Multiple sequence alignment - TraesCS5B01G560000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G560000 chr5B 100.000 3258 0 0 1 3258 706491689 706488432 0.000000e+00 6017.0
1 TraesCS5B01G560000 chr5B 82.243 535 68 16 1040 1572 706424703 706425212 1.390000e-118 436.0
2 TraesCS5B01G560000 chr5B 87.742 155 19 0 1654 1808 706023803 706023957 7.180000e-42 182.0
3 TraesCS5B01G560000 chr5B 74.878 410 84 14 1655 2053 706685303 706684902 5.590000e-38 169.0
4 TraesCS5B01G560000 chr5B 100.000 61 0 0 3198 3258 97490297 97490237 2.660000e-21 113.0
5 TraesCS5B01G560000 chr5B 97.872 47 1 0 736 782 384570517 384570471 7.490000e-12 82.4
6 TraesCS5B01G560000 chr2B 90.637 502 37 2 1 495 19071626 19071128 0.000000e+00 658.0
7 TraesCS5B01G560000 chr2B 86.000 500 55 7 1 494 598579892 598580382 3.730000e-144 521.0
8 TraesCS5B01G560000 chr6B 90.524 496 44 2 1 496 671097194 671096702 0.000000e+00 652.0
9 TraesCS5B01G560000 chr6B 85.800 500 56 7 1 494 432362703 432362213 1.730000e-142 516.0
10 TraesCS5B01G560000 chr6B 97.619 42 1 0 733 774 138643858 138643899 4.510000e-09 73.1
11 TraesCS5B01G560000 chr6A 92.325 443 31 2 41 483 27175532 27175093 7.670000e-176 627.0
12 TraesCS5B01G560000 chr6A 100.000 43 0 0 3 45 27178226 27178184 2.690000e-11 80.5
13 TraesCS5B01G560000 chr7B 87.810 484 45 8 1 483 741669702 741669232 3.670000e-154 555.0
14 TraesCS5B01G560000 chr7B 95.349 129 5 1 558 685 304122739 304122867 1.530000e-48 204.0
15 TraesCS5B01G560000 chr7B 98.361 61 1 0 3198 3258 21622444 21622504 1.240000e-19 108.0
16 TraesCS5B01G560000 chr7B 96.078 51 0 2 733 783 539323432 539323384 7.490000e-12 82.4
17 TraesCS5B01G560000 chr4B 87.397 484 47 8 1 483 638534292 638534762 7.950000e-151 544.0
18 TraesCS5B01G560000 chr4B 93.750 64 4 0 3194 3257 432854369 432854306 2.680000e-16 97.1
19 TraesCS5B01G560000 chr1B 86.912 489 53 6 1 483 118137170 118136687 3.700000e-149 538.0
20 TraesCS5B01G560000 chr1B 98.361 61 1 0 3198 3258 223165341 223165281 1.240000e-19 108.0
21 TraesCS5B01G560000 chr7A 87.238 478 52 4 1 472 96095716 96095242 1.330000e-148 536.0
22 TraesCS5B01G560000 chr7A 94.574 129 6 1 558 685 374561222 374561350 7.130000e-47 198.0
23 TraesCS5B01G560000 chr4A 86.885 244 29 3 1037 1279 608260103 608260344 1.490000e-68 270.0
24 TraesCS5B01G560000 chr4A 95.385 65 3 0 3194 3258 5060657 5060593 1.600000e-18 104.0
25 TraesCS5B01G560000 chr4A 92.308 65 5 0 2179 2243 608384434 608384498 3.460000e-15 93.5
26 TraesCS5B01G560000 chr2A 96.774 155 5 0 531 685 17487884 17487730 3.220000e-65 259.0
27 TraesCS5B01G560000 chr7D 95.349 129 5 1 558 685 330809731 330809603 1.530000e-48 204.0
28 TraesCS5B01G560000 chr5D 75.366 410 76 17 1655 2053 564122612 564122217 1.200000e-39 174.0
29 TraesCS5B01G560000 chr3B 98.438 64 0 1 3193 3255 595623723 595623786 9.560000e-21 111.0
30 TraesCS5B01G560000 chr3B 95.455 66 3 0 3193 3258 596347035 596346970 4.450000e-19 106.0
