAAA 58.841 42.857 0.00 0.00 34.43 3.28
2210 2227 2.556189 ACACATGTTGCTATCGCCAAAA 59.444 40.909 0.00 0.00 34.43 2.44
2211 2228 3.005261 ACACATGTTGCTATCGCCAAAAA 59.995 39.130 0.00 0.00 34.43 1.94
2212 2229 4.175516 CACATGTTGCTATCGCCAAAAAT 58.824 39.130 0.00 0.00 34.43 1.82
2213 2230 4.031991 CACATGTTGCTATCGCCAAAAATG 59.968 41.667 0.00 0.00 34.43 2.32
2214 2231 3.229276 TGTTGCTATCGCCAAAAATGG 57.771 42.857 0.00 0.00 34.43 3.16
2223 2240 3.495124 CCAAAAATGGCCAGTGACG 57.505 52.632 13.05 0.00 0.00 4.35
2224 2241 0.038343 CCAAAAATGGCCAGTGACGG 60.038 55.000 13.05 6.08 0.00 4.79
2225 2242 0.038343 CAAAAATGGCCAGTGACGGG 60.038 55.000 13.05 0.00 0.00 5.28
2231 2248 2.597510 GCCAGTGACGGGCCTTTT 60.598 61.111 16.13 0.00 45.87 2.27
2232 2249 2.200337 GCCAGTGACGGGCCTTTTT 61.200 57.895 16.13 0.00 45.87 1.94
2233 2250 1.956802 CCAGTGACGGGCCTTTTTC 59.043 57.895 0.84 0.00 0.00 2.29
2234 2251 0.537371 CCAGTGACGGGCCTTTTTCT 60.537 55.000 0.84 0.00 0.00 2.52
2235 2252 1.318576 CAGTGACGGGCCTTTTTCTT 58.681 50.000 0.84 0.00 0.00 2.52
2236 2253 1.266989 CAGTGACGGGCCTTTTTCTTC 59.733 52.381 0.84 0.00 0.00 2.87
2237 2254 1.143073 AGTGACGGGCCTTTTTCTTCT 59.857 47.619 0.84 0.00 0.00 2.85
2238 2255 1.954382 GTGACGGGCCTTTTTCTTCTT 59.046 47.619 0.84 0.00 0.00 2.52
2239 2256 2.031069 GTGACGGGCCTTTTTCTTCTTC 60.031 50.000 0.84 0.00 0.00 2.87
2240 2257 2.158667 TGACGGGCCTTTTTCTTCTTCT 60.159 45.455 0.84 0.00 0.00 2.85
2241 2258 2.885266 GACGGGCCTTTTTCTTCTTCTT 59.115 45.455 0.84 0.00 0.00 2.52
2242 2259 2.885266 ACGGGCCTTTTTCTTCTTCTTC 59.115 45.455 0.84 0.00 0.00 2.87
2243 2260 2.229062 CGGGCCTTTTTCTTCTTCTTCC 59.771 50.000 0.84 0.00 0.00 3.46
2244 2261 2.563179 GGGCCTTTTTCTTCTTCTTCCC 59.437 50.000 0.84 0.00 0.00 3.97
2245 2262 3.230976 GGCCTTTTTCTTCTTCTTCCCA 58.769 45.455 0.00 0.00 0.00 4.37
2246 2263 3.641436 GGCCTTTTTCTTCTTCTTCCCAA 59.359 43.478 0.00 0.00 0.00 4.12
2247 2264 4.284490 GGCCTTTTTCTTCTTCTTCCCAAT 59.716 41.667 0.00 0.00 0.00 3.16
2248 2265 5.473931 GCCTTTTTCTTCTTCTTCCCAATC 58.526 41.667 0.00 0.00 0.00 2.67
2249 2266 5.567623 GCCTTTTTCTTCTTCTTCCCAATCC 60.568 44.000 0.00 0.00 0.00 3.01
2250 2267 5.539955 CCTTTTTCTTCTTCTTCCCAATCCA 59.460 40.000 0.00 0.00 0.00 3.41
2251 2268 6.405278 TTTTTCTTCTTCTTCCCAATCCAC 57.595 37.500 0.00 0.00 0.00 4.02
2252 2269 3.721087 TCTTCTTCTTCCCAATCCACC 57.279 47.619 0.00 0.00 0.00 4.61
2253 2270 2.986019 TCTTCTTCTTCCCAATCCACCA 59.014 45.455 0.00 0.00 0.00 4.17
2254 2271 3.593328 TCTTCTTCTTCCCAATCCACCAT 59.407 43.478 0.00 0.00 0.00 3.55
2255 2272 4.044571 TCTTCTTCTTCCCAATCCACCATT 59.955 41.667 0.00 0.00 0.00 3.16
2256 2273 3.700538 TCTTCTTCCCAATCCACCATTG 58.299 45.455 0.00 0.00 41.64 2.82
2257 2274 3.075882 TCTTCTTCCCAATCCACCATTGT 59.924 43.478 0.00 0.00 40.51 2.71
2258 2275 3.085952 TCTTCCCAATCCACCATTGTC 57.914 47.619 0.00 0.00 40.51 3.18
2259 2276 2.102578 CTTCCCAATCCACCATTGTCC 58.897 52.381 0.00 0.00 40.51 4.02
2260 2277 1.381867 TCCCAATCCACCATTGTCCT 58.618 50.000 0.00 0.00 40.51 3.85
2261 2278 1.284785 TCCCAATCCACCATTGTCCTC 59.715 52.381 0.00 0.00 40.51 3.71
2262 2279 1.686115 CCCAATCCACCATTGTCCTCC 60.686 57.143 0.00 0.00 40.51 4.30
2263 2280 1.686115 CCAATCCACCATTGTCCTCCC 60.686 57.143 0.00 0.00 40.51 4.30
2264 2281 1.285962 CAATCCACCATTGTCCTCCCT 59.714 52.381 0.00 0.00 37.67 4.20
2265 2282 0.921896 ATCCACCATTGTCCTCCCTG 59.078 55.000 0.00 0.00 0.00 4.45
2266 2283 0.178876 TCCACCATTGTCCTCCCTGA 60.179 55.000 0.00 0.00 0.00 3.86
2267 2284 0.254178 CCACCATTGTCCTCCCTGAG 59.746 60.000 0.00 0.00 0.00 3.35
2268 2285 1.279496 CACCATTGTCCTCCCTGAGA 58.721 55.000 0.00 0.00 0.00 3.27
2269 2286 1.630369 CACCATTGTCCTCCCTGAGAA 59.370 52.381 0.00 0.00 0.00 2.87
2270 2287 2.240667 CACCATTGTCCTCCCTGAGAAT 59.759 50.000 0.00 0.00 0.00 2.40
2271 2288 3.455910 CACCATTGTCCTCCCTGAGAATA 59.544 47.826 0.00 0.00 28.18 1.75
2272 2289 3.713764 ACCATTGTCCTCCCTGAGAATAG 59.286 47.826 0.00 0.00 28.18 1.73
2273 2290 3.713764 CCATTGTCCTCCCTGAGAATAGT 59.286 47.826 0.00 0.00 28.18 2.12
2274 2291 4.164988 CCATTGTCCTCCCTGAGAATAGTT 59.835 45.833 0.00 0.00 28.18 2.24
2275 2292 5.363939 CATTGTCCTCCCTGAGAATAGTTC 58.636 45.833 0.00 0.00 28.18 3.01
2276 2293 4.338795 TGTCCTCCCTGAGAATAGTTCT 57.661 45.455 0.00 0.00 44.21 3.01
2277 2294 4.689062 TGTCCTCCCTGAGAATAGTTCTT 58.311 43.478 0.00 0.00 40.87 2.52
2278 2295 4.712337 TGTCCTCCCTGAGAATAGTTCTTC 59.288 45.833 0.00 0.00 40.87 2.87
2279 2296 4.100344 GTCCTCCCTGAGAATAGTTCTTCC 59.900 50.000 0.00 0.00 40.87 3.46
2280 2297 4.016105 TCCTCCCTGAGAATAGTTCTTCCT 60.016 45.833 0.00 0.00 40.87 3.36
2281 2298 5.195960 TCCTCCCTGAGAATAGTTCTTCCTA 59.804 44.000 0.00 0.00 40.87 2.94
2282 2299 5.303333 CCTCCCTGAGAATAGTTCTTCCTAC 59.697 48.000 0.00 0.00 40.87 3.18
2283 2300 5.209659 TCCCTGAGAATAGTTCTTCCTACC 58.790 45.833 0.00 0.00 40.87 3.18
2284 2301 4.345547 CCCTGAGAATAGTTCTTCCTACCC 59.654 50.000 0.00 0.00 40.87 3.69
2285 2302 4.345547 CCTGAGAATAGTTCTTCCTACCCC 59.654 50.000 0.00 0.00 40.87 4.95
2286 2303 5.212745 CTGAGAATAGTTCTTCCTACCCCT 58.787 45.833 0.00 0.00 40.87 4.79
2287 2304 4.962995 TGAGAATAGTTCTTCCTACCCCTG 59.037 45.833 0.00 0.00 40.87 4.45
2288 2305 4.299485 AGAATAGTTCTTCCTACCCCTGG 58.701 47.826 0.00 0.00 36.36 4.45
2289 2306 4.015541 AGAATAGTTCTTCCTACCCCTGGA 60.016 45.833 0.00 0.00 36.36 3.86
2290 2307 2.255770 AGTTCTTCCTACCCCTGGAG 57.744 55.000 0.00 0.00 34.76 3.86
2291 2308 0.542333 GTTCTTCCTACCCCTGGAGC 59.458 60.000 0.00 0.00 34.76 4.70
2292 2309 0.118346 TTCTTCCTACCCCTGGAGCA 59.882 55.000 0.00 0.00 34.76 4.26
2293 2310 0.325671 TCTTCCTACCCCTGGAGCAG 60.326 60.000 0.00 0.00 34.76 4.24
2294 2311 0.618968 CTTCCTACCCCTGGAGCAGT 60.619 60.000 0.00 0.00 34.76 4.40
2295 2312 0.178873 TTCCTACCCCTGGAGCAGTT 60.179 55.000 0.00 0.00 34.76 3.16
2296 2313 0.178873 TCCTACCCCTGGAGCAGTTT 60.179 55.000 0.00 0.00 0.00 2.66
2297 2314 0.035056 CCTACCCCTGGAGCAGTTTG 60.035 60.000 0.00 0.00 0.00 2.93
2298 2315 0.693049 CTACCCCTGGAGCAGTTTGT 59.307 55.000 0.00 0.00 0.00 2.83
2299 2316 0.400213 TACCCCTGGAGCAGTTTGTG 59.600 55.000 0.00 0.00 0.00 3.33
2326 2343 4.455070 AGGTAAGCTCATTATTTCCCCC 57.545 45.455 0.00 0.00 0.00 5.40
2344 2361 2.431954 CCCTCGGGAACACTAGTAGA 57.568 55.000 3.59 0.00 37.50 2.59
2345 2362 2.731572 CCCTCGGGAACACTAGTAGAA 58.268 52.381 3.59 0.00 37.50 2.10
2346 2363 3.094572 CCCTCGGGAACACTAGTAGAAA 58.905 50.000 3.59 0.00 37.50 2.52
2347 2364 3.512724 CCCTCGGGAACACTAGTAGAAAA 59.487 47.826 3.59 0.00 37.50 2.29
2348 2365 4.020839 CCCTCGGGAACACTAGTAGAAAAA 60.021 45.833 3.59 0.00 37.50 1.94
2349 2366 5.169295 CCTCGGGAACACTAGTAGAAAAAG 58.831 45.833 3.59 0.00 0.00 2.27
2350 2367 5.143376 TCGGGAACACTAGTAGAAAAAGG 57.857 43.478 3.59 0.00 0.00 3.11
2351 2368 4.020839 TCGGGAACACTAGTAGAAAAAGGG 60.021 45.833 3.59 0.00 0.00 3.95
2352 2369 4.008330 GGGAACACTAGTAGAAAAAGGGC 58.992 47.826 3.59 0.00 0.00 5.19
2353 2370 4.008330 GGAACACTAGTAGAAAAAGGGCC 58.992 47.826 3.59 0.00 0.00 5.80
2354 2371 4.263374 GGAACACTAGTAGAAAAAGGGCCT 60.263 45.833 0.00 0.00 0.00 5.19
2355 2372 5.046087 GGAACACTAGTAGAAAAAGGGCCTA 60.046 44.000 6.41 0.00 0.00 3.93
2356 2373 6.352823 GGAACACTAGTAGAAAAAGGGCCTAT 60.353 42.308 6.41 0.00 0.00 2.57
2357 2374 6.638021 ACACTAGTAGAAAAAGGGCCTATT 57.362 37.500 6.41 5.13 0.00 1.73
2358 2375 6.415573 ACACTAGTAGAAAAAGGGCCTATTG 58.584 40.000 6.41 0.00 0.00 1.90
2359 2376 6.012771 ACACTAGTAGAAAAAGGGCCTATTGT 60.013 38.462 6.41 6.68 0.00 2.71
2360 2377 6.539103 CACTAGTAGAAAAAGGGCCTATTGTC 59.461 42.308 6.41 8.43 0.00 3.18
2361 2378 4.856509 AGTAGAAAAAGGGCCTATTGTCC 58.143 43.478 6.41 0.00 0.00 4.02
2362 2379 3.101643 AGAAAAAGGGCCTATTGTCCC 57.898 47.619 6.41 0.00 42.94 4.46
2366 2383 3.004090 GGGCCTATTGTCCCGGTT 58.996 61.111 0.84 0.00 32.00 4.44
2367 2384 1.453197 GGGCCTATTGTCCCGGTTG 60.453 63.158 0.84 0.00 32.00 3.77
2368 2385 1.453197 GGCCTATTGTCCCGGTTGG 60.453 63.158 0.00 0.00 0.00 3.77
2369 2386 1.301954 GCCTATTGTCCCGGTTGGT 59.698 57.895 0.00 0.00 34.77 3.67
2370 2387 1.029947 GCCTATTGTCCCGGTTGGTG 61.030 60.000 0.00 0.00 34.77 4.17
2371 2388 0.616371 CCTATTGTCCCGGTTGGTGA 59.384 55.000 0.00 0.00 34.77 4.02
2372 2389 1.406887 CCTATTGTCCCGGTTGGTGAG 60.407 57.143 0.00 0.00 34.77 3.51
2373 2390 0.616371 TATTGTCCCGGTTGGTGAGG 59.384 55.000 0.00 0.00 34.77 3.86
2374 2391 2.137177 ATTGTCCCGGTTGGTGAGGG 62.137 60.000 0.00 0.00 46.40 4.30
2375 2392 4.717313 GTCCCGGTTGGTGAGGGC 62.717 72.222 0.00 0.00 44.70 5.19
2378 2395 3.966543 CCGGTTGGTGAGGGCCTT 61.967 66.667 7.89 0.00 0.00 4.35
2379 2396 2.115266 CGGTTGGTGAGGGCCTTT 59.885 61.111 7.89 0.00 0.00 3.11
2380 2397 1.377229 CGGTTGGTGAGGGCCTTTA 59.623 57.895 7.89 0.00 0.00 1.85
2381 2398 0.676782 CGGTTGGTGAGGGCCTTTAG 60.677 60.000 7.89 0.00 0.00 1.85
2382 2399 0.404426 GGTTGGTGAGGGCCTTTAGT 59.596 55.000 7.89 0.00 0.00 2.24
2383 2400 1.613520 GGTTGGTGAGGGCCTTTAGTC 60.614 57.143 7.89 0.00 0.00 2.59
2384 2401 0.696501 TTGGTGAGGGCCTTTAGTCC 59.303 55.000 7.89 6.97 0.00 3.85
2385 2402 1.205460 TGGTGAGGGCCTTTAGTCCC 61.205 60.000 7.89 2.27 42.94 4.46
2389 2406 3.084304 GGGCCTTTAGTCCCGGTT 58.916 61.111 0.84 0.00 32.00 4.44
2390 2407 1.077930 GGGCCTTTAGTCCCGGTTC 60.078 63.158 0.84 0.00 32.00 3.62
2391 2408 1.559965 GGGCCTTTAGTCCCGGTTCT 61.560 60.000 0.84 0.15 32.00 3.01
2392 2409 0.392595 GGCCTTTAGTCCCGGTTCTG 60.393 60.000 0.00 0.00 0.00 3.02
2393 2410 0.392595 GCCTTTAGTCCCGGTTCTGG 60.393 60.000 0.00 0.00 0.00 3.86
2394 2411 1.272807 CCTTTAGTCCCGGTTCTGGA 58.727 55.000 0.00 0.00 0.00 3.86
2395 2412 1.626825 CCTTTAGTCCCGGTTCTGGAA 59.373 52.381 0.00 0.00 32.59 3.53
2396 2413 2.614734 CCTTTAGTCCCGGTTCTGGAAC 60.615 54.545 0.00 5.02 40.45 3.62
2406 2423 2.845363 GTTCTGGAACCGGGACTAAA 57.155 50.000 6.32 0.00 35.36 1.85
2407 2424 2.696506 GTTCTGGAACCGGGACTAAAG 58.303 52.381 6.32 0.00 35.36 1.85
2408 2425 1.272807 TCTGGAACCGGGACTAAAGG 58.727 55.000 6.32 0.00 0.00 3.11
2409 2426 0.252197 CTGGAACCGGGACTAAAGGG 59.748 60.000 6.32 0.00 0.00 3.95
2410 2427 0.474273 TGGAACCGGGACTAAAGGGT 60.474 55.000 6.32 0.00 0.00 4.34
2411 2428 0.251354 GGAACCGGGACTAAAGGGTC 59.749 60.000 6.32 0.00 40.88 4.46
2412 2429 0.108472 GAACCGGGACTAAAGGGTCG 60.108 60.000 6.32 0.00 37.12 4.79
2413 2430 0.833409 AACCGGGACTAAAGGGTCGT 60.833 55.000 6.32 0.00 37.12 4.34
2414 2431 0.833409 ACCGGGACTAAAGGGTCGTT 60.833 55.000 6.32 0.00 37.12 3.85
2415 2432 1.185315 CCGGGACTAAAGGGTCGTTA 58.815 55.000 0.00 0.00 37.12 3.18
2416 2433 1.134995 CCGGGACTAAAGGGTCGTTAC 60.135 57.143 0.00 0.00 37.12 2.50
2417 2434 1.821136 CGGGACTAAAGGGTCGTTACT 59.179 52.381 0.00 0.00 37.12 2.24
2418 2435 3.016736 CGGGACTAAAGGGTCGTTACTA 58.983 50.000 0.00 0.00 37.12 1.82
2419 2436 3.443681 CGGGACTAAAGGGTCGTTACTAA 59.556 47.826 0.00 0.00 37.12 2.24