31 TraesCS5B01G560000 chr3B 94.444 54 2 1 733 786 481626796 481626848 7.490000e-12 82.4
32 TraesCS5B01G560000 chr3B 91.379 58 3 2 733 789 422206569 422206625 9.690000e-11 78.7
33 TraesCS5B01G560000 chr3A 96.923 65 2 0 3194 3258 567652884 567652948 3.440000e-20 110.0
34 TraesCS5B01G560000 chr3A 96.078 51 0 2 733 783 468726760 468726808 7.490000e-12 82.4
35 TraesCS5B01G560000 chr3A 92.727 55 3 1 733 786 154641413 154641359 9.690000e-11 78.7
36 TraesCS5B01G560000 chr1A 90.667 75 4 3 3186 3258 494429397 494429324 2.680000e-16 97.1
37 TraesCS5B01G560000 chr5A 98.039 51 0 1 733 783 68933041 68933090 1.610000e-13 87.9
38 TraesCS5B01G560000 chr4D 92.727 55 2 2 733 787 58389290 58389238 9.690000e-11 78.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G560000 chr5B 706488432 706491689 3257 True 6017.00 6017 100.0000 1 3258 1 chr5B.!!$R3 3257
1 TraesCS5B01G560000 chr5B 706424703 706425212 509 False 436.00 436 82.2430 1040 1572 1 chr5B.!!$F2 532
2 TraesCS5B01G560000 chr6A 27175093 27178226 3133 True 353.75 627 96.1625 3 483 2 chr6A.!!$R1 480


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
767 3424 0.032813 AGTATTTCCGGACGGAGGGA 60.033 55.0 13.64 4.95 46.06 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2333 4990 0.032815 TCGACATCCAAAGCGTGACA 59.967 50.0 0.0 0.0 0.0 3.58 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 2714 2.808206 GGCGACCGGGATTGAGGAT 61.808 63.158 6.32 0.00 0.00 3.24
93 2750 1.153745 CGAGGGCGAGAGTTGAAGG 60.154 63.158 0.00 0.00 40.82 3.46
110 2767 1.275666 AGGACCATGAACATGTCGGA 58.724 50.000 12.74 0.00 37.11 4.55
115 2772 2.237143 ACCATGAACATGTCGGACTGAT 59.763 45.455 9.88 0.39 37.11 2.90
116 2773 2.610833 CCATGAACATGTCGGACTGATG 59.389 50.000 9.88 8.16 37.11 3.07
117 2774 3.524541 CATGAACATGTCGGACTGATGA 58.475 45.455 13.52 0.00 34.23 2.92
118 2775 2.959516 TGAACATGTCGGACTGATGAC 58.040 47.619 13.52 8.52 35.67 3.06
119 2776 2.271800 GAACATGTCGGACTGATGACC 58.728 52.381 13.52 3.51 34.18 4.02
172 2829 3.937778 TGAGGCAATCAATCTCCATGA 57.062 42.857 0.00 0.00 34.02 3.07
199 2856 2.287788 CGCTCAATTTTGACAGCAAGGT 60.288 45.455 5.67 0.00 35.04 3.50
226 2883 3.305064 GCCTGAGTTTTTGTGGCGAAATA 60.305 43.478 0.00 0.00 33.96 1.40
266 2923 1.680249 GGCAGACCAAACCTGATCCTC 60.680 57.143 0.00 0.00 33.65 3.71
280 2937 0.748005 ATCCTCAAAATCCGCACCCG 60.748 55.000 0.00 0.00 0.00 5.28
325 2982 2.892425 GAACGGCAGCCTGGATCG 60.892 66.667 10.54 0.00 0.00 3.69
326 2983 3.665675 GAACGGCAGCCTGGATCGT 62.666 63.158 10.54 0.00 35.48 3.73
334 2991 1.959985 CAGCCTGGATCGTAGAGTCAT 59.040 52.381 0.00 0.00 43.63 3.06
348 3005 0.835941 AGTCATCCAGCCAGATGTCC 59.164 55.000 12.03 5.93 43.46 4.02
393 3050 1.228925 GGCTACGGGGAGGCTAGAT 60.229 63.158 0.00 0.00 38.91 1.98
404 3061 2.334023 GAGGCTAGATGGAGTTGGGAT 58.666 52.381 0.00 0.00 0.00 3.85
413 3070 1.203300 TGGAGTTGGGATCAGAGGTGA 60.203 52.381 0.00 0.00 37.02 4.02
447 3104 2.203938 GGTGGTGGAGGTGGAGGA 60.204 66.667 0.00 0.00 0.00 3.71