2420 2437 4.082245 CGGGACTAAAGGGTCGTTACTAAA 60.082 45.833 0.00 0.00 37.12 1.85
2421 2438 5.414360 GGGACTAAAGGGTCGTTACTAAAG 58.586 45.833 0.00 0.00 37.12 1.85
2422 2439 4.867047 GGACTAAAGGGTCGTTACTAAAGC 59.133 45.833 0.00 0.00 37.12 3.51
2423 2440 4.825422 ACTAAAGGGTCGTTACTAAAGCC 58.175 43.478 0.00 0.00 0.00 4.35
2424 2441 2.775911 AAGGGTCGTTACTAAAGCCC 57.224 50.000 0.00 0.00 36.46 5.19
2425 2442 0.907486 AGGGTCGTTACTAAAGCCCC 59.093 55.000 9.19 2.76 36.86 5.80
2426 2443 0.107508 GGGTCGTTACTAAAGCCCCC 60.108 60.000 0.00 0.00 0.00 5.40
2444 2461 2.446036 CCCCCTTCCTAGTCCCGG 60.446 72.222 0.00 0.00 0.00 5.73
2445 2462 2.367378 CCCCTTCCTAGTCCCGGT 59.633 66.667 0.00 0.00 0.00 5.28
2446 2463 1.306739 CCCCTTCCTAGTCCCGGTT 60.307 63.158 0.00 0.00 0.00 4.44
2447 2464 1.335882 CCCCTTCCTAGTCCCGGTTC 61.336 65.000 0.00 0.00 0.00 3.62
2448 2465 0.325390 CCCTTCCTAGTCCCGGTTCT 60.325 60.000 0.00 0.15 0.00 3.01
2449 2466 1.569653 CCTTCCTAGTCCCGGTTCTT 58.430 55.000 0.00 0.00 0.00 2.52
2450 2467 2.625087 CCCTTCCTAGTCCCGGTTCTTA 60.625 54.545 0.00 0.00 0.00 2.10
2451 2468 3.306613 CCTTCCTAGTCCCGGTTCTTAT 58.693 50.000 0.00 0.00 0.00 1.73
2452 2469 4.477249 CCTTCCTAGTCCCGGTTCTTATA 58.523 47.826 0.00 0.00 0.00 0.98
2453 2470 4.280425 CCTTCCTAGTCCCGGTTCTTATAC 59.720 50.000 0.00 0.00 0.00 1.47
2454 2471 3.480470 TCCTAGTCCCGGTTCTTATACG 58.520 50.000 0.00 0.00 0.00 3.06
2455 2472 3.136443 TCCTAGTCCCGGTTCTTATACGA 59.864 47.826 0.00 0.00 0.00 3.43
2456 2473 3.885297 CCTAGTCCCGGTTCTTATACGAA 59.115 47.826 0.00 0.00 0.00 3.85
2457 2474 3.790152 AGTCCCGGTTCTTATACGAAC 57.210 47.619 12.48 12.48 41.91 3.95
2464 2481 3.790152 GTTCTTATACGAACCGGGACT 57.210 47.619 6.32 0.00 37.82 3.85
2465 2482 4.900635 GTTCTTATACGAACCGGGACTA 57.099 45.455 6.32 0.00 37.82 2.59
2466 2483 5.248870 GTTCTTATACGAACCGGGACTAA 57.751 43.478 6.32 0.00 37.82 2.24
2467 2484 5.650543 GTTCTTATACGAACCGGGACTAAA 58.349 41.667 6.32 0.00 37.82 1.85
2468 2485 5.505173 TCTTATACGAACCGGGACTAAAG 57.495 43.478 6.32 0.54 0.00 1.85
2469 2486 4.339247 TCTTATACGAACCGGGACTAAAGG 59.661 45.833 6.32 0.00 0.00 3.11
2470 2487 0.532115 TACGAACCGGGACTAAAGGC 59.468 55.000 6.32 0.00 0.00 4.35
2471 2488 1.449070 CGAACCGGGACTAAAGGCC 60.449 63.158 6.32 0.00 0.00 5.19
2472 2489 1.077930 GAACCGGGACTAAAGGCCC 60.078 63.158 11.29 11.29 41.11 5.80
2473 2490 1.540617 AACCGGGACTAAAGGCCCT 60.541 57.895 18.97 0.00 42.40 5.19
2474 2491 1.559965 AACCGGGACTAAAGGCCCTC 61.560 60.000 18.97 0.00 42.40 4.30
2475 2492 2.743179 CCGGGACTAAAGGCCCTCC 61.743 68.421 18.97 0.00 42.40 4.30
2476 2493 1.993391 CGGGACTAAAGGCCCTCCA 60.993 63.158 18.97 0.00 42.40 3.86
2477 2494 1.608154 GGGACTAAAGGCCCTCCAC 59.392 63.158 14.19 0.00 41.31 4.02
2478 2495 1.221021 GGACTAAAGGCCCTCCACG 59.779 63.158 0.00 0.00 33.74 4.94
2479 2496 1.551019 GGACTAAAGGCCCTCCACGT 61.551 60.000 0.00 0.00 33.74 4.49
2480 2497 0.391263 GACTAAAGGCCCTCCACGTG 60.391 60.000 9.08 9.08 33.74 4.49
2481 2498 1.078426 CTAAAGGCCCTCCACGTGG 60.078 63.158 29.26 29.26 33.74 4.94
2494 2511 2.813908 CGTGGCCGTTGCTAGTCC 60.814 66.667 0.00 0.00 37.74 3.85
2495 2512 2.436115 GTGGCCGTTGCTAGTCCC 60.436 66.667 0.00 0.00 37.74 4.46
2496 2513 4.077184 TGGCCGTTGCTAGTCCCG 62.077 66.667 0.00 0.00 37.74 5.14
2497 2514 4.832608 GGCCGTTGCTAGTCCCGG 62.833 72.222 10.52 10.52 43.22 5.73
2498 2515 4.078516 GCCGTTGCTAGTCCCGGT 62.079 66.667 14.60 0.00 42.36 5.28
2499 2516 2.660802 CCGTTGCTAGTCCCGGTT 59.339 61.111 0.00 0.00 35.78 4.44
2500 2517 1.740296 CCGTTGCTAGTCCCGGTTG 60.740 63.158 0.00 0.00 35.78 3.77
2501 2518 1.740296 CGTTGCTAGTCCCGGTTGG 60.740 63.158 0.00 0.00 0.00 3.77
2502 2519 1.373812 GTTGCTAGTCCCGGTTGGT 59.626 57.895 0.00 0.00 34.77 3.67
2503 2520 0.609662 GTTGCTAGTCCCGGTTGGTA 59.390 55.000 0.00 0.00 34.77 3.25
2504 2521 1.002315 GTTGCTAGTCCCGGTTGGTAA 59.998 52.381 0.00 0.00 34.77 2.85
2505 2522 0.609662 TGCTAGTCCCGGTTGGTAAC 59.390 55.000 0.00 0.00 34.77 2.50
2520 2537 3.676291 GGTAACACCAACCGGTACTAA 57.324 47.619 8.00 0.00 46.94 2.24
2521 2538 4.001618 GGTAACACCAACCGGTACTAAA 57.998 45.455 8.00 0.00 46.94 1.85
2522 2539 3.996363 GGTAACACCAACCGGTACTAAAG 59.004 47.826 8.00 0.00 46.94 1.85
2523 2540 2.845363 ACACCAACCGGTACTAAAGG 57.155 50.000 8.00 6.03 46.94 3.11
2524 2541 2.328319 ACACCAACCGGTACTAAAGGA 58.672 47.619 8.00 0.00 46.94 3.36
2525 2542 2.705127 ACACCAACCGGTACTAAAGGAA 59.295 45.455 8.00 0.00 46.94 3.36
2526 2543 3.136260 ACACCAACCGGTACTAAAGGAAA 59.864 43.478 8.00 0.00 46.94 3.13
2527 2544 4.202493 ACACCAACCGGTACTAAAGGAAAT 60.202 41.667 8.00 0.00 46.94 2.17
2528 2545 4.763279 CACCAACCGGTACTAAAGGAAATT 59.237 41.667 8.00 0.00 46.94 1.82
2529 2546 5.242171 CACCAACCGGTACTAAAGGAAATTT 59.758 40.000 8.00 0.00 46.94 1.82
2530 2547 5.834742 ACCAACCGGTACTAAAGGAAATTTT 59.165 36.000 8.00 0.00 46.71 1.82
2531 2548 7.003482 ACCAACCGGTACTAAAGGAAATTTTA 58.997 34.615 8.00 0.00 46.71 1.52
2532 2549 7.670979 ACCAACCGGTACTAAAGGAAATTTTAT 59.329 33.333 8.00 0.00 46.71 1.40
2533 2550 7.971722 CCAACCGGTACTAAAGGAAATTTTATG 59.028 37.037 8.00 0.00 32.01 1.90
2534 2551 8.732531 CAACCGGTACTAAAGGAAATTTTATGA 58.267 33.333 8.00 0.00 32.01 2.15
2535 2552 9.470399 AACCGGTACTAAAGGAAATTTTATGAT 57.530 29.630 8.00 0.00 32.01 2.45
2536 2553 9.470399 ACCGGTACTAAAGGAAATTTTATGATT 57.530 29.630 4.49 0.00 32.01 2.57
2601 2618 9.620259 ATTTCAACTTCTAATCTCTAATCACCC 57.380 33.333 0.00 0.00 0.00 4.61
2602 2619 7.125792 TCAACTTCTAATCTCTAATCACCCC 57.874 40.000 0.00 0.00 0.00 4.95
2603 2620 6.672218 TCAACTTCTAATCTCTAATCACCCCA 59.328 38.462 0.00 0.00 0.00 4.96
2604 2621 6.487299 ACTTCTAATCTCTAATCACCCCAC 57.513 41.667 0.00 0.00 0.00 4.61
2605 2622 5.964477 ACTTCTAATCTCTAATCACCCCACA 59.036 40.000 0.00 0.00 0.00 4.17
2606 2623 6.617371 ACTTCTAATCTCTAATCACCCCACAT 59.383 38.462 0.00 0.00 0.00 3.21
2607 2624 6.672266 TCTAATCTCTAATCACCCCACATC 57.328 41.667 0.00 0.00 0.00 3.06
2608 2625 6.143206 TCTAATCTCTAATCACCCCACATCA 58.857 40.000 0.00 0.00 0.00 3.07
2609 2626 4.696479 ATCTCTAATCACCCCACATCAC 57.304 45.455 0.00 0.00 0.00 3.06
2610 2627 3.724478 TCTCTAATCACCCCACATCACT 58.276 45.455 0.00 0.00 0.00 3.41
2611 2628 3.452264 TCTCTAATCACCCCACATCACTG 59.548 47.826 0.00 0.00 0.00 3.66
2612 2629 2.092968 TCTAATCACCCCACATCACTGC 60.093 50.000 0.00 0.00 0.00 4.40
2613 2630 0.700564 AATCACCCCACATCACTGCT 59.299 50.000 0.00 0.00 0.00 4.24
2614 2631 0.254178 ATCACCCCACATCACTGCTC 59.746 55.000 0.00 0.00 0.00 4.26
2615 2632 1.126948 TCACCCCACATCACTGCTCA 61.127 55.000 0.00 0.00 0.00 4.26
2616 2633 0.250858 CACCCCACATCACTGCTCAA 60.251 55.000 0.00 0.00 0.00 3.02
2617 2634 0.700564 ACCCCACATCACTGCTCAAT 59.299 50.000 0.00 0.00 0.00 2.57
2618 2635 1.076024 ACCCCACATCACTGCTCAATT 59.924 47.619 0.00 0.00 0.00 2.32
2619 2636 2.173519 CCCCACATCACTGCTCAATTT 58.826 47.619 0.00 0.00 0.00 1.82
2620 2637 3.245229 ACCCCACATCACTGCTCAATTTA 60.245 43.478 0.00 0.00 0.00 1.40
2621 2638 3.763360 CCCCACATCACTGCTCAATTTAA 59.237 43.478 0.00 0.00 0.00 1.52
2622 2639 4.380867 CCCCACATCACTGCTCAATTTAAC 60.381 45.833 0.00 0.00 0.00 2.01
2623 2640 4.380867 CCCACATCACTGCTCAATTTAACC 60.381 45.833 0.00 0.00 0.00 2.85
2624 2641 4.460382 CCACATCACTGCTCAATTTAACCT 59.540 41.667 0.00 0.00 0.00 3.50
2625 2642 5.392380 CCACATCACTGCTCAATTTAACCTC 60.392 44.000 0.00 0.00 0.00 3.85
2626 2643 5.413833 CACATCACTGCTCAATTTAACCTCT 59.586 40.000 0.00 0.00 0.00 3.69
2627 2644 6.595326 CACATCACTGCTCAATTTAACCTCTA 59.405 38.462 0.00 0.00 0.00 2.43
2628 2645 7.119699 CACATCACTGCTCAATTTAACCTCTAA 59.880 37.037 0.00 0.00 0.00 2.10
2629 2646 7.831193 ACATCACTGCTCAATTTAACCTCTAAT 59.169 33.333 0.00 0.00 0.00 1.73
2630 2647 7.849804 TCACTGCTCAATTTAACCTCTAATC 57.150 36.000 0.00 0.00 0.00 1.75
2631 2648 7.624549 TCACTGCTCAATTTAACCTCTAATCT 58.375 34.615 0.00 0.00 0.00 2.40
2632 2649 7.766278 TCACTGCTCAATTTAACCTCTAATCTC 59.234 37.037 0.00 0.00 0.00 2.75
2633 2650 7.768120 CACTGCTCAATTTAACCTCTAATCTCT 59.232 37.037 0.00 0.00 0.00 3.10
2634 2651 8.982723 ACTGCTCAATTTAACCTCTAATCTCTA 58.017 33.333 0.00 0.00 0.00 2.43
2635 2652 9.823647 CTGCTCAATTTAACCTCTAATCTCTAA 57.176 33.333 0.00 0.00 0.00 2.10
2642 2659 7.613551 TTAACCTCTAATCTCTAATCACCCC 57.386 40.000 0.00 0.00 0.00 4.95
2643 2660 5.426325 ACCTCTAATCTCTAATCACCCCT 57.574 43.478 0.00 0.00 0.00 4.79
2644 2661 5.399113 ACCTCTAATCTCTAATCACCCCTC 58.601 45.833 0.00 0.00 0.00 4.30
2645 2662 5.103043 ACCTCTAATCTCTAATCACCCCTCA 60.103 44.000 0.00 0.00 0.00 3.86
2646 2663 6.022315 CCTCTAATCTCTAATCACCCCTCAT 58.978 44.000 0.00 0.00 0.00 2.90
2647 2664 6.154363 CCTCTAATCTCTAATCACCCCTCATC 59.846 46.154 0.00 0.00 0.00 2.92
2648 2665 6.624297 TCTAATCTCTAATCACCCCTCATCA 58.376 40.000 0.00 0.00 0.00 3.07
2649 2666 7.251936 TCTAATCTCTAATCACCCCTCATCAT 58.748 38.462 0.00 0.00 0.00 2.45
2650 2667 6.776887 AATCTCTAATCACCCCTCATCATT 57.223 37.500 0.00 0.00 0.00 2.57
2651 2668 6.776887 ATCTCTAATCACCCCTCATCATTT 57.223 37.500 0.00 0.00 0.00 2.32
2652 2669 6.179906 TCTCTAATCACCCCTCATCATTTC 57.820 41.667 0.00 0.00 0.00 2.17
2653 2670 5.667172 TCTCTAATCACCCCTCATCATTTCA 59.333 40.000 0.00 0.00 0.00 2.69
2654 2671 6.158520 TCTCTAATCACCCCTCATCATTTCAA 59.841 38.462 0.00 0.00 0.00 2.69
2655 2672 6.730447 TCTAATCACCCCTCATCATTTCAAA 58.270 36.000 0.00 0.00 0.00 2.69
2656 2673 7.356680 TCTAATCACCCCTCATCATTTCAAAT 58.643 34.615 0.00 0.00 0.00 2.32
2657 2674 6.475596 AATCACCCCTCATCATTTCAAATC 57.524 37.500 0.00 0.00 0.00 2.17
2658 2675 4.933134 TCACCCCTCATCATTTCAAATCA 58.067 39.130 0.00 0.00 0.00 2.57
2659 2676 5.521696 TCACCCCTCATCATTTCAAATCAT 58.478 37.500 0.00 0.00 0.00 2.45
2660 2677 5.595542 TCACCCCTCATCATTTCAAATCATC 59.404 40.000 0.00 0.00 0.00 2.92
2661 2678 4.581824 ACCCCTCATCATTTCAAATCATCG 59.418 41.667 0.00 0.00 0.00 3.84
2662 2679 4.823442 CCCCTCATCATTTCAAATCATCGA 59.177 41.667 0.00 0.00 0.00 3.59
2663 2680 5.300034 CCCCTCATCATTTCAAATCATCGAA 59.700 40.000 0.00 0.00 0.00 3.71
2664 2681 6.204359 CCCTCATCATTTCAAATCATCGAAC 58.796 40.000 0.00 0.00 0.00 3.95
2665 2682 6.039047 CCCTCATCATTTCAAATCATCGAACT 59.961 38.462 0.00 0.00 0.00 3.01
2666 2683 7.415989 CCCTCATCATTTCAAATCATCGAACTT 60.416 37.037 0.00 0.00 0.00 2.66
2667 2684 7.642978 CCTCATCATTTCAAATCATCGAACTTC 59.357 37.037 0.00 0.00 0.00 3.01
2668 2685 7.475015 TCATCATTTCAAATCATCGAACTTCC 58.525 34.615 0.00 0.00 0.00 3.46
2669 2686 6.194796 TCATTTCAAATCATCGAACTTCCC 57.805 37.500 0.00 0.00 0.00 3.97
2670 2687 4.678509 TTTCAAATCATCGAACTTCCCG 57.321 40.909 0.00 0.00 0.00 5.14
2671 2688 2.627945 TCAAATCATCGAACTTCCCGG 58.372 47.619 0.00 0.00 0.00 5.73
2672 2689 2.235155 TCAAATCATCGAACTTCCCGGA 59.765 45.455 0.73 0.00 0.00 5.14
2673 2690 2.311124 AATCATCGAACTTCCCGGAC 57.689 50.000 0.73 0.00 0.00 4.79
2674 2691 0.102481 ATCATCGAACTTCCCGGACG 59.898 55.000 0.73 0.00 0.00 4.79
2675 2692 1.518572 CATCGAACTTCCCGGACGG 60.519 63.158 0.73 3.25 0.00 4.79
2676 2693 1.980772 ATCGAACTTCCCGGACGGT 60.981 57.895 0.73 0.00 0.00 4.83
2677 2694 1.941999 ATCGAACTTCCCGGACGGTC 61.942 60.000 0.73 0.00 0.00 4.79
2678 2695 2.922950 CGAACTTCCCGGACGGTCA 61.923 63.158 0.73 0.00 0.00 4.02
2679 2696 1.373873 GAACTTCCCGGACGGTCAC 60.374 63.158 0.73 0.00 0.00 3.67
2680 2697 2.776670 GAACTTCCCGGACGGTCACC 62.777 65.000 0.73 0.00 0.00 4.02
2681 2698 4.078516 CTTCCCGGACGGTCACCC 62.079 72.222 0.73 0.00 0.00 4.61
2682 2699 4.938074 TTCCCGGACGGTCACCCA 62.938 66.667 0.73 0.00 0.00 4.51
2683 2700 4.707768 TCCCGGACGGTCACCCAT 62.708 66.667 0.73 0.00 0.00 4.00
2684 2701 4.157120 CCCGGACGGTCACCCATC 62.157 72.222 0.73 0.00 0.00 3.51
2685 2702 4.157120 CCGGACGGTCACCCATCC 62.157 72.222 10.76 1.98 0.00 3.51
2686 2703 3.075005 CGGACGGTCACCCATCCT 61.075 66.667 10.76 0.00 0.00 3.24
2687 2704 2.901042 GGACGGTCACCCATCCTC 59.099 66.667 10.76 0.00 0.00 3.71
2688 2705 1.686110 GGACGGTCACCCATCCTCT 60.686 63.158 10.76 0.00 0.00 3.69
2689 2706 1.677637 GGACGGTCACCCATCCTCTC 61.678 65.000 10.76 0.00 0.00 3.20
2690 2707 0.970937 GACGGTCACCCATCCTCTCA 60.971 60.000 2.62 0.00 0.00 3.27
2691 2708 1.258445 ACGGTCACCCATCCTCTCAC 61.258 60.000 0.00 0.00 0.00 3.51
2692 2709 0.972983 CGGTCACCCATCCTCTCACT 60.973 60.000 0.00 0.00 0.00 3.41
2693 2710 1.685180 CGGTCACCCATCCTCTCACTA 60.685 57.143 0.00 0.00 0.00 2.74
2694 2711 1.757699 GGTCACCCATCCTCTCACTAC 59.242 57.143 0.00 0.00 0.00 2.73
2695 2712 2.624557 GGTCACCCATCCTCTCACTACT 60.625 54.545 0.00 0.00 0.00 2.57
2696 2713 2.691011 GTCACCCATCCTCTCACTACTC 59.309 54.545 0.00 0.00 0.00 2.59
2697 2714 2.035632 CACCCATCCTCTCACTACTCC 58.964 57.143 0.00 0.00 0.00 3.85
2698 2715 1.646447 ACCCATCCTCTCACTACTCCA 59.354 52.381 0.00 0.00 0.00 3.86
2699 2716 2.315176 CCCATCCTCTCACTACTCCAG 58.685 57.143 0.00 0.00 0.00 3.86
2700 2717 1.686052 CCATCCTCTCACTACTCCAGC 59.314 57.143 0.00 0.00 0.00 4.85
2701 2718 1.686052 CATCCTCTCACTACTCCAGCC 59.314 57.143 0.00 0.00 0.00 4.85
2702 2719 1.003646 TCCTCTCACTACTCCAGCCT 58.996 55.000 0.00 0.00 0.00 4.58
2703 2720 1.110442 CCTCTCACTACTCCAGCCTG 58.890 60.000 0.00 0.00 0.00 4.85
2704 2721 1.341482 CCTCTCACTACTCCAGCCTGA 60.341 57.143 0.00 0.00 0.00 3.86
2705 2722 2.023673 CTCTCACTACTCCAGCCTGAG 58.976 57.143 0.00 0.00 38.37 3.35
2706 2723 0.459489 CTCACTACTCCAGCCTGAGC 59.541 60.000 0.00 0.00 35.72 4.26
2707 2724 0.251787 TCACTACTCCAGCCTGAGCA 60.252 55.000 0.00 0.00 43.56 4.26
2708 2725 0.829333 CACTACTCCAGCCTGAGCAT 59.171 55.000 0.00 0.00 43.56 3.79
2709 2726 0.829333 ACTACTCCAGCCTGAGCATG 59.171 55.000 0.00 0.00 43.56 4.06
2710 2727 0.532417 CTACTCCAGCCTGAGCATGC 60.532 60.000 10.51 10.51 43.56 4.06
2711 2728 0.979709 TACTCCAGCCTGAGCATGCT 60.980 55.000 22.92 22.92 43.56 3.79
2712 2729 1.077644 CTCCAGCCTGAGCATGCTT 60.078 57.895 23.61 5.39 43.56 3.91
2713 2730 0.179702 CTCCAGCCTGAGCATGCTTA 59.820 55.000 23.61 17.59 43.56 3.09
2714 2731 0.620030 TCCAGCCTGAGCATGCTTAA 59.380 50.000 23.61 12.67 43.56 1.85
2715 2732 0.737219 CCAGCCTGAGCATGCTTAAC 59.263 55.000 23.61 12.59 43.56 2.01
2716 2733 1.681166 CCAGCCTGAGCATGCTTAACT 60.681 52.381 23.61 14.73 43.56 2.24
2717 2734 2.089980 CAGCCTGAGCATGCTTAACTT 58.910 47.619 23.61 5.39 43.56 2.66
2718 2735 2.097142 CAGCCTGAGCATGCTTAACTTC 59.903 50.000 23.61 8.62 43.56 3.01
2719 2736 1.403323 GCCTGAGCATGCTTAACTTCC 59.597 52.381 23.61 7.55 39.53 3.46
2720 2737 1.667724 CCTGAGCATGCTTAACTTCCG 59.332 52.381 23.61 4.37 0.00 4.30
2721 2738 1.667724 CTGAGCATGCTTAACTTCCGG 59.332 52.381 23.61 8.23 0.00 5.14
2722 2739 1.017387 GAGCATGCTTAACTTCCGGG 58.983 55.000 23.61 0.00 0.00 5.73
2723 2740 0.328258 AGCATGCTTAACTTCCGGGT 59.672 50.000 16.30 0.00 0.00 5.28
2724 2741 1.173913 GCATGCTTAACTTCCGGGTT 58.826 50.000 11.37 0.60 0.00 4.11
2725 2742 1.132453 GCATGCTTAACTTCCGGGTTC 59.868 52.381 11.37 0.00 0.00 3.62
2726 2743 2.711542 CATGCTTAACTTCCGGGTTCT 58.288 47.619 0.00 0.00 0.00 3.01
2727 2744 3.869065 CATGCTTAACTTCCGGGTTCTA 58.131 45.455 0.00 0.00 0.00 2.10
2728 2745 4.451900 CATGCTTAACTTCCGGGTTCTAT 58.548 43.478 0.00 0.00 0.00 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1 2 1.705997 ATCATACCCTCCGGTTGGCC 61.706 60.000 0.00 0.00 40.58 5.36
3 4 1.070758 CAGATCATACCCTCCGGTTGG 59.929 57.143 0.00 5.83 40.58 3.77
4 5 1.762957 ACAGATCATACCCTCCGGTTG 59.237 52.381 0.00 0.00 40.58 3.77
5 6 2.176247 ACAGATCATACCCTCCGGTT 57.824 50.000 0.00 0.00 40.58 4.44
7 8 1.000163 CGAACAGATCATACCCTCCGG 60.000 57.143 0.00 0.00 0.00 5.14
8 9 1.681793 ACGAACAGATCATACCCTCCG 59.318 52.381 0.00 0.00 0.00 4.63
9 10 2.224066 CCACGAACAGATCATACCCTCC 60.224 54.545 0.00 0.00 0.00 4.30
10 11 2.803492 GCCACGAACAGATCATACCCTC 60.803 54.545 0.00 0.00 0.00 4.30
11 12 1.139058 GCCACGAACAGATCATACCCT 59.861 52.381 0.00 0.00 0.00 4.34
12 13 1.139058 AGCCACGAACAGATCATACCC 59.861 52.381 0.00 0.00 0.00 3.69
13 14 2.474816 GAGCCACGAACAGATCATACC 58.525 52.381 0.00 0.00 0.00 2.73
14 15 2.120232 CGAGCCACGAACAGATCATAC 58.880 52.381 0.00 0.00 45.77 2.39
15 16 1.749063 ACGAGCCACGAACAGATCATA 59.251 47.619 7.86 0.00 45.77 2.15
16 17 0.532573 ACGAGCCACGAACAGATCAT 59.467 50.000 7.86 0.00 45.77 2.45
17 18 0.317160 AACGAGCCACGAACAGATCA 59.683 50.000 7.86 0.00 45.77 2.92
18 19 1.429463 AAACGAGCCACGAACAGATC 58.571 50.000 7.86 0.00 45.77 2.75
19 20 2.029290 AGTAAACGAGCCACGAACAGAT 60.029 45.455 7.86 0.00 45.77 2.90
20 21 1.338973 AGTAAACGAGCCACGAACAGA 59.661 47.619 7.86 0.00 45.77 3.41
21 22 1.719780 GAGTAAACGAGCCACGAACAG 59.280 52.381 7.86 0.00 45.77 3.16
22 23 1.774639 GAGTAAACGAGCCACGAACA 58.225 50.000 7.86 0.00 45.77 3.18
23 24 0.706729 CGAGTAAACGAGCCACGAAC 59.293 55.000 7.86 3.62 45.77 3.95
24 25 0.311790 ACGAGTAAACGAGCCACGAA 59.688 50.000 7.86 0.00 45.77 3.85
25 26 0.311790 AACGAGTAAACGAGCCACGA 59.688 50.000 7.86 0.00 45.77 4.35
27 28 1.774639 TGAACGAGTAAACGAGCCAC 58.225 50.000 0.00 0.00 37.03 5.01
28 29 2.223876 ACTTGAACGAGTAAACGAGCCA 60.224 45.455 0.00 0.00 37.03 4.75
29 30 2.155155 CACTTGAACGAGTAAACGAGCC 59.845 50.000 0.00 0.00 37.03 4.70
30 31 2.409879 GCACTTGAACGAGTAAACGAGC 60.410 50.000 0.00 0.00 37.03 5.03
31 32 3.050619 AGCACTTGAACGAGTAAACGAG 58.949 45.455 0.00 0.00 37.03 4.18
32 33 2.792674 CAGCACTTGAACGAGTAAACGA 59.207 45.455 0.00 0.00 37.03 3.85
33 34 2.096909 CCAGCACTTGAACGAGTAAACG 60.097 50.000 0.00 0.00 39.31 3.60
34 35 2.349532 GCCAGCACTTGAACGAGTAAAC 60.350 50.000 0.00 0.00 0.00 2.01
35 36 1.871039 GCCAGCACTTGAACGAGTAAA 59.129 47.619 0.00 0.00 0.00 2.01
36 37 1.508632 GCCAGCACTTGAACGAGTAA 58.491 50.000 0.00 0.00 0.00 2.24
37 38 0.320421 GGCCAGCACTTGAACGAGTA 60.320 55.000 0.00 0.00 0.00 2.59
38 39 1.598130 GGCCAGCACTTGAACGAGT 60.598 57.895 0.00 0.00 0.00 4.18
39 40 0.957395 ATGGCCAGCACTTGAACGAG 60.957 55.000 13.05 0.00 0.00 4.18
40 41 0.323302 TATGGCCAGCACTTGAACGA 59.677 50.000 13.05 0.00 0.00 3.85
41 42 1.382522 ATATGGCCAGCACTTGAACG 58.617 50.000 13.05 0.00 0.00 3.95
42 43 5.707298 ACATATATATGGCCAGCACTTGAAC 59.293 40.000 23.44 0.00 38.00 3.18
43 44 5.879763 ACATATATATGGCCAGCACTTGAA 58.120 37.500 23.44 0.00 38.00 2.69
44 45 5.503634 ACATATATATGGCCAGCACTTGA 57.496 39.130 23.44 0.00 38.00 3.02
45 46 6.579666 AAACATATATATGGCCAGCACTTG 57.420 37.500 23.44 7.19 38.00 3.16
46 47 7.287466 TGAAAAACATATATATGGCCAGCACTT 59.713 33.333 23.44 6.44 38.00 3.16
47 48 6.777091 TGAAAAACATATATATGGCCAGCACT 59.223 34.615 23.44 0.00 38.00 4.40
48 49 6.980593 TGAAAAACATATATATGGCCAGCAC 58.019 36.000 23.44 10.89 38.00 4.40
49 50 7.779754 ATGAAAAACATATATATGGCCAGCA 57.220 32.000 23.44 16.18 37.46 4.41
50 51 9.177608 TCTATGAAAAACATATATATGGCCAGC 57.822 33.333 23.44 12.02 40.18 4.85
77 78 8.017373 GCACGTATAGTACATAGAACCGAAATA 58.983 37.037 0.00 0.00 0.00 1.40
78 79 6.860023 GCACGTATAGTACATAGAACCGAAAT 59.140 38.462 0.00 0.00 0.00 2.17
79 80 6.038603 AGCACGTATAGTACATAGAACCGAAA 59.961 38.462 0.00 0.00 0.00 3.46
80 81 5.528690 AGCACGTATAGTACATAGAACCGAA 59.471 40.000 0.00 0.00 0.00 4.30
81 82 5.059161 AGCACGTATAGTACATAGAACCGA 58.941 41.667 0.00 0.00 0.00 4.69
82 83 5.354054 AGCACGTATAGTACATAGAACCG 57.646 43.478 0.00 0.00 0.00 4.44
83 84 7.642669 TGTAAGCACGTATAGTACATAGAACC 58.357 38.462 0.00 0.00 0.00 3.62
84 85 9.114965 CATGTAAGCACGTATAGTACATAGAAC 57.885 37.037 10.99 0.00 34.46 3.01
85 86 7.806487 GCATGTAAGCACGTATAGTACATAGAA 59.194 37.037 10.99 0.00 34.46 2.10
86 87 7.174426 AGCATGTAAGCACGTATAGTACATAGA 59.826 37.037 10.99 0.00 34.46 1.98
87 88 7.306213 AGCATGTAAGCACGTATAGTACATAG 58.694 38.462 10.99 8.31 34.46 2.23
88 89 7.210718 AGCATGTAAGCACGTATAGTACATA 57.789 36.000 10.99 0.00 34.46 2.29
89 90 6.085555 AGCATGTAAGCACGTATAGTACAT 57.914 37.500 0.00 7.26 36.15 2.29
90 91 5.509716 AGCATGTAAGCACGTATAGTACA 57.490 39.130 0.00 0.00 36.85 2.90
91 92 6.581542 CCTAAGCATGTAAGCACGTATAGTAC 59.418 42.308 0.00 0.00 36.85 2.73
92 93 6.263842 ACCTAAGCATGTAAGCACGTATAGTA 59.736 38.462 0.00 0.00 36.85 1.82
93 94 5.068723 ACCTAAGCATGTAAGCACGTATAGT 59.931 40.000 0.00 0.00 36.85 2.12
94 95 5.529791 ACCTAAGCATGTAAGCACGTATAG 58.470 41.667 0.00 0.00 36.85 1.31
95 96 5.524971 ACCTAAGCATGTAAGCACGTATA 57.475 39.130 0.00 0.00 36.85 1.47
96 97 4.402056 ACCTAAGCATGTAAGCACGTAT 57.598 40.909 0.00 0.00 36.85 3.06
97 98 3.880047 ACCTAAGCATGTAAGCACGTA 57.120 42.857 0.00 0.00 36.85 3.57
98 99 2.762535 ACCTAAGCATGTAAGCACGT 57.237 45.000 0.00 0.00 36.85 4.49
99 100 3.425525 CGATACCTAAGCATGTAAGCACG 59.574 47.826 0.00 0.00 36.85 5.34
100 101 4.617959 TCGATACCTAAGCATGTAAGCAC 58.382 43.478 0.00 0.00 36.85 4.40
101 102 4.929819 TCGATACCTAAGCATGTAAGCA 57.070 40.909 0.00 0.00 36.85 3.91
102 103 9.239002 CTTATATCGATACCTAAGCATGTAAGC 57.761 37.037 7.41 0.00 0.00 3.09
103 104 9.737427 CCTTATATCGATACCTAAGCATGTAAG 57.263 37.037 7.41 7.54 0.00 2.34
104 105 9.251440 ACCTTATATCGATACCTAAGCATGTAA 57.749 33.333 7.41 0.00 0.00 2.41
105 106 8.683615 CACCTTATATCGATACCTAAGCATGTA 58.316 37.037 7.41 0.00 0.00 2.29
106 107 7.548097 CACCTTATATCGATACCTAAGCATGT 58.452 38.462 7.41 4.32 0.00 3.21
107 108 6.477033 GCACCTTATATCGATACCTAAGCATG 59.523 42.308 7.41 13.14 0.00 4.06
108 109 6.154534 TGCACCTTATATCGATACCTAAGCAT 59.845 38.462 7.41 2.00 0.00 3.79
109 110 5.479027 TGCACCTTATATCGATACCTAAGCA 59.521 40.000 7.41 11.05 0.00 3.91
110 111 5.962433 TGCACCTTATATCGATACCTAAGC 58.038 41.667 7.41 8.67 0.00 3.09
111 112 9.900710 GATATGCACCTTATATCGATACCTAAG 57.099 37.037 7.41 12.16 30.45 2.18
121 122 5.749109 GCAGGTACGATATGCACCTTATATC 59.251 44.000 0.00 0.00 40.77 1.63
122 123 5.395324 GGCAGGTACGATATGCACCTTATAT 60.395 44.000 11.48 0.00 40.77 0.86
123 124 4.081862 GGCAGGTACGATATGCACCTTATA 60.082 45.833 11.48 0.00 40.77 0.98
124 125 3.306780 GGCAGGTACGATATGCACCTTAT 60.307 47.826 11.48 0.00 40.77 1.73
125 126 2.036733 GGCAGGTACGATATGCACCTTA 59.963 50.000 11.48 0.00 40.77 2.69
126 127 1.202651 GGCAGGTACGATATGCACCTT 60.203 52.381 11.48 0.00 40.77 3.50
127 128 0.393077 GGCAGGTACGATATGCACCT 59.607 55.000 11.48 0.00 43.56 4.00
128 129 0.105964 TGGCAGGTACGATATGCACC 59.894 55.000 11.48 0.00 41.78 5.01
129 130 1.502231 CTGGCAGGTACGATATGCAC 58.498 55.000 6.61 4.09 41.78 4.57
130 131 0.392706 CCTGGCAGGTACGATATGCA 59.607 55.000 25.74 0.00 41.78 3.96
131 132 3.217242 CCTGGCAGGTACGATATGC 57.783 57.895 25.74 3.24 39.25 3.14
141 142 2.817844 GGTAAACAGTAAACCTGGCAGG 59.182 50.000 31.62 31.62 46.06 4.85
142 143 2.817844 GGGTAAACAGTAAACCTGGCAG 59.182 50.000 7.75 7.75 46.06 4.85
143 144 2.811136 CGGGTAAACAGTAAACCTGGCA 60.811 50.000 0.00 0.00 46.06 4.92
144 145 1.808343 CGGGTAAACAGTAAACCTGGC 59.192 52.381 0.00 0.00 46.06 4.85
147 148 3.242011 TCTCCGGGTAAACAGTAAACCT 58.758 45.455 0.00 0.00 33.59 3.50
148 149 3.683365 TCTCCGGGTAAACAGTAAACC 57.317 47.619 0.00 0.00 0.00 3.27
149 150 6.401394 ACTAATCTCCGGGTAAACAGTAAAC 58.599 40.000 0.00 0.00 0.00 2.01
150 151 6.438425 AGACTAATCTCCGGGTAAACAGTAAA 59.562 38.462 0.00 0.00 0.00 2.01
151 152 5.954150 AGACTAATCTCCGGGTAAACAGTAA 59.046 40.000 0.00 0.00 0.00 2.24
152 153 5.513233 AGACTAATCTCCGGGTAAACAGTA 58.487 41.667 0.00 0.00 0.00 2.74
153 154 4.351127 AGACTAATCTCCGGGTAAACAGT 58.649 43.478 0.00 0.00 0.00 3.55
154 155 6.461110 TTAGACTAATCTCCGGGTAAACAG 57.539 41.667 0.00 0.00 36.29 3.16
155 156 6.238842 CGATTAGACTAATCTCCGGGTAAACA 60.239 42.308 25.56 0.00 41.80 2.83
156 157 6.016777 TCGATTAGACTAATCTCCGGGTAAAC 60.017 42.308 25.56 3.72 41.80 2.01
157 158 6.064060 TCGATTAGACTAATCTCCGGGTAAA 58.936 40.000 25.56 2.67 41.80 2.01
158 159 5.624159 TCGATTAGACTAATCTCCGGGTAA 58.376 41.667 25.56 2.96 41.80 2.85
159 160 5.233083 TCGATTAGACTAATCTCCGGGTA 57.767 43.478 25.56 6.53 41.80 3.69
160 161 4.096190 TCGATTAGACTAATCTCCGGGT 57.904 45.455 25.56 0.00 41.80 5.28
161 162 5.449107 TTTCGATTAGACTAATCTCCGGG 57.551 43.478 25.56 14.12 41.80 5.73
162 163 5.921408 CCTTTTCGATTAGACTAATCTCCGG 59.079 44.000 25.56 16.80 41.80 5.14
163 164 6.418226 CACCTTTTCGATTAGACTAATCTCCG 59.582 42.308 25.56 16.95 41.80 4.63
164 165 6.201234 GCACCTTTTCGATTAGACTAATCTCC 59.799 42.308 25.56 7.68 41.80 3.71
165 166 6.981559 AGCACCTTTTCGATTAGACTAATCTC 59.018 38.462 25.56 9.07 41.80 2.75
166 167 6.879400 AGCACCTTTTCGATTAGACTAATCT 58.121 36.000 25.56 8.70 41.80 2.40
167 168 8.644318 TTAGCACCTTTTCGATTAGACTAATC 57.356 34.615 20.87 20.87 40.83 1.75
171 172 9.614792 AAATATTAGCACCTTTTCGATTAGACT 57.385 29.630 0.00 0.00 0.00 3.24
172 173 9.865484 GAAATATTAGCACCTTTTCGATTAGAC 57.135 33.333 0.00 0.00 0.00 2.59
173 174 9.052759 GGAAATATTAGCACCTTTTCGATTAGA 57.947 33.333 0.00 0.00 0.00 2.10
174 175 8.836413 TGGAAATATTAGCACCTTTTCGATTAG 58.164 33.333 0.00 0.00 0.00 1.73
175 176 8.740123 TGGAAATATTAGCACCTTTTCGATTA 57.260 30.769 0.00 0.00 0.00 1.75
176 177 7.639113 TGGAAATATTAGCACCTTTTCGATT 57.361 32.000 0.00 0.00 0.00 3.34
177 178 7.122055 TGTTGGAAATATTAGCACCTTTTCGAT 59.878 33.333 0.00 0.00 0.00 3.59
178 179 6.431543 TGTTGGAAATATTAGCACCTTTTCGA 59.568 34.615 0.00 0.00 0.00 3.71
179 180 6.616947 TGTTGGAAATATTAGCACCTTTTCG 58.383 36.000 0.00 0.00 0.00 3.46
180 181 7.870445 TGTTGTTGGAAATATTAGCACCTTTTC 59.130 33.333 0.00 0.00 0.00 2.29
181 182 7.731054 TGTTGTTGGAAATATTAGCACCTTTT 58.269 30.769 0.00 0.00 0.00 2.27
182 183 7.015195 ACTGTTGTTGGAAATATTAGCACCTTT 59.985 33.333 0.00 0.00 0.00 3.11
183 184 6.493458 ACTGTTGTTGGAAATATTAGCACCTT 59.507 34.615 0.00 0.00 0.00 3.50
184 185 6.010219 ACTGTTGTTGGAAATATTAGCACCT 58.990 36.000 0.00 0.00 0.00 4.00
185 186 6.267496 ACTGTTGTTGGAAATATTAGCACC 57.733 37.500 0.00 0.00 0.00 5.01
200 201 1.925847 CGTTTGCATGCAACTGTTGTT 59.074 42.857 31.99 7.26 35.46 2.83
201 202 1.133982 TCGTTTGCATGCAACTGTTGT 59.866 42.857 31.99 0.11 35.46 3.32
202 203 1.837648 TCGTTTGCATGCAACTGTTG 58.162 45.000 31.99 18.78 35.46 3.33
203 204 2.192624 GTTCGTTTGCATGCAACTGTT 58.807 42.857 31.99 0.00 35.46 3.16
204 205 1.535860 GGTTCGTTTGCATGCAACTGT 60.536 47.619 31.99 0.00 35.46 3.55
205 206 1.130955 GGTTCGTTTGCATGCAACTG 58.869 50.000 31.99 25.16 35.46 3.16
206 207 0.743688 TGGTTCGTTTGCATGCAACT 59.256 45.000 31.99 0.00 35.46 3.16
207 208 1.130955 CTGGTTCGTTTGCATGCAAC 58.869 50.000 31.99 23.55 35.46 4.17
208 209 0.597118 GCTGGTTCGTTTGCATGCAA 60.597 50.000 28.80 28.80 0.00 4.08
209 210 1.007502 GCTGGTTCGTTTGCATGCA 60.008 52.632 18.46 18.46 0.00 3.96
210 211 1.734117 GGCTGGTTCGTTTGCATGC 60.734 57.895 11.82 11.82 0.00 4.06
211 212 0.387622 CAGGCTGGTTCGTTTGCATG 60.388 55.000 6.61 0.00 0.00 4.06
212 213 0.537143 TCAGGCTGGTTCGTTTGCAT 60.537 50.000 15.73 0.00 0.00 3.96
213 214 1.153066 TCAGGCTGGTTCGTTTGCA 60.153 52.632 15.73 0.00 0.00 4.08
214 215 1.576421 CTCAGGCTGGTTCGTTTGC 59.424 57.895 15.73 0.00 0.00 3.68
215 216 1.165907 TGCTCAGGCTGGTTCGTTTG 61.166 55.000 15.73 0.00 39.59 2.93
216 217 0.250901 ATGCTCAGGCTGGTTCGTTT 60.251 50.000 15.73 0.00 39.59 3.60
217 218 0.957395 CATGCTCAGGCTGGTTCGTT 60.957 55.000 15.73 0.00 39.59 3.85
218 219 1.376424 CATGCTCAGGCTGGTTCGT 60.376 57.895 15.73 2.69 39.59 3.85
219 220 0.108186 TACATGCTCAGGCTGGTTCG 60.108 55.000 15.73 2.60 39.59 3.95
220 221 2.338577 ATACATGCTCAGGCTGGTTC 57.661 50.000 15.73 4.70 39.59 3.62
221 222 3.748083 CATATACATGCTCAGGCTGGTT 58.252 45.455 15.73 0.00 39.59 3.67
222 223 3.413846 CATATACATGCTCAGGCTGGT 57.586 47.619 15.73 6.62 39.59 4.00
235 236 9.739276 CCTTAATTTTAGGATCAGGCATATACA 57.261 33.333 0.00 0.00 34.56 2.29
236 237 9.178758 CCCTTAATTTTAGGATCAGGCATATAC 57.821 37.037 3.00 0.00 34.56 1.47
237 238 9.122954 TCCCTTAATTTTAGGATCAGGCATATA 57.877 33.333 3.00 0.00 34.56 0.86
238 239 8.000171 TCCCTTAATTTTAGGATCAGGCATAT 58.000 34.615 3.00 0.00 34.56 1.78
239 240 7.401060 TCCCTTAATTTTAGGATCAGGCATA 57.599 36.000 3.00 0.00 34.56 3.14
240 241 6.279813 TCCCTTAATTTTAGGATCAGGCAT 57.720 37.500 3.00 0.00 34.56 4.40
241 242 5.725551 TCCCTTAATTTTAGGATCAGGCA 57.274 39.130 3.00 0.00 34.56 4.75
247 248 8.383175 TGCTATTCGATCCCTTAATTTTAGGAT 58.617 33.333 3.00 5.45 41.86 3.24
248 249 7.660208 GTGCTATTCGATCCCTTAATTTTAGGA 59.340 37.037 3.00 1.01 34.56 2.94
249 250 7.444183 TGTGCTATTCGATCCCTTAATTTTAGG 59.556 37.037 0.00 0.00 0.00 2.69
250 251 8.378172 TGTGCTATTCGATCCCTTAATTTTAG 57.622 34.615 0.00 0.00 0.00 1.85
251 252 8.918202 ATGTGCTATTCGATCCCTTAATTTTA 57.082 30.769 0.00 0.00 0.00 1.52
252 253 7.823745 ATGTGCTATTCGATCCCTTAATTTT 57.176 32.000 0.00 0.00 0.00 1.82
253 254 8.375506 TCTATGTGCTATTCGATCCCTTAATTT 58.624 33.333 0.00 0.00 0.00 1.82
254 255 7.819900 GTCTATGTGCTATTCGATCCCTTAATT 59.180 37.037 0.00 0.00 0.00 1.40
255 256 7.179338 AGTCTATGTGCTATTCGATCCCTTAAT 59.821 37.037 0.00 0.00 0.00 1.40
256 257 6.493802 AGTCTATGTGCTATTCGATCCCTTAA 59.506 38.462 0.00 0.00 0.00 1.85
257 258 6.010850 AGTCTATGTGCTATTCGATCCCTTA 58.989 40.000 0.00 0.00 0.00 2.69
258 259 4.835615 AGTCTATGTGCTATTCGATCCCTT 59.164 41.667 0.00 0.00 0.00 3.95
259 260 4.411927 AGTCTATGTGCTATTCGATCCCT 58.588 43.478 0.00 0.00 0.00 4.20
260 261 4.792521 AGTCTATGTGCTATTCGATCCC 57.207 45.455 0.00 0.00 0.00 3.85
261 262 7.767261 AGATAAGTCTATGTGCTATTCGATCC 58.233 38.462 0.00 0.00 31.36 3.36
268 269 9.451002 ACGTGTATAGATAAGTCTATGTGCTAT 57.549 33.333 7.93 0.00 45.15 2.97
269 270 8.843885 ACGTGTATAGATAAGTCTATGTGCTA 57.156 34.615 7.93 0.00 45.15 3.49
270 271 7.747155 ACGTGTATAGATAAGTCTATGTGCT 57.253 36.000 7.93 0.00 45.15 4.40
271 272 8.291032 AGAACGTGTATAGATAAGTCTATGTGC 58.709 37.037 7.93 0.00 45.15 4.57
272 273 9.814507 GAGAACGTGTATAGATAAGTCTATGTG 57.185 37.037 7.93 0.00 45.15 3.21
273 274 9.001542 GGAGAACGTGTATAGATAAGTCTATGT 57.998 37.037 7.93 0.00 45.15 2.29
274 275 9.000486 TGGAGAACGTGTATAGATAAGTCTATG 58.000 37.037 7.93 0.00 45.15 2.23
275 276 9.001542 GTGGAGAACGTGTATAGATAAGTCTAT 57.998 37.037 0.00 3.71 46.71 1.98
276 277 7.443575 GGTGGAGAACGTGTATAGATAAGTCTA 59.556 40.741 0.00 0.00 41.03 2.59
277 278 6.262720 GGTGGAGAACGTGTATAGATAAGTCT 59.737 42.308 0.00 0.00 38.52 3.24
278 279 6.039047 TGGTGGAGAACGTGTATAGATAAGTC 59.961 42.308 0.00 0.00 0.00 3.01
279 280 5.889853 TGGTGGAGAACGTGTATAGATAAGT 59.110 40.000 0.00 0.00 0.00 2.24
280 281 6.387041 TGGTGGAGAACGTGTATAGATAAG 57.613 41.667 0.00 0.00 0.00 1.73
281 282 6.737622 GCATGGTGGAGAACGTGTATAGATAA 60.738 42.308 0.00 0.00 0.00 1.75
282 283 5.278808 GCATGGTGGAGAACGTGTATAGATA 60.279 44.000 0.00 0.00 0.00 1.98
283 284 4.501571 GCATGGTGGAGAACGTGTATAGAT 60.502 45.833 0.00 0.00 0.00 1.98
284 285 3.181479 GCATGGTGGAGAACGTGTATAGA 60.181 47.826 0.00 0.00 0.00 1.98
285 286 3.123804 GCATGGTGGAGAACGTGTATAG 58.876 50.000 0.00 0.00 0.00 1.31
286 287 2.498078 TGCATGGTGGAGAACGTGTATA 59.502 45.455 0.00 0.00 0.00 1.47
287 288 1.277842 TGCATGGTGGAGAACGTGTAT 59.722 47.619 0.00 0.00 0.00 2.29
288 289 0.682292 TGCATGGTGGAGAACGTGTA 59.318 50.000 0.00 0.00 0.00 2.90
289 290 0.036732 ATGCATGGTGGAGAACGTGT 59.963 50.000 0.00 0.00 0.00 4.49
290 291 0.448990 CATGCATGGTGGAGAACGTG 59.551 55.000 19.40 0.00 0.00 4.49
291 292 0.036732 ACATGCATGGTGGAGAACGT 59.963 50.000 29.41 2.39 0.00 3.99
292 293 1.935873 CTACATGCATGGTGGAGAACG 59.064 52.381 29.41 1.63 28.44 3.95
293 294 2.991250 ACTACATGCATGGTGGAGAAC 58.009 47.619 29.41 0.00 31.77 3.01
294 295 5.365314 TGTATACTACATGCATGGTGGAGAA 59.635 40.000 29.41 9.33 32.89 2.87
295 296 4.898861 TGTATACTACATGCATGGTGGAGA 59.101 41.667 29.41 13.36 32.89 3.71
296 297 4.991056 GTGTATACTACATGCATGGTGGAG 59.009 45.833 29.41 21.08 41.34 3.86
297 298 4.407296 TGTGTATACTACATGCATGGTGGA 59.593 41.667 29.41 18.46 41.34 4.02
298 299 4.702831 TGTGTATACTACATGCATGGTGG 58.297 43.478 29.41 19.80 41.34 4.61
299 300 6.232139 CATGTGTATACTACATGCATGGTG 57.768 41.667 29.41 22.18 45.97 4.17
307 308 5.069648 AGCTGCAGACATGTGTATACTACAT 59.930 40.000 20.43 12.40 41.34 2.29
308 309 4.402474 AGCTGCAGACATGTGTATACTACA 59.598 41.667 20.43 7.42 36.08 2.74
309 310 4.938080 AGCTGCAGACATGTGTATACTAC 58.062 43.478 20.43 1.85 0.00 2.73
310 311 5.127031 TGAAGCTGCAGACATGTGTATACTA 59.873 40.000 20.43 0.00 0.00 1.82
311 312 4.081476 TGAAGCTGCAGACATGTGTATACT 60.081 41.667 20.43 0.00 0.00 2.12
312 313 4.183865 TGAAGCTGCAGACATGTGTATAC 58.816 43.478 20.43 0.00 0.00 1.47
313 314 4.470334 TGAAGCTGCAGACATGTGTATA 57.530 40.909 20.43 0.00 0.00 1.47
314 315 3.339253 TGAAGCTGCAGACATGTGTAT 57.661 42.857 20.43 0.00 0.00 2.29
315 316 2.837532 TGAAGCTGCAGACATGTGTA 57.162 45.000 20.43 0.00 0.00 2.90
316 317 1.971481 TTGAAGCTGCAGACATGTGT 58.029 45.000 20.43 0.00 0.00 3.72
317 318 3.937079 TCTATTGAAGCTGCAGACATGTG 59.063 43.478 20.43 7.00 0.00 3.21
318 319 4.212143 TCTATTGAAGCTGCAGACATGT 57.788 40.909 20.43 0.00 0.00 3.21
319 320 5.158101 CTTCTATTGAAGCTGCAGACATG 57.842 43.478 20.43 7.61 42.50 3.21
331 332 8.372459 ACAGGTACATACACAACTTCTATTGAA 58.628 33.333 0.00 0.00 33.57 2.69
332 333 7.817478 CACAGGTACATACACAACTTCTATTGA 59.183 37.037 0.00 0.00 33.57 2.57
333 334 7.817478 TCACAGGTACATACACAACTTCTATTG 59.183 37.037 0.00 0.00 35.59 1.90
334 335 7.903145 TCACAGGTACATACACAACTTCTATT 58.097 34.615 0.00 0.00 0.00 1.73
335 336 7.476540 TCACAGGTACATACACAACTTCTAT 57.523 36.000 0.00 0.00 0.00 1.98
336 337 6.904463 TCACAGGTACATACACAACTTCTA 57.096 37.500 0.00 0.00 0.00 2.10
337 338 5.801531 TCACAGGTACATACACAACTTCT 57.198 39.130 0.00 0.00 0.00 2.85
338 339 6.854496 TTTCACAGGTACATACACAACTTC 57.146 37.500 0.00 0.00 0.00 3.01
339 340 7.284489 ACAATTTCACAGGTACATACACAACTT 59.716 33.333 0.00 0.00 0.00 2.66
340 341 6.770785 ACAATTTCACAGGTACATACACAACT 59.229 34.615 0.00 0.00 0.00 3.16
341 342 6.966021 ACAATTTCACAGGTACATACACAAC 58.034 36.000 0.00 0.00 0.00 3.32
342 343 6.768381 TGACAATTTCACAGGTACATACACAA 59.232 34.615 0.00 0.00 0.00 3.33
343 344 6.292150 TGACAATTTCACAGGTACATACACA 58.708 36.000 0.00 0.00 0.00 3.72
344 345 6.795098 TGACAATTTCACAGGTACATACAC 57.205 37.500 0.00 0.00 0.00 2.90
345 346 6.995686 ACTTGACAATTTCACAGGTACATACA 59.004 34.615 0.00 0.00 32.26 2.29
346 347 7.435068 ACTTGACAATTTCACAGGTACATAC 57.565 36.000 0.00 0.00 32.26 2.39
347 348 8.349245 CAAACTTGACAATTTCACAGGTACATA 58.651 33.333 0.00 0.00 32.26 2.29
348 349 6.959639 AACTTGACAATTTCACAGGTACAT 57.040 33.333 0.00 0.00 32.26 2.29
349 350 6.151985 ACAAACTTGACAATTTCACAGGTACA 59.848 34.615 0.00 0.00 32.26 2.90
350 351 6.472163 CACAAACTTGACAATTTCACAGGTAC 59.528 38.462 0.00 0.00 32.26 3.34
351 352 6.405286 CCACAAACTTGACAATTTCACAGGTA 60.405 38.462 0.00 0.00 32.26 3.08
352 353 5.410067 CACAAACTTGACAATTTCACAGGT 58.590 37.500 0.00 0.00 32.26 4.00
353 354 4.805192 CCACAAACTTGACAATTTCACAGG 59.195 41.667 0.00 0.00 32.26 4.00
354 355 5.649557 TCCACAAACTTGACAATTTCACAG 58.350 37.500 0.00 0.00 32.26 3.66
355 356 5.651387 TCCACAAACTTGACAATTTCACA 57.349 34.783 0.00 0.00 32.26 3.58
356 357 6.534793 ACAATCCACAAACTTGACAATTTCAC 59.465 34.615 0.00 0.00 32.26 3.18
357 358 6.638610 ACAATCCACAAACTTGACAATTTCA 58.361 32.000 0.00 0.00 0.00 2.69
358 359 8.702438 CATACAATCCACAAACTTGACAATTTC 58.298 33.333 0.00 0.00 0.00 2.17
359 360 7.656948 CCATACAATCCACAAACTTGACAATTT 59.343 33.333 0.00 0.00 0.00 1.82
360 361 7.015098 TCCATACAATCCACAAACTTGACAATT 59.985 33.333 0.00 0.00 0.00 2.32
361 362 6.493115 TCCATACAATCCACAAACTTGACAAT 59.507 34.615 0.00 0.00 0.00 2.71
362 363 5.830457 TCCATACAATCCACAAACTTGACAA 59.170 36.000 0.00 0.00 0.00 3.18
363 364 5.380900 TCCATACAATCCACAAACTTGACA 58.619 37.500 0.00 0.00 0.00 3.58
364 365 5.473504 ACTCCATACAATCCACAAACTTGAC 59.526 40.000 0.00 0.00 0.00 3.18
365 366 5.630121 ACTCCATACAATCCACAAACTTGA 58.370 37.500 0.00 0.00 0.00 3.02
366 367 5.964958 ACTCCATACAATCCACAAACTTG 57.035 39.130 0.00 0.00 0.00 3.16
367 368 9.747898 TTAATACTCCATACAATCCACAAACTT 57.252 29.630 0.00 0.00 0.00 2.66
368 369 9.920946 ATTAATACTCCATACAATCCACAAACT 57.079 29.630 0.00 0.00 0.00 2.66
399 400 9.062524 GCCAAATATGTGGTATATACTTGTTCA 57.937 33.333 13.70 0.00 41.12 3.18
400 401 8.227791 CGCCAAATATGTGGTATATACTTGTTC 58.772 37.037 13.70 0.00 41.12 3.18
401 402 7.934665 TCGCCAAATATGTGGTATATACTTGTT 59.065 33.333 13.70 0.00 41.12 2.83
402 403 7.446769 TCGCCAAATATGTGGTATATACTTGT 58.553 34.615 13.70 0.47 41.12 3.16
403 404 7.899178 TCGCCAAATATGTGGTATATACTTG 57.101 36.000 13.70 7.19 41.12 3.16
404 405 8.318412 TCATCGCCAAATATGTGGTATATACTT 58.682 33.333 13.70 0.00 41.12 2.24
405 406 7.847096 TCATCGCCAAATATGTGGTATATACT 58.153 34.615 13.70 0.00 41.12 2.12
406 407 7.764443 ACTCATCGCCAAATATGTGGTATATAC 59.236 37.037 13.70 4.14 41.12 1.47
407 408 7.847096 ACTCATCGCCAAATATGTGGTATATA 58.153 34.615 13.70 0.00 41.12 0.86
408 409 6.711277 ACTCATCGCCAAATATGTGGTATAT 58.289 36.000 13.70 2.37 41.12 0.86
409 410 6.109156 ACTCATCGCCAAATATGTGGTATA 57.891 37.500 13.70 0.00 41.12 1.47
410 411 4.973168 ACTCATCGCCAAATATGTGGTAT 58.027 39.130 13.70 5.10 41.12 2.73
411 412 4.415881 ACTCATCGCCAAATATGTGGTA 57.584 40.909 13.70 2.86 41.12 3.25
412 413 3.281727 ACTCATCGCCAAATATGTGGT 57.718 42.857 13.70 0.00 41.12 4.16
413 414 4.393062 GGATACTCATCGCCAAATATGTGG 59.607 45.833 7.66 7.66 42.05 4.17
414 415 5.536554 GGATACTCATCGCCAAATATGTG 57.463 43.478 0.00 0.00 31.33 3.21
450 451 2.686405 GGGACAACTTGGTCGACTTTTT 59.314 45.455 16.46 1.07 38.70 1.94
451 452 2.294979 GGGACAACTTGGTCGACTTTT 58.705 47.619 16.46 0.71 38.70 2.27
452 453 1.476291 GGGGACAACTTGGTCGACTTT 60.476 52.381 16.46 1.08 38.70 2.66
453 454 0.108019 GGGGACAACTTGGTCGACTT 59.892 55.000 16.46 0.00 38.70 3.01
454 455 0.763223 AGGGGACAACTTGGTCGACT 60.763 55.000 16.46 0.00 38.70 4.18
455 456 0.971386 TAGGGGACAACTTGGTCGAC 59.029 55.000 7.13 7.13 38.70 4.20
456 457 1.719529 TTAGGGGACAACTTGGTCGA 58.280 50.000 0.00 0.00 38.70 4.20
457 458 2.554370 TTTAGGGGACAACTTGGTCG 57.446 50.000 0.00 0.00 38.70 4.79
477 478 5.180271 TCTACACAACTTGGTCGAGTTTTT 58.820 37.500 1.08 0.00 37.76 1.94
478 479 4.761975 TCTACACAACTTGGTCGAGTTTT 58.238 39.130 1.08 0.00 37.76 2.43
479 480 4.098960 TCTCTACACAACTTGGTCGAGTTT 59.901 41.667 1.08 0.00 37.76 2.66
480 481 3.635373 TCTCTACACAACTTGGTCGAGTT 59.365 43.478 0.00 0.00 40.37 3.01
481 482 3.220110 TCTCTACACAACTTGGTCGAGT 58.780 45.455 0.00 0.00 0.00 4.18
482 483 3.917329 TCTCTACACAACTTGGTCGAG 57.083 47.619 0.00 0.95 0.00 4.04
483 484 4.556233 CAATCTCTACACAACTTGGTCGA 58.444 43.478 0.00 0.00 0.00 4.20
484 485 3.123621 GCAATCTCTACACAACTTGGTCG 59.876 47.826 0.00 0.00 0.00 4.79
485 486 3.123621 CGCAATCTCTACACAACTTGGTC 59.876 47.826 0.00 0.00 0.00 4.02
486 487 3.067106 CGCAATCTCTACACAACTTGGT 58.933 45.455 0.00 0.00 0.00 3.67
487 488 3.123621 GTCGCAATCTCTACACAACTTGG 59.876 47.826 0.00 0.00 0.00 3.61
488 489 3.990469 AGTCGCAATCTCTACACAACTTG 59.010 43.478 0.00 0.00 0.00 3.16
489 490 4.258702 AGTCGCAATCTCTACACAACTT 57.741 40.909 0.00 0.00 0.00 2.66
490 491 3.944055 AGTCGCAATCTCTACACAACT 57.056 42.857 0.00 0.00 0.00 3.16
491 492 6.462073 TTTTAGTCGCAATCTCTACACAAC 57.538 37.500 0.00 0.00 0.00 3.32
492 493 6.926826 TCTTTTTAGTCGCAATCTCTACACAA 59.073 34.615 0.00 0.00 0.00 3.33
493 494 6.452242 TCTTTTTAGTCGCAATCTCTACACA 58.548 36.000 0.00 0.00 0.00 3.72
494 495 6.946229 TCTTTTTAGTCGCAATCTCTACAC 57.054 37.500 0.00 0.00 0.00 2.90
495 496 7.656137 ACTTTCTTTTTAGTCGCAATCTCTACA 59.344 33.333 0.00 0.00 0.00 2.74
496 497 8.019769 ACTTTCTTTTTAGTCGCAATCTCTAC 57.980 34.615 0.00 0.00 0.00 2.59
497 498 8.495949 CAACTTTCTTTTTAGTCGCAATCTCTA 58.504 33.333 0.00 0.00 0.00 2.43
498 499 7.012421 ACAACTTTCTTTTTAGTCGCAATCTCT 59.988 33.333 0.00 0.00 0.00 3.10
499 500 7.112148 CACAACTTTCTTTTTAGTCGCAATCTC 59.888 37.037 0.00 0.00 0.00 2.75
500 501 6.912591 CACAACTTTCTTTTTAGTCGCAATCT 59.087 34.615 0.00 0.00 0.00 2.40
501 502 6.691388 ACACAACTTTCTTTTTAGTCGCAATC 59.309 34.615 0.00 0.00 0.00 2.67
502 503 6.560711 ACACAACTTTCTTTTTAGTCGCAAT 58.439 32.000 0.00 0.00 0.00 3.56
503 504 5.945155 ACACAACTTTCTTTTTAGTCGCAA 58.055 33.333 0.00 0.00 0.00 4.85
504 505 5.554822 ACACAACTTTCTTTTTAGTCGCA 57.445 34.783 0.00 0.00 0.00 5.10
505 506 6.134061 CCTACACAACTTTCTTTTTAGTCGC 58.866 40.000 0.00 0.00 0.00 5.19
506 507 6.134061 GCCTACACAACTTTCTTTTTAGTCG 58.866 40.000 0.00 0.00 0.00 4.18
507 508 6.018507 TCGCCTACACAACTTTCTTTTTAGTC 60.019 38.462 0.00 0.00 0.00 2.59
508 509 5.818857 TCGCCTACACAACTTTCTTTTTAGT 59.181 36.000 0.00 0.00 0.00 2.24
509 510 6.295039 TCGCCTACACAACTTTCTTTTTAG 57.705 37.500 0.00 0.00 0.00 1.85
510 511 6.680874 TTCGCCTACACAACTTTCTTTTTA 57.319 33.333 0.00 0.00 0.00 1.52
511 512 5.570234 TTCGCCTACACAACTTTCTTTTT 57.430 34.783 0.00 0.00 0.00 1.94
512 513 5.298276 TGATTCGCCTACACAACTTTCTTTT 59.702 36.000 0.00 0.00 0.00 2.27
513 514 4.819630 TGATTCGCCTACACAACTTTCTTT 59.180 37.500 0.00 0.00 0.00 2.52
514 515 4.385825 TGATTCGCCTACACAACTTTCTT 58.614 39.130 0.00 0.00 0.00 2.52
515 516 4.002906 TGATTCGCCTACACAACTTTCT 57.997 40.909 0.00 0.00 0.00 2.52
516 517 4.024387 TGTTGATTCGCCTACACAACTTTC 60.024 41.667 0.00 0.00 40.59 2.62
517 518 3.880490 TGTTGATTCGCCTACACAACTTT 59.120 39.130 0.00 0.00 40.59 2.66
518 519 3.472652 TGTTGATTCGCCTACACAACTT 58.527 40.909 0.00 0.00 40.59 2.66
519 520 3.120321 TGTTGATTCGCCTACACAACT 57.880 42.857 0.00 0.00 40.59 3.16
520 521 3.188460 ACATGTTGATTCGCCTACACAAC 59.812 43.478 0.00 0.00 40.44 3.32
521 522 3.188254 CACATGTTGATTCGCCTACACAA 59.812 43.478 0.00 0.00 0.00 3.33
522 523 2.741517 CACATGTTGATTCGCCTACACA 59.258 45.455 0.00 0.00 0.00 3.72
523 524 2.095853 CCACATGTTGATTCGCCTACAC 59.904 50.000 0.00 0.00 0.00 2.90
524 525 2.290008 ACCACATGTTGATTCGCCTACA 60.290 45.455 3.55 0.00 0.00 2.74
525 526 2.356135 ACCACATGTTGATTCGCCTAC 58.644 47.619 3.55 0.00 0.00 3.18
526 527 2.779755 ACCACATGTTGATTCGCCTA 57.220 45.000 3.55 0.00 0.00 3.93
527 528 1.909700 AACCACATGTTGATTCGCCT 58.090 45.000 3.55 0.00 35.31 5.52
536 537 3.888930 CCTAACCAACTCAACCACATGTT 59.111 43.478 0.00 0.00 37.80 2.71
537 538 3.117663 ACCTAACCAACTCAACCACATGT 60.118 43.478 0.00 0.00 0.00 3.21
538 539 3.253188 CACCTAACCAACTCAACCACATG 59.747 47.826 0.00 0.00 0.00 3.21
539 540 3.486383 CACCTAACCAACTCAACCACAT 58.514 45.455 0.00 0.00 0.00 3.21
540 541 2.422235 CCACCTAACCAACTCAACCACA 60.422 50.000 0.00 0.00 0.00 4.17
541 542 2.158726 TCCACCTAACCAACTCAACCAC 60.159 50.000 0.00 0.00 0.00 4.16
542 543 2.128535 TCCACCTAACCAACTCAACCA 58.871 47.619 0.00 0.00 0.00 3.67
543 544 2.158726 TGTCCACCTAACCAACTCAACC 60.159 50.000 0.00 0.00 0.00 3.77
544 545 3.139077 CTGTCCACCTAACCAACTCAAC 58.861 50.000 0.00 0.00 0.00 3.18
545 546 2.775384 ACTGTCCACCTAACCAACTCAA 59.225 45.455 0.00 0.00 0.00 3.02
546 547 2.104111 CACTGTCCACCTAACCAACTCA 59.896 50.000 0.00 0.00 0.00 3.41
547 548 2.550208 CCACTGTCCACCTAACCAACTC 60.550 54.545 0.00 0.00 0.00 3.01
548 549 1.420138 CCACTGTCCACCTAACCAACT 59.580 52.381 0.00 0.00 0.00 3.16
549 550 1.142262 ACCACTGTCCACCTAACCAAC 59.858 52.381 0.00 0.00 0.00 3.77
550 551 1.513858 ACCACTGTCCACCTAACCAA 58.486 50.000 0.00 0.00 0.00 3.67
551 552 2.402182 TACCACTGTCCACCTAACCA 57.598 50.000 0.00 0.00 0.00 3.67
552 553 3.105283 AGATACCACTGTCCACCTAACC 58.895 50.000 0.00 0.00 0.00 2.85
553 554 3.132467 GGAGATACCACTGTCCACCTAAC 59.868 52.174 0.00 0.00 38.79 2.34
554 555 3.245839 TGGAGATACCACTGTCCACCTAA 60.246 47.826 0.00 0.00 44.64 2.69
555 556 2.313643 TGGAGATACCACTGTCCACCTA 59.686 50.000 0.00 0.00 44.64 3.08
556 557 1.078823 TGGAGATACCACTGTCCACCT 59.921 52.381 0.00 0.00 44.64 4.00
557 558 1.568504 TGGAGATACCACTGTCCACC 58.431 55.000 0.00 0.00 44.64 4.61
567 568 0.546598 CCTGGTGGGTTGGAGATACC 59.453 60.000 0.00 0.00 39.54 2.73
579 580 1.549203 CAGGATTTGAACCCTGGTGG 58.451 55.000 0.00 0.00 44.68 4.61
584 585 0.779997 AGCACCAGGATTTGAACCCT 59.220 50.000 0.00 0.00 0.00 4.34
585 586 1.177401 GAGCACCAGGATTTGAACCC 58.823 55.000 0.00 0.00 0.00 4.11
586 587 0.804989 CGAGCACCAGGATTTGAACC 59.195 55.000 0.00 0.00 0.00 3.62
587 588 0.169009 GCGAGCACCAGGATTTGAAC 59.831 55.000 0.00 0.00 0.00 3.18
588 589 0.250684 TGCGAGCACCAGGATTTGAA 60.251 50.000 0.00 0.00 0.00 2.69
589 590 0.035152 ATGCGAGCACCAGGATTTGA 60.035 50.000 0.00 0.00 0.00 2.69
590 591 0.813184 AATGCGAGCACCAGGATTTG 59.187 50.000 0.00 0.00 0.00 2.32
591 592 2.418368 TAATGCGAGCACCAGGATTT 57.582 45.000 0.00 0.00 31.11 2.17
592 593 2.645838 ATAATGCGAGCACCAGGATT 57.354 45.000 0.00 0.00 33.17 3.01
593 594 2.498167 GAATAATGCGAGCACCAGGAT 58.502 47.619 0.00 0.00 0.00 3.24
594 595 1.475034 GGAATAATGCGAGCACCAGGA 60.475 52.381 0.00 0.00 0.00 3.86
595 596 0.947244 GGAATAATGCGAGCACCAGG 59.053 55.000 0.00 0.00 0.00 4.45
596 597 1.600957 CAGGAATAATGCGAGCACCAG 59.399 52.381 0.00 0.00 0.00 4.00
597 598 1.667236 CAGGAATAATGCGAGCACCA 58.333 50.000 0.00 0.00 0.00 4.17
598 599 0.947244 CCAGGAATAATGCGAGCACC 59.053 55.000 0.00 0.00 0.00 5.01
599 600 1.953559 TCCAGGAATAATGCGAGCAC 58.046 50.000 0.00 0.00 0.00 4.40
600 601 2.936919 ATCCAGGAATAATGCGAGCA 57.063 45.000 0.00 0.00 0.00 4.26
601 602 5.886960 ATAAATCCAGGAATAATGCGAGC 57.113 39.130 0.00 0.00 0.00 5.03
602 603 7.874940 TGAAATAAATCCAGGAATAATGCGAG 58.125 34.615 0.00 0.00 0.00 5.03
603 604 7.815840 TGAAATAAATCCAGGAATAATGCGA 57.184 32.000 0.00 0.00 0.00 5.10
613 614 5.010012 CCCGAAATCCTGAAATAAATCCAGG 59.990 44.000 0.00 0.00 46.64 4.45
614 615 5.594317 ACCCGAAATCCTGAAATAAATCCAG 59.406 40.000 0.00 0.00 0.00 3.86
615 616 5.359576 CACCCGAAATCCTGAAATAAATCCA 59.640 40.000 0.00 0.00 0.00 3.41
616 617 5.592688 TCACCCGAAATCCTGAAATAAATCC 59.407 40.000 0.00 0.00 0.00 3.01
617 618 6.693315 TCACCCGAAATCCTGAAATAAATC 57.307 37.500 0.00 0.00 0.00 2.17
618 619 6.607198 ACATCACCCGAAATCCTGAAATAAAT 59.393 34.615 0.00 0.00 0.00 1.40
619 620 5.949354 ACATCACCCGAAATCCTGAAATAAA 59.051 36.000 0.00 0.00 0.00 1.40
620 621 5.356751 CACATCACCCGAAATCCTGAAATAA 59.643 40.000 0.00 0.00 0.00 1.40
621 622 4.881273 CACATCACCCGAAATCCTGAAATA 59.119 41.667 0.00 0.00 0.00 1.40
622 623 3.696051 CACATCACCCGAAATCCTGAAAT 59.304 43.478 0.00 0.00 0.00 2.17
623 624 3.081061 CACATCACCCGAAATCCTGAAA 58.919 45.455 0.00 0.00 0.00 2.69
624 625 2.710377 CACATCACCCGAAATCCTGAA 58.290 47.619 0.00 0.00 0.00 3.02
625 626 1.678728 GCACATCACCCGAAATCCTGA 60.679 52.381 0.00 0.00 0.00 3.86
626 627 0.734889 GCACATCACCCGAAATCCTG 59.265 55.000 0.00 0.00 0.00 3.86
627 628 0.620556 AGCACATCACCCGAAATCCT 59.379 50.000 0.00 0.00 0.00 3.24
628 629 1.463674 AAGCACATCACCCGAAATCC 58.536 50.000 0.00 0.00 0.00 3.01
629 630 2.487762 TGAAAGCACATCACCCGAAATC 59.512 45.455 0.00 0.00 0.00 2.17
630 631 2.489329 CTGAAAGCACATCACCCGAAAT 59.511 45.455 0.00 0.00 0.00 2.17
631 632 1.879380 CTGAAAGCACATCACCCGAAA 59.121 47.619 0.00 0.00 0.00 3.46
632 633 1.202758 ACTGAAAGCACATCACCCGAA 60.203 47.619 0.00 0.00 37.60 4.30
633 634 0.396435 ACTGAAAGCACATCACCCGA 59.604 50.000 0.00 0.00 37.60 5.14
634 635 0.518636 CACTGAAAGCACATCACCCG 59.481 55.000 0.00 0.00 37.60 5.28
635 636 0.883833 CCACTGAAAGCACATCACCC 59.116 55.000 0.00 0.00 37.60 4.61
636 637 0.883833 CCCACTGAAAGCACATCACC 59.116 55.000 0.00 0.00 37.60 4.02
637 638 1.808945 CTCCCACTGAAAGCACATCAC 59.191 52.381 0.00 0.00 37.60 3.06
638 639 1.271543 CCTCCCACTGAAAGCACATCA 60.272 52.381 0.00 0.00 37.60 3.07
639 640 1.003580 TCCTCCCACTGAAAGCACATC 59.996 52.381 0.00 0.00 37.60 3.06
640 641 1.004044 CTCCTCCCACTGAAAGCACAT 59.996 52.381 0.00 0.00 37.60 3.21
641 642 0.397941 CTCCTCCCACTGAAAGCACA 59.602 55.000 0.00 0.00 37.60 4.57
642 643 0.687354 TCTCCTCCCACTGAAAGCAC 59.313 55.000 0.00 0.00 37.60 4.40
643 644 0.687354 GTCTCCTCCCACTGAAAGCA 59.313 55.000 0.00 0.00 37.60 3.91
644 645 0.390472 CGTCTCCTCCCACTGAAAGC 60.390 60.000 0.00 0.00 37.60 3.51
645 646 0.969894 ACGTCTCCTCCCACTGAAAG 59.030 55.000 0.00 0.00 42.29 2.62
646 647 1.343465 GAACGTCTCCTCCCACTGAAA 59.657 52.381 0.00 0.00 0.00 2.69
647 648 0.966920 GAACGTCTCCTCCCACTGAA 59.033 55.000 0.00 0.00 0.00 3.02
648 649 0.898789 GGAACGTCTCCTCCCACTGA 60.899 60.000 8.87 0.00 41.61 3.41
649 650 1.592223 GGAACGTCTCCTCCCACTG 59.408 63.158 8.87 0.00 41.61 3.66
650 651 4.115270 GGAACGTCTCCTCCCACT 57.885 61.111 8.87 0.00 41.61 4.00
671 672 4.883300 GTAGGCGCCTCGTCGTCG 62.883 72.222 36.73 0.00 39.34 5.12
672 673 4.883300 CGTAGGCGCCTCGTCGTC 62.883 72.222 36.73 15.88 36.23 4.20
685 686 6.866770 TCTTGAGATTTACAAAGTCACCGTAG 59.133 38.462 0.00 0.00 0.00 3.51
686 687 6.751157 TCTTGAGATTTACAAAGTCACCGTA 58.249 36.000 0.00 0.00 0.00 4.02
687 688 5.607477 TCTTGAGATTTACAAAGTCACCGT 58.393 37.500 0.00 0.00 0.00 4.83
688 689 6.368791 TCATCTTGAGATTTACAAAGTCACCG 59.631 38.462 0.00 0.00 31.21 4.94
689 690 7.672983 TCATCTTGAGATTTACAAAGTCACC 57.327 36.000 0.00 0.00 31.21 4.02
692 693 9.875675 GCATATCATCTTGAGATTTACAAAGTC 57.124 33.333 0.00 0.00 31.21 3.01
693 694 8.844244 GGCATATCATCTTGAGATTTACAAAGT 58.156 33.333 0.00 0.00 31.21 2.66
694 695 8.013947 CGGCATATCATCTTGAGATTTACAAAG 58.986 37.037 0.00 0.00 31.21 2.77
695 696 7.041167 CCGGCATATCATCTTGAGATTTACAAA 60.041 37.037 0.00 0.00 31.21 2.83
696 697 6.427853 CCGGCATATCATCTTGAGATTTACAA 59.572 38.462 0.00 0.00 31.21 2.41
697 698 5.934043 CCGGCATATCATCTTGAGATTTACA 59.066 40.000 0.00 0.00 31.21 2.41
698 699 5.163814 GCCGGCATATCATCTTGAGATTTAC 60.164 44.000 24.80 0.00 31.21 2.01
699 700 4.937620 GCCGGCATATCATCTTGAGATTTA 59.062 41.667 24.80 0.00 31.21 1.40
700 701 3.755378 GCCGGCATATCATCTTGAGATTT 59.245 43.478 24.80 0.00 31.21 2.17
701 702 3.008813 AGCCGGCATATCATCTTGAGATT 59.991 43.478 31.54 0.00 31.21 2.40
702 703 2.570752 AGCCGGCATATCATCTTGAGAT 59.429 45.455 31.54 0.00 34.56 2.75
703 704 1.973515 AGCCGGCATATCATCTTGAGA 59.026 47.619 31.54 0.00 0.00 3.27
704 705 2.289257 TGAGCCGGCATATCATCTTGAG 60.289 50.000 31.54 0.00 0.00 3.02
705 706 1.693606 TGAGCCGGCATATCATCTTGA 59.306 47.619 31.54 0.00 0.00 3.02
706 707 2.074576 CTGAGCCGGCATATCATCTTG 58.925 52.381 31.54 7.95 0.00 3.02
707 708 1.696336 ACTGAGCCGGCATATCATCTT 59.304 47.619 31.54 3.33 0.00 2.40
708 709 1.274728 GACTGAGCCGGCATATCATCT 59.725 52.381 31.54 11.40 0.00 2.90
709 710 1.274728 AGACTGAGCCGGCATATCATC 59.725 52.381 31.54 19.98 0.00 2.92
710 711 1.274728 GAGACTGAGCCGGCATATCAT 59.725 52.381 31.54 13.17 0.00 2.45
711 712 0.676184 GAGACTGAGCCGGCATATCA 59.324 55.000 31.54 22.44 0.00 2.15
712 713 0.965439 AGAGACTGAGCCGGCATATC 59.035 55.000 31.54 18.63 0.00 1.63
713 714 0.965439 GAGAGACTGAGCCGGCATAT 59.035 55.000 31.54 8.11 0.00 1.78
714 715 1.448119 CGAGAGACTGAGCCGGCATA 61.448 60.000 31.54 16.21 0.00 3.14
715 716 2.780094 CGAGAGACTGAGCCGGCAT 61.780 63.158 31.54 14.28 0.00 4.40
716 717 3.443925 CGAGAGACTGAGCCGGCA 61.444 66.667 31.54 7.98 0.00 5.69
717 718 4.200283 CCGAGAGACTGAGCCGGC 62.200 72.222 21.89 21.89 33.47 6.13
718 719 2.438614 TCCGAGAGACTGAGCCGG 60.439 66.667 0.00 0.00 41.36 6.13
719 720 2.477176 CCTCCGAGAGACTGAGCCG 61.477 68.421 0.00 0.00 0.00 5.52
720 721 1.379309 ACCTCCGAGAGACTGAGCC 60.379 63.158 0.00 0.00 0.00 4.70
721 722 1.806568 CACCTCCGAGAGACTGAGC 59.193 63.158 0.00 0.00 0.00 4.26
722 723 0.679640 AGCACCTCCGAGAGACTGAG 60.680 60.000 0.00 0.00 0.00 3.35
723 724 0.678366 GAGCACCTCCGAGAGACTGA 60.678 60.000 0.00 0.00 0.00 3.41
724 725 0.962855 TGAGCACCTCCGAGAGACTG 60.963 60.000 0.00 0.22 0.00 3.51
725 726 0.033601 ATGAGCACCTCCGAGAGACT 60.034 55.000 0.00 0.00 0.00 3.24
726 727 1.606668 CTATGAGCACCTCCGAGAGAC 59.393 57.143 0.00 0.00 0.00 3.36
727 728 1.477740 CCTATGAGCACCTCCGAGAGA 60.478 57.143 0.00 0.00 0.00 3.10
728 729 0.958091 CCTATGAGCACCTCCGAGAG 59.042 60.000 0.00 0.00 0.00 3.20
729 730 0.468214 CCCTATGAGCACCTCCGAGA 60.468 60.000 0.00 0.00 0.00 4.04
730 731 1.467678 CCCCTATGAGCACCTCCGAG 61.468 65.000 0.00 0.00 0.00 4.63
731 732 1.457643 CCCCTATGAGCACCTCCGA 60.458 63.158 0.00 0.00 0.00 4.55
732 733 0.469331 TACCCCTATGAGCACCTCCG 60.469 60.000 0.00 0.00 0.00 4.63
733 734 1.343069 CTACCCCTATGAGCACCTCC 58.657 60.000 0.00 0.00 0.00 4.30
734 735 1.343069 CCTACCCCTATGAGCACCTC 58.657 60.000 0.00 0.00 0.00 3.85
735 736 0.104934 CCCTACCCCTATGAGCACCT 60.105 60.000 0.00 0.00 0.00 4.00
736 737 0.400093 ACCCTACCCCTATGAGCACC 60.400 60.000 0.00 0.00 0.00 5.01
737 738 0.759346 CACCCTACCCCTATGAGCAC 59.241 60.000 0.00 0.00 0.00 4.40
738 739 0.341961 ACACCCTACCCCTATGAGCA 59.658 55.000 0.00 0.00 0.00 4.26
739 740 0.759346 CACACCCTACCCCTATGAGC 59.241 60.000 0.00 0.00 0.00 4.26
740 741 0.759346 GCACACCCTACCCCTATGAG 59.241 60.000 0.00 0.00 0.00 2.90
741 742 1.046472 CGCACACCCTACCCCTATGA 61.046 60.000 0.00 0.00 0.00 2.15
742 743 1.335132 ACGCACACCCTACCCCTATG 61.335 60.000 0.00 0.00 0.00 2.23
743 744 1.002533 ACGCACACCCTACCCCTAT 59.997 57.895 0.00 0.00 0.00 2.57
744 745 1.985662 CACGCACACCCTACCCCTA 60.986 63.158 0.00 0.00 0.00 3.53
745 746 3.319198 CACGCACACCCTACCCCT 61.319 66.667 0.00 0.00 0.00 4.79
746 747 3.633116 ACACGCACACCCTACCCC 61.633 66.667 0.00 0.00 0.00 4.95
747 748 2.358247 CACACGCACACCCTACCC 60.358 66.667 0.00 0.00 0.00 3.69
748 749 1.959226 CACACACGCACACCCTACC 60.959 63.158 0.00 0.00 0.00 3.18
749 750 2.604174 GCACACACGCACACCCTAC 61.604 63.158 0.00 0.00 0.00 3.18
750 751 2.280524 GCACACACGCACACCCTA 60.281 61.111 0.00 0.00 0.00 3.53
753 754 3.783588 GAACGCACACACGCACACC 62.784 63.158 0.00 0.00 36.19 4.16
754 755 2.350760 GAACGCACACACGCACAC 60.351 61.111 0.00 0.00 36.19 3.82
755 756 0.876342 TATGAACGCACACACGCACA 60.876 50.000 0.00 0.00 36.19 4.57
756 757 0.179250 CTATGAACGCACACACGCAC 60.179 55.000 0.00 0.00 36.19 5.34
757 758 1.288419 CCTATGAACGCACACACGCA 61.288 55.000 0.00 0.00 36.19 5.24
758 759 1.419922 CCTATGAACGCACACACGC 59.580 57.895 0.00 0.00 36.19 5.34
759 760 0.389296 TCCCTATGAACGCACACACG 60.389 55.000 0.00 0.00 39.50 4.49
760 761 1.665679 CATCCCTATGAACGCACACAC 59.334 52.381 0.00 0.00 34.84 3.82
761 762 1.552792 TCATCCCTATGAACGCACACA 59.447 47.619 0.00 0.00 39.20 3.72
762 763 2.205074 CTCATCCCTATGAACGCACAC 58.795 52.381 0.00 0.00 41.57 3.82
763 764 1.831106 ACTCATCCCTATGAACGCACA 59.169 47.619 0.00 0.00 41.57 4.57
764 765 2.205074 CACTCATCCCTATGAACGCAC 58.795 52.381 0.00 0.00 41.57 5.34
765 766 1.831106 ACACTCATCCCTATGAACGCA 59.169 47.619 0.00 0.00 41.57 5.24
766 767 2.604046 ACACTCATCCCTATGAACGC 57.396 50.000 0.00 0.00 41.57 4.84
767 768 3.990469 GCATACACTCATCCCTATGAACG 59.010 47.826 0.00 0.00 41.57 3.95
768 769 3.990469 CGCATACACTCATCCCTATGAAC 59.010 47.826 0.00 0.00 41.57 3.18
769 770 3.554960 GCGCATACACTCATCCCTATGAA 60.555 47.826 0.30 0.00 41.57 2.57
770 771 2.029020 GCGCATACACTCATCCCTATGA 60.029 50.000 0.30 0.00 39.87 2.15
771 772 2.341257 GCGCATACACTCATCCCTATG 58.659 52.381 0.30 0.00 0.00 2.23
772 773 1.067565 CGCGCATACACTCATCCCTAT 60.068 52.381 8.75 0.00 0.00 2.57
773 774 0.313987 CGCGCATACACTCATCCCTA 59.686 55.000 8.75 0.00 0.00 3.53
774 775 1.068083 CGCGCATACACTCATCCCT 59.932 57.895 8.75 0.00 0.00 4.20
775 776 1.227263 ACGCGCATACACTCATCCC 60.227 57.895 5.73 0.00 0.00 3.85
776 777 0.806102 ACACGCGCATACACTCATCC 60.806 55.000 5.73 0.00 0.00 3.51
777 778 1.835121 TACACGCGCATACACTCATC 58.165 50.000 5.73 0.00 0.00 2.92
778 779 2.509052 ATACACGCGCATACACTCAT 57.491 45.000 5.73 0.00 0.00 2.90
779 780 3.003897 TCATATACACGCGCATACACTCA 59.996 43.478 5.73 0.00 0.00 3.41
780 781 3.561503 TCATATACACGCGCATACACTC 58.438 45.455 5.73 0.00 0.00 3.51
781 782 3.565516 CTCATATACACGCGCATACACT 58.434 45.455 5.73 0.00 0.00 3.55
782 783 2.090658 GCTCATATACACGCGCATACAC 59.909 50.000 5.73 0.00 0.00 2.90
783 784 2.324860 GCTCATATACACGCGCATACA 58.675 47.619 5.73 0.00 0.00 2.29
784 785 1.317611 CGCTCATATACACGCGCATAC 59.682 52.381 5.73 0.00 39.11 2.39
785 786 1.613270 CGCTCATATACACGCGCATA 58.387 50.000 5.73 1.53 39.11 3.14
786 787 2.434688 CGCTCATATACACGCGCAT 58.565 52.632 5.73 0.00 39.11 4.73
787 788 3.916439 CGCTCATATACACGCGCA 58.084 55.556 5.73 0.00 39.11 6.09
791 792 4.322009 CAGACATAAGCGCTCATATACACG 59.678 45.833 12.06 0.00 0.00 4.49
792 793 5.223382 ACAGACATAAGCGCTCATATACAC 58.777 41.667 12.06 1.26 0.00 2.90
793 794 5.453567 ACAGACATAAGCGCTCATATACA 57.546 39.130 12.06 0.00 0.00 2.29
794 795 6.524933 CAGTACAGACATAAGCGCTCATATAC 59.475 42.308 12.06 5.98 0.00 1.47
795 796 6.430000 TCAGTACAGACATAAGCGCTCATATA 59.570 38.462 12.06 0.00 0.00 0.86
796 797 5.241728 TCAGTACAGACATAAGCGCTCATAT 59.758 40.000 12.06 2.36 0.00 1.78
797 798 4.578928 TCAGTACAGACATAAGCGCTCATA 59.421 41.667 12.06 0.00 0.00 2.15
798 799 3.381590 TCAGTACAGACATAAGCGCTCAT 59.618 43.478 12.06 0.00 0.00 2.90
799 800 2.752903 TCAGTACAGACATAAGCGCTCA 59.247 45.455 12.06 0.00 0.00 4.26
800 801 3.422417 TCAGTACAGACATAAGCGCTC 57.578 47.619 12.06 0.00 0.00 5.03
801 802 3.711086 CATCAGTACAGACATAAGCGCT 58.289 45.455 2.64 2.64 0.00 5.92
802 803 2.219674 GCATCAGTACAGACATAAGCGC 59.780 50.000 0.00 0.00 0.00 5.92
803 804 3.711086 AGCATCAGTACAGACATAAGCG 58.289 45.455 0.00 0.00 0.00 4.68
804 805 7.539712 TTTTAGCATCAGTACAGACATAAGC 57.460 36.000 0.00 0.00 0.00 3.09
834 835 9.342308 TGATCATCTCTACACAACTTTCTTTTT 57.658 29.630 0.00 0.00 0.00 1.94
835 836 8.778358 GTGATCATCTCTACACAACTTTCTTTT 58.222 33.333 0.00 0.00 34.05 2.27
836 837 7.933577 TGTGATCATCTCTACACAACTTTCTTT 59.066 33.333 0.00 0.00 39.70 2.52
837 838 7.386299 GTGTGATCATCTCTACACAACTTTCTT 59.614 37.037 0.00 0.00 43.21 2.52
838 839 6.870965 GTGTGATCATCTCTACACAACTTTCT 59.129 38.462 0.00 0.00 43.21 2.52
839 840 7.054855 GTGTGATCATCTCTACACAACTTTC 57.945 40.000 0.00 0.00 43.21 2.62
846 847 4.098055 ACGTGTGTGATCATCTCTACAC 57.902 45.455 0.00 8.96 42.70 2.90
847 848 4.201783 CGTACGTGTGTGATCATCTCTACA 60.202 45.833 7.22 0.00 0.00 2.74
848 849 4.033702 TCGTACGTGTGTGATCATCTCTAC 59.966 45.833 16.05 0.00 0.00 2.59
849 850 4.033702 GTCGTACGTGTGTGATCATCTCTA 59.966 45.833 16.05 0.00 0.00 2.43
850 851 3.007635 TCGTACGTGTGTGATCATCTCT 58.992 45.455 16.05 0.00 0.00 3.10
851 852 3.099362 GTCGTACGTGTGTGATCATCTC 58.901 50.000 16.05 0.00 0.00 2.75
852 853 2.159421 GGTCGTACGTGTGTGATCATCT 60.159 50.000 16.05 0.00 0.00 2.90
853 854 2.182825 GGTCGTACGTGTGTGATCATC 58.817 52.381 16.05 0.00 0.00 2.92
854 855 1.542472 TGGTCGTACGTGTGTGATCAT 59.458 47.619 16.05 0.00 0.00 2.45
855 856 0.953003 TGGTCGTACGTGTGTGATCA 59.047 50.000 16.05 0.00 0.00 2.92
856 857 2.054687 TTGGTCGTACGTGTGTGATC 57.945 50.000 16.05 0.00 0.00 2.92
857 858 2.034939 TCTTTGGTCGTACGTGTGTGAT 59.965 45.455 16.05 0.00 0.00 3.06
858 859 1.404748 TCTTTGGTCGTACGTGTGTGA 59.595 47.619 16.05 5.47 0.00 3.58
859 860 1.842720 TCTTTGGTCGTACGTGTGTG 58.157 50.000 16.05 3.17 0.00 3.82
860 861 2.582728 TTCTTTGGTCGTACGTGTGT 57.417 45.000 16.05 0.00 0.00 3.72
861 862 4.210537 AGAATTTCTTTGGTCGTACGTGTG 59.789 41.667 16.05 1.61 0.00 3.82
862 863 4.374399 AGAATTTCTTTGGTCGTACGTGT 58.626 39.130 16.05 0.00 0.00 4.49
863 864 4.985044 AGAATTTCTTTGGTCGTACGTG 57.015 40.909 16.05 0.57 0.00 4.49
864 865 7.814107 TGTTATAGAATTTCTTTGGTCGTACGT 59.186 33.333 16.05 0.00 0.00 3.57
865 866 8.106348 GTGTTATAGAATTTCTTTGGTCGTACG 58.894 37.037 9.53 9.53 0.00 3.67
866 867 8.928733 TGTGTTATAGAATTTCTTTGGTCGTAC 58.071 33.333 3.86 0.00 0.00 3.67
867 868 9.661563 ATGTGTTATAGAATTTCTTTGGTCGTA 57.338 29.630 3.86 0.00 0.00 3.43
868 869 7.972832 TGTGTTATAGAATTTCTTTGGTCGT 57.027 32.000 3.86 0.00 0.00 4.34
869 870 9.840427 AAATGTGTTATAGAATTTCTTTGGTCG 57.160 29.630 3.86 0.00 0.00 4.79
871 872 9.423061 GCAAATGTGTTATAGAATTTCTTTGGT 57.577 29.630 3.86 0.00 0.00 3.67
872 873 9.421806 TGCAAATGTGTTATAGAATTTCTTTGG 57.578 29.630 3.86 0.00 0.00 3.28
876 877 9.577110 CACATGCAAATGTGTTATAGAATTTCT 57.423 29.630 11.53 4.03 44.99 2.52
897 898 1.426621 GTCAGGACGCATGCACATG 59.573 57.895 19.57 17.82 41.60 3.21
898 899 1.746615 GGTCAGGACGCATGCACAT 60.747 57.895 19.57 5.83 0.00 3.21
899 900 2.358615 GGTCAGGACGCATGCACA 60.359 61.111 19.57 0.00 0.00 4.57
900 901 3.127533 GGGTCAGGACGCATGCAC 61.128 66.667 19.57 10.85 42.92 4.57
901 902 3.315142 GAGGGTCAGGACGCATGCA 62.315 63.158 19.57 0.00 45.43 3.96
902 903 2.512515 GAGGGTCAGGACGCATGC 60.513 66.667 17.21 7.91 45.43 4.06
903 904 0.107508 ATTGAGGGTCAGGACGCATG 60.108 55.000 17.21 0.00 45.43 4.06
904 905 0.179000 GATTGAGGGTCAGGACGCAT 59.821 55.000 17.21 3.84 45.43 4.73
905 906 1.596934 GATTGAGGGTCAGGACGCA 59.403 57.895 17.21 2.40 45.43 5.24
906 907 1.519455 CGATTGAGGGTCAGGACGC 60.519 63.158 8.29 8.29 43.63 5.19
907 908 1.519455 GCGATTGAGGGTCAGGACG 60.519 63.158 0.00 0.00 0.00 4.79
908 909 1.153349 GGCGATTGAGGGTCAGGAC 60.153 63.158 0.00 0.00 0.00 3.85
909 910 1.612146 TGGCGATTGAGGGTCAGGA 60.612 57.895 0.00 0.00 0.00 3.86
910 911 1.153289 CTGGCGATTGAGGGTCAGG 60.153 63.158 0.00 0.00 0.00 3.86
911 912 1.153289 CCTGGCGATTGAGGGTCAG 60.153 63.158 0.00 0.00 0.00 3.51
912 913 1.612146 TCCTGGCGATTGAGGGTCA 60.612 57.895 0.00 0.00 0.00 4.02
913 914 1.144936 CTCCTGGCGATTGAGGGTC 59.855 63.158 0.00 0.00 0.00 4.46
914 915 2.370445 CCTCCTGGCGATTGAGGGT 61.370 63.158 6.56 0.00 41.64 4.34
915 916 1.626356 TTCCTCCTGGCGATTGAGGG 61.626 60.000 12.53 0.00 44.73 4.30
916 917 0.471617 ATTCCTCCTGGCGATTGAGG 59.528 55.000 7.80 7.80 45.77 3.86
917 918 1.415659 AGATTCCTCCTGGCGATTGAG 59.584 52.381 0.00 0.00 0.00 3.02
918 919 1.139654 CAGATTCCTCCTGGCGATTGA 59.860 52.381 0.00 0.00 0.00 2.57
919 920 1.590932 CAGATTCCTCCTGGCGATTG 58.409 55.000 0.00 0.00 0.00 2.67
920 921 0.179034 GCAGATTCCTCCTGGCGATT 60.179 55.000 0.00 0.00 32.51 3.34
921 922 1.340399 TGCAGATTCCTCCTGGCGAT 61.340 55.000 0.00 0.00 32.51 4.58
922 923 1.552799 TTGCAGATTCCTCCTGGCGA 61.553 55.000 0.00 0.00 32.51 5.54
923 924 1.078214 TTGCAGATTCCTCCTGGCG 60.078 57.895 0.00 0.00 32.51 5.69
924 925 1.382692 GCTTGCAGATTCCTCCTGGC 61.383 60.000 0.00 0.00 32.51 4.85
925 926 0.034767 TGCTTGCAGATTCCTCCTGG 60.035 55.000 0.00 0.00 32.51 4.45
926 927 1.380524 CTGCTTGCAGATTCCTCCTG 58.619 55.000 16.78 0.00 34.88 3.86
927 928 0.255318 CCTGCTTGCAGATTCCTCCT 59.745 55.000 22.50 0.00 0.00 3.69
928 929 0.750911 CCCTGCTTGCAGATTCCTCC 60.751 60.000 22.50 0.00 0.00 4.30
929 930 0.750911 CCCCTGCTTGCAGATTCCTC 60.751 60.000 22.50 0.00 0.00 3.71
930 931 1.305623 CCCCTGCTTGCAGATTCCT 59.694 57.895 22.50 0.00 0.00 3.36
931 932 2.421399 GCCCCTGCTTGCAGATTCC 61.421 63.158 22.50 5.67 33.53 3.01
932 933 1.679977 TGCCCCTGCTTGCAGATTC 60.680 57.895 22.50 11.31 38.71 2.52
933 934 1.980772 GTGCCCCTGCTTGCAGATT 60.981 57.895 22.50 0.00 38.34 2.40
934 935 2.362120 GTGCCCCTGCTTGCAGAT 60.362 61.111 22.50 0.00 38.34 2.90
936 937 2.874648 TATCGTGCCCCTGCTTGCAG 62.875 60.000 15.02 15.02 38.34 4.41
937 938 2.476852 TTATCGTGCCCCTGCTTGCA 62.477 55.000 0.00 0.00 38.71 4.08
938 939 1.312371 TTTATCGTGCCCCTGCTTGC 61.312 55.000 0.00 0.00 38.71 4.01
939 940 1.135402 GTTTTATCGTGCCCCTGCTTG 60.135 52.381 0.00 0.00 38.71 4.01
940 941 1.173913 GTTTTATCGTGCCCCTGCTT 58.826 50.000 0.00 0.00 38.71 3.91
941 942 0.328258 AGTTTTATCGTGCCCCTGCT 59.672 50.000 0.00 0.00 38.71 4.24
942 943 1.132453 GAAGTTTTATCGTGCCCCTGC 59.868 52.381 0.00 0.00 38.26 4.85
943 944 1.743394 GGAAGTTTTATCGTGCCCCTG 59.257 52.381 0.00 0.00 0.00 4.45
944 945 1.677820 CGGAAGTTTTATCGTGCCCCT 60.678 52.381 0.00 0.00 0.00 4.79
945 946 0.730840 CGGAAGTTTTATCGTGCCCC 59.269 55.000 0.00 0.00 0.00 5.80
946 947 1.395954 GTCGGAAGTTTTATCGTGCCC 59.604 52.381 0.00 0.00 0.00 5.36
947 948 1.395954 GGTCGGAAGTTTTATCGTGCC 59.604 52.381 0.00 0.00 0.00 5.01
948 949 1.395954 GGGTCGGAAGTTTTATCGTGC 59.604 52.381 0.00 0.00 0.00 5.34
949 950 2.004733 GGGGTCGGAAGTTTTATCGTG 58.995 52.381 0.00 0.00 0.00 4.35
950 951 1.404583 CGGGGTCGGAAGTTTTATCGT 60.405 52.381 0.00 0.00 0.00 3.73
951 952 1.135024 TCGGGGTCGGAAGTTTTATCG 60.135 52.381 0.00 0.00 36.95 2.92
952 953 2.678471 TCGGGGTCGGAAGTTTTATC 57.322 50.000 0.00 0.00 36.95 1.75
953 954 3.054948 TGATTCGGGGTCGGAAGTTTTAT 60.055 43.478 0.00 0.00 36.95 1.40
954 955 2.302445 TGATTCGGGGTCGGAAGTTTTA 59.698 45.455 0.00 0.00 36.95 1.52
955 956 1.072648 TGATTCGGGGTCGGAAGTTTT 59.927 47.619 0.00 0.00 36.95 2.43
956 957 0.688487 TGATTCGGGGTCGGAAGTTT 59.312 50.000 0.00 0.00 36.95 2.66
957 958 0.249398 CTGATTCGGGGTCGGAAGTT 59.751 55.000 0.00 0.00 36.95 2.66
958 959 1.614241 CCTGATTCGGGGTCGGAAGT 61.614 60.000 3.33 0.00 36.95 3.01
959 960 1.144057 CCTGATTCGGGGTCGGAAG 59.856 63.158 3.33 0.00 36.95 3.46
960 961 3.026431 GCCTGATTCGGGGTCGGAA 62.026 63.158 13.48 0.00 36.95 4.30
961 962 3.467226 GCCTGATTCGGGGTCGGA 61.467 66.667 13.48 0.00 36.95 4.55
962 963 4.891727 CGCCTGATTCGGGGTCGG 62.892 72.222 13.48 0.00 36.95 4.79
982 983 2.676471 AAGGTGGTCATTGGCGGC 60.676 61.111 0.00 0.00 0.00 6.53
983 984 2.342650 CCAAGGTGGTCATTGGCGG 61.343 63.158 0.00 0.00 46.03 6.13
984 985 3.277133 CCAAGGTGGTCATTGGCG 58.723 61.111 0.00 0.00 46.03 5.69
987 988 0.039256 CAACGCCAAGGTGGTCATTG 60.039 55.000 4.49 0.00 40.46 2.82
988 989 1.805428 GCAACGCCAAGGTGGTCATT 61.805 55.000 4.49 0.00 40.46 2.57
989 990 2.268076 GCAACGCCAAGGTGGTCAT 61.268 57.895 4.49 0.00 40.46 3.06
990 991 2.904866 GCAACGCCAAGGTGGTCA 60.905 61.111 4.49 0.00 40.46 4.02
1006 1007 0.523335 CCTAAAAATCGTGCTGCGGC 60.523 55.000 11.65 11.65 41.72 6.53
1007 1008 0.098728 CCCTAAAAATCGTGCTGCGG 59.901 55.000 0.00 0.00 41.72 5.69
1008 1009 0.802494 ACCCTAAAAATCGTGCTGCG 59.198 50.000 0.00 0.00 43.01 5.18
1009 1010 1.202031 CGACCCTAAAAATCGTGCTGC 60.202 52.381 0.00 0.00 0.00 5.25
1010 1011 2.343101 TCGACCCTAAAAATCGTGCTG 58.657 47.619 0.00 0.00 37.16 4.41
1011 1012 2.754946 TCGACCCTAAAAATCGTGCT 57.245 45.000 0.00 0.00 37.16 4.40
1012 1013 2.034001 CGATCGACCCTAAAAATCGTGC 60.034 50.000 10.26 0.00 37.16 5.34
1013 1014 3.836229 CGATCGACCCTAAAAATCGTG 57.164 47.619 10.26 0.00 37.16 4.35
1014 1015 3.515330 ACGATCGACCCTAAAAATCGT 57.485 42.857 24.34 3.11 45.32 3.73
1015 1016 3.441163 TGACGATCGACCCTAAAAATCG 58.559 45.455 24.34 0.00 43.53 3.34
1016 1017 4.260253 GCTTGACGATCGACCCTAAAAATC 60.260 45.833 24.34 5.06 0.00 2.17
1017 1018 3.621715 GCTTGACGATCGACCCTAAAAAT 59.378 43.478 24.34 0.00 0.00 1.82
1018 1019 2.997986 GCTTGACGATCGACCCTAAAAA 59.002 45.455 24.34 3.90 0.00 1.94
1019 1020 2.613691 GCTTGACGATCGACCCTAAAA 58.386 47.619 24.34 4.64 0.00 1.52
1020 1021 1.134907 GGCTTGACGATCGACCCTAAA 60.135 52.381 24.34 5.03 0.00 1.85
1021 1022 0.458669 GGCTTGACGATCGACCCTAA 59.541 55.000 24.34 5.40 0.00 2.69
1022 1023 1.721664 CGGCTTGACGATCGACCCTA 61.722 60.000 24.34 6.51 35.47 3.53
1023 1024 2.893398 GGCTTGACGATCGACCCT 59.107 61.111 24.34 0.00 0.00 4.34
1024 1025 2.582498 CGGCTTGACGATCGACCC 60.582 66.667 24.34 11.44 35.47 4.46
1025 1026 3.255379 GCGGCTTGACGATCGACC 61.255 66.667 24.34 13.39 35.47 4.79
1026 1027 1.878522 ATGCGGCTTGACGATCGAC 60.879 57.895 24.34 17.11 35.47 4.20
1027 1028 1.878069 CATGCGGCTTGACGATCGA 60.878 57.895 24.34 0.00 35.47 3.59
1028 1029 1.217585 ATCATGCGGCTTGACGATCG 61.218 55.000 19.22 14.88 35.47 3.69
1029 1030 0.234106 CATCATGCGGCTTGACGATC 59.766 55.000 19.22 0.00 35.47 3.69
1030 1031 0.462581 ACATCATGCGGCTTGACGAT 60.463 50.000 19.22 6.62 35.47 3.73
1031 1032 1.079197 ACATCATGCGGCTTGACGA 60.079 52.632 19.22 0.00 35.47 4.20
1032 1033 1.349627 GACATCATGCGGCTTGACG 59.650 57.895 19.22 14.53 0.00 4.35
1033 1034 1.003116 GATGACATCATGCGGCTTGAC 60.003 52.381 19.22 8.89 36.57 3.18
1034 1035 1.302366 GATGACATCATGCGGCTTGA 58.698 50.000 19.13 19.13 36.57 3.02
1035 1036 0.041576 CGATGACATCATGCGGCTTG 60.042 55.000 15.58 9.41 36.57 4.01
1036 1037 0.462581 ACGATGACATCATGCGGCTT 60.463 50.000 15.58 0.00 36.57 4.35
1037 1038 0.877649 GACGATGACATCATGCGGCT 60.878 55.000 15.58 0.00 36.57 5.52
1038 1039 1.153597 TGACGATGACATCATGCGGC 61.154 55.000 15.58 4.78 36.57 6.53
1039 1040 1.259770 CTTGACGATGACATCATGCGG 59.740 52.381 15.58 1.38 36.57 5.69
1040 1041 1.332640 GCTTGACGATGACATCATGCG 60.333 52.381 15.58 4.61 36.60 4.73
1041 1042 1.003116 GGCTTGACGATGACATCATGC 60.003 52.381 15.58 10.67 42.37 4.06
1042 1043 1.259770 CGGCTTGACGATGACATCATG 59.740 52.381 15.58 2.78 36.57 3.07
1043 1044 1.575244 CGGCTTGACGATGACATCAT 58.425 50.000 15.58 0.00 39.70 2.45
1044 1045 1.083806 GCGGCTTGACGATGACATCA 61.084 55.000 15.58 0.00 35.47 3.07
1045 1046 1.083806 TGCGGCTTGACGATGACATC 61.084 55.000 5.28 5.28 35.47 3.06
1046 1047 1.079197 TGCGGCTTGACGATGACAT 60.079 52.632 0.00 0.00 35.47 3.06
1047 1048 1.737735 CTGCGGCTTGACGATGACA 60.738 57.895 0.00 0.00 35.47 3.58
1048 1049 3.084579 CTGCGGCTTGACGATGAC 58.915 61.111 0.00 0.00 35.47 3.06
1049 1050 2.815211 GCTGCGGCTTGACGATGA 60.815 61.111 11.21 0.00 35.47 2.92
1050 1051 3.120385 TGCTGCGGCTTGACGATG 61.120 61.111 20.27 0.00 39.59 3.84
1051 1052 3.121030 GTGCTGCGGCTTGACGAT 61.121 61.111 20.27 0.00 39.59 3.73
1076 1077 4.514577 CCTAGTGACCTGCCGCCG 62.515 72.222 0.00 0.00 0.00 6.46
1077 1078 4.162690 CCCTAGTGACCTGCCGCC 62.163 72.222 0.00 0.00 0.00 6.13
1078 1079 2.435693 ATCCCTAGTGACCTGCCGC 61.436 63.158 0.00 0.00 0.00 6.53
1079 1080 1.443407 CATCCCTAGTGACCTGCCG 59.557 63.158 0.00 0.00 0.00 5.69
1080 1081 1.147153 GCATCCCTAGTGACCTGCC 59.853 63.158 0.00 0.00 0.00 4.85
1081 1082 0.471617 ATGCATCCCTAGTGACCTGC 59.528 55.000 0.00 0.00 0.00 4.85
1082 1083 1.071385 GGATGCATCCCTAGTGACCTG 59.929 57.143 32.15 0.00 41.20 4.00
1083 1084 1.428869 GGATGCATCCCTAGTGACCT 58.571 55.000 32.15 0.00 41.20 3.85
1112 1113 4.426112 CAGCTCTCCGTGCAGCGA 62.426 66.667 9.75 0.00 44.77 4.93
1119 1120 3.768922 GCTCCAGCAGCTCTCCGT 61.769 66.667 0.00 0.00 45.83 4.69
1129 1130 0.319727 CGATCAGATCCAGCTCCAGC 60.320 60.000 4.73 0.00 42.49 4.85
1130 1131 0.319727 GCGATCAGATCCAGCTCCAG 60.320 60.000 4.73 0.00 0.00 3.86
1131 1132 1.744639 GCGATCAGATCCAGCTCCA 59.255 57.895 4.73 0.00 0.00 3.86
1132 1133 1.372748 CGCGATCAGATCCAGCTCC 60.373 63.158 0.00 0.00 0.00 4.70
1133 1134 0.938637 CACGCGATCAGATCCAGCTC 60.939 60.000 15.93 0.00 0.00 4.09
1134 1135 1.067084 CACGCGATCAGATCCAGCT 59.933 57.895 15.93 0.00 0.00 4.24
1255 1259 4.003788 CGTGGGTGGAAGCGACCT 62.004 66.667 0.00 0.00 40.07 3.85
1273 1277 3.503363 GGCAGCATCGTCCAGTGC 61.503 66.667 0.00 0.00 41.57 4.40
1276 1280 4.147449 TCGGGCAGCATCGTCCAG 62.147 66.667 7.17 0.00 0.00 3.86
1332 1336 1.804748 GGCTGAAGAAACGGACGAAAT 59.195 47.619 0.00 0.00 0.00 2.17
1333 1337 1.202604 AGGCTGAAGAAACGGACGAAA 60.203 47.619 0.00 0.00 0.00 3.46
1342 1346 0.321671 CGGTGGAGAGGCTGAAGAAA 59.678 55.000 0.00 0.00 0.00 2.52
1377 1381 1.048724 CCTGAATAGCGGGAGGTGGA 61.049 60.000 0.00 0.00 46.81 4.02
1395 1399 4.803426 CGAGAGCGCAGTGGTCCC 62.803 72.222 11.47 0.00 46.44 4.46
1427 1431 2.124819 CCGCTGCAGCAGAAGGAT 60.125 61.111 36.03 0.00 42.21 3.24
1461 1469 2.907179 AAAGGGTTGAGGAGGCGGG 61.907 63.158 0.00 0.00 0.00 6.13
1477 1485 2.340809 ACGATGTCGCCCGTCAAA 59.659 55.556 1.77 0.00 44.43 2.69
1493 1501 3.046390 CTCATAGATGCGGAAAGTCGAC 58.954 50.000 7.70 7.70 0.00 4.20
1506 1514 0.322975 GCCCATCCACGCTCATAGAT 59.677 55.000 0.00 0.00 0.00 1.98
1532 1549 3.973206 ACACCACTTATCATCCAACGA 57.027 42.857 0.00 0.00 0.00 3.85
1535 1552 6.716284 TGATACAACACCACTTATCATCCAA 58.284 36.000 0.00 0.00 0.00 3.53
1536 1553 6.156083 TCTGATACAACACCACTTATCATCCA 59.844 38.462 0.00 0.00 32.00 3.41
1537 1554 6.582636 TCTGATACAACACCACTTATCATCC 58.417 40.000 0.00 0.00 32.00 3.51
1542 1559 9.261180 CGATATTTCTGATACAACACCACTTAT 57.739 33.333 0.00 0.00 0.00 1.73
1543 1560 8.471609 TCGATATTTCTGATACAACACCACTTA 58.528 33.333 0.00 0.00 0.00 2.24
1553 1570 4.931601 GGCAGCATCGATATTTCTGATACA 59.068 41.667 15.73 0.00 0.00 2.29
1558 1575 2.740981 GGAGGCAGCATCGATATTTCTG 59.259 50.000 0.00 4.81 0.00 3.02
1569 1586 1.537172 ATGCTCATGGAGGCAGCAT 59.463 52.632 11.87 11.87 46.51 3.79
1584 1601 2.203451 CTCCATCTGCCCCCATGC 60.203 66.667 0.00 0.00 0.00 4.06
1586 1603 2.446848 CGACTCCATCTGCCCCCAT 61.447 63.158 0.00 0.00 0.00 4.00
1591 1608 0.179124 GTGAGACGACTCCATCTGCC 60.179 60.000 12.30 0.00 41.99 4.85
1594 1611 1.911057 TGTGTGAGACGACTCCATCT 58.089 50.000 12.30 0.00 41.99 2.90
1609 1626 1.077501 CGCCCCCAGAATCATGTGT 60.078 57.895 0.00 0.00 0.00 3.72
1611 1628 2.124151 GCGCCCCCAGAATCATGT 60.124 61.111 0.00 0.00 0.00 3.21
1629 1646 0.753111 GGCTATGTTGCCCCAAGGAG 60.753 60.000 0.00 0.00 46.82 3.69
1630 1647 1.306296 GGCTATGTTGCCCCAAGGA 59.694 57.895 0.00 0.00 46.82 3.36
1642 1659 1.106285 GGGAGGTTGCAAAGGCTATG 58.894 55.000 0.00 0.00 41.91 2.23
1654 1671 2.242043 CATTGTTGCTCTTGGGAGGTT 58.758 47.619 0.00 0.00 39.80 3.50
1666 1683 1.270550 CTTGACACCCTCCATTGTTGC 59.729 52.381 0.00 0.00 0.00 4.17
1668 1685 1.145738 AGCTTGACACCCTCCATTGTT 59.854 47.619 0.00 0.00 0.00 2.83
1681 1698 1.620819 TGAAGGAGAGACCAGCTTGAC 59.379 52.381 0.00 0.00 42.04 3.18
1692 1709 5.073428 GGGGCCTATAAATTTGAAGGAGAG 58.927 45.833 19.53 0.00 0.00 3.20
1693 1710 4.480537 TGGGGCCTATAAATTTGAAGGAGA 59.519 41.667 19.53 2.72 0.00 3.71
1694 1711 4.803452 TGGGGCCTATAAATTTGAAGGAG 58.197 43.478 19.53 3.30 0.00 3.69
1695 1712 4.890499 TGGGGCCTATAAATTTGAAGGA 57.110 40.909 19.53 1.80 0.00 3.36
1704 1721 7.827787 TGGACTATAAAATTGGGGCCTATAAA 58.172 34.615 0.84 0.00 0.00 1.40
1707 1724 5.941146 TGGACTATAAAATTGGGGCCTAT 57.059 39.130 0.84 0.00 0.00 2.57
1709 1726 4.286707 GTTGGACTATAAAATTGGGGCCT 58.713 43.478 0.84 0.00 0.00 5.19
1710 1727 3.386726 GGTTGGACTATAAAATTGGGGCC 59.613 47.826 0.00 0.00 0.00 5.80
1711 1728 4.286707 AGGTTGGACTATAAAATTGGGGC 58.713 43.478 0.00 0.00 0.00 5.80
1712 1729 4.578928 CGAGGTTGGACTATAAAATTGGGG 59.421 45.833 0.00 0.00 0.00 4.96
1713 1730 5.190677 ACGAGGTTGGACTATAAAATTGGG 58.809 41.667 0.00 0.00 0.00 4.12
1714 1731 6.183360 GGAACGAGGTTGGACTATAAAATTGG 60.183 42.308 0.00 0.00 0.00 3.16
1715 1732 6.373216 TGGAACGAGGTTGGACTATAAAATTG 59.627 38.462 0.00 0.00 0.00 2.32
1716 1733 6.478129 TGGAACGAGGTTGGACTATAAAATT 58.522 36.000 0.00 0.00 0.00 1.82
1717 1734 6.057321 TGGAACGAGGTTGGACTATAAAAT 57.943 37.500 0.00 0.00 0.00 1.82
1718 1735 5.484715 CTGGAACGAGGTTGGACTATAAAA 58.515 41.667 0.00 0.00 0.00 1.52
1719 1736 4.081309 CCTGGAACGAGGTTGGACTATAAA 60.081 45.833 0.00 0.00 0.00 1.40
1720 1737 3.449737 CCTGGAACGAGGTTGGACTATAA 59.550 47.826 0.00 0.00 0.00 0.98
1721 1738 3.028850 CCTGGAACGAGGTTGGACTATA 58.971 50.000 0.00 0.00 0.00 1.31
1722 1739 1.831736 CCTGGAACGAGGTTGGACTAT 59.168 52.381 0.00 0.00 0.00 2.12
1723 1740 1.263356 CCTGGAACGAGGTTGGACTA 58.737 55.000 0.00 0.00 0.00 2.59
1724 1741 1.481056 CCCTGGAACGAGGTTGGACT 61.481 60.000 0.00 0.00 0.00 3.85
1741 1758 1.542547 CCCACCACGTATATCTTGCCC 60.543 57.143 0.00 0.00 0.00 5.36
1744 1761 5.526111 CCTAAAACCCACCACGTATATCTTG 59.474 44.000 0.00 0.00 0.00 3.02
1753 1770 2.953648 ACTTTTCCTAAAACCCACCACG 59.046 45.455 0.00 0.00 0.00 4.94
1755 1772 5.024118 TGAAACTTTTCCTAAAACCCACCA 58.976 37.500 0.00 0.00 36.36 4.17
1759 1776 4.406326 TGGGTGAAACTTTTCCTAAAACCC 59.594 41.667 15.56 15.56 43.44 4.11
1760 1777 5.601583 TGGGTGAAACTTTTCCTAAAACC 57.398 39.130 0.00 0.45 36.36 3.27
1767 1784 4.441495 CCTCTTGTTGGGTGAAACTTTTCC 60.441 45.833 0.00 0.00 36.36 3.13
1768 1785 4.159693 ACCTCTTGTTGGGTGAAACTTTTC 59.840 41.667 0.00 0.00 36.74 2.29
1770 1787 3.708451 ACCTCTTGTTGGGTGAAACTTT 58.292 40.909 0.00 0.00 36.74 2.66
1778 1795 1.072331 CTGTAGCACCTCTTGTTGGGT 59.928 52.381 0.00 0.00 36.07 4.51
1785 1802 2.043227 GGCCTATCTGTAGCACCTCTT 58.957 52.381 0.00 0.00 0.00 2.85
1796 1813 0.469917 AATCGGTGTGGGCCTATCTG 59.530 55.000 4.53 0.00 0.00 2.90
1800 1817 3.578978 TCTAATAATCGGTGTGGGCCTA 58.421 45.455 4.53 0.00 0.00 3.93
1801 1818 2.404559 TCTAATAATCGGTGTGGGCCT 58.595 47.619 4.53 0.00 0.00 5.19
1809 1826 6.932400 TGATTGCCGTAAATCTAATAATCGGT 59.068 34.615 8.31 0.00 37.44 4.69
1810 1827 7.095397 TGTGATTGCCGTAAATCTAATAATCGG 60.095 37.037 8.31 0.00 37.44 4.18
1811 1828 7.740346 GTGTGATTGCCGTAAATCTAATAATCG 59.260 37.037 8.31 0.00 37.44 3.34
1812 1829 8.015658 GGTGTGATTGCCGTAAATCTAATAATC 58.984 37.037 8.31 0.00 37.44 1.75
1813 1830 7.040686 GGGTGTGATTGCCGTAAATCTAATAAT 60.041 37.037 8.31 0.00 37.44 1.28
1814 1831 6.261381 GGGTGTGATTGCCGTAAATCTAATAA 59.739 38.462 8.31 0.00 37.44 1.40
1815 1832 5.761234 GGGTGTGATTGCCGTAAATCTAATA 59.239 40.000 8.31 0.00 37.44 0.98
1816 1833 4.578928 GGGTGTGATTGCCGTAAATCTAAT 59.421 41.667 8.31 0.00 37.44 1.73
1817 1834 3.942748 GGGTGTGATTGCCGTAAATCTAA 59.057 43.478 8.31 0.00 37.44 2.10
1818 1835 3.055021 TGGGTGTGATTGCCGTAAATCTA 60.055 43.478 8.31 0.00 37.44 1.98
1819