499 3156 3.947173 CGAGAGCCATCCTGGACT 58.053 61.111 0.00 0.00 40.96 3.85
500 3157 1.440893 CGAGAGCCATCCTGGACTG 59.559 63.158 0.00 0.00 40.96 3.51
501 3158 1.039785 CGAGAGCCATCCTGGACTGA 61.040 60.000 0.00 0.00 40.96 3.41
502 3159 0.752054 GAGAGCCATCCTGGACTGAG 59.248 60.000 0.00 0.00 40.96 3.35
503 3160 0.690411 AGAGCCATCCTGGACTGAGG 60.690 60.000 0.00 0.00 40.96 3.86
504 3161 0.689080 GAGCCATCCTGGACTGAGGA 60.689 60.000 0.00 0.00 46.47 3.71
510 3167 2.325661 TCCTGGACTGAGGATTGTGA 57.674 50.000 0.00 0.00 37.20 3.58
511 3168 2.182827 TCCTGGACTGAGGATTGTGAG 58.817 52.381 0.00 0.00 37.20 3.51
512 3169 1.209019 CCTGGACTGAGGATTGTGAGG 59.791 57.143 0.00 0.00 34.69 3.86
513 3170 0.615331 TGGACTGAGGATTGTGAGGC 59.385 55.000 0.00 0.00 0.00 4.70
514 3171 0.107459 GGACTGAGGATTGTGAGGCC 60.107 60.000 0.00 0.00 0.00 5.19
515 3172 0.908198 GACTGAGGATTGTGAGGCCT 59.092 55.000 3.86 3.86 33.97 5.19
516 3173 0.908198 ACTGAGGATTGTGAGGCCTC 59.092 55.000 26.78 26.78 46.60 4.70
517 3174 0.179936 CTGAGGATTGTGAGGCCTCC 59.820 60.000 29.95 20.55 46.01 4.30
518 3175 0.547471 TGAGGATTGTGAGGCCTCCA 60.547 55.000 29.95 22.85 46.01 3.86
519 3176 0.620556 GAGGATTGTGAGGCCTCCAA 59.379 55.000 29.95 28.82 41.84 3.53
520 3177 0.622665 AGGATTGTGAGGCCTCCAAG 59.377 55.000 29.95 0.00 0.00 3.61
521 3178 1.034292 GGATTGTGAGGCCTCCAAGC 61.034 60.000 29.26 29.26 0.00 4.01
528 3185 2.034221 GGCCTCCAAGCCGACTTT 59.966 61.111 0.00 0.00 44.57 2.66
529 3186 2.041115 GGCCTCCAAGCCGACTTTC 61.041 63.158 0.00 0.00 44.57 2.62
530 3187 2.391389 GCCTCCAAGCCGACTTTCG 61.391 63.158 0.00 0.00 40.07 3.46
531 3188 1.292223 CCTCCAAGCCGACTTTCGA 59.708 57.895 0.00 0.00 43.74 3.71
532 3189 0.737715 CCTCCAAGCCGACTTTCGAG 60.738 60.000 0.00 0.00 43.74 4.04
533 3190 0.737715 CTCCAAGCCGACTTTCGAGG 60.738 60.000 0.00 0.00 43.74 4.63
534 3191 1.741770 CCAAGCCGACTTTCGAGGG 60.742 63.158 0.00 0.00 43.74 4.30
535 3192 1.741770 CAAGCCGACTTTCGAGGGG 60.742 63.158 0.00 0.00 43.74 4.79
536 3193 3.607370 AAGCCGACTTTCGAGGGGC 62.607 63.158 0.00 6.26 43.74 5.80
537 3194 4.083862 GCCGACTTTCGAGGGGCT 62.084 66.667 0.00 0.00 43.74 5.19
538 3195 2.125512 CCGACTTTCGAGGGGCTG 60.126 66.667 0.00 0.00 43.74 4.85
539 3196 2.815647 CGACTTTCGAGGGGCTGC 60.816 66.667 0.00 0.00 43.74 5.25
540 3197 2.815647 GACTTTCGAGGGGCTGCG 60.816 66.667 0.00 0.00 0.00 5.18
541 3198 3.296709 GACTTTCGAGGGGCTGCGA 62.297 63.158 0.00 0.00 34.32 5.10
542 3199 2.187946 CTTTCGAGGGGCTGCGAT 59.812 61.111 0.00 0.00 36.31 4.58
543 3200 1.450312 CTTTCGAGGGGCTGCGATT 60.450 57.895 0.00 0.00 36.31 3.34
544 3201 1.002624 TTTCGAGGGGCTGCGATTT 60.003 52.632 0.00 0.00 36.31 2.17
545 3202 1.305219 TTTCGAGGGGCTGCGATTTG 61.305 55.000 0.00 0.00 36.31 2.32
546 3203 3.204827 CGAGGGGCTGCGATTTGG 61.205 66.667 0.00 0.00 0.00 3.28
547 3204 2.044946 GAGGGGCTGCGATTTGGT 60.045 61.111 0.00 0.00 0.00 3.67
548 3205 2.361610 AGGGGCTGCGATTTGGTG 60.362 61.111 0.00 0.00 0.00 4.17
549 3206 2.676471 GGGGCTGCGATTTGGTGT 60.676 61.111 0.00 0.00 0.00 4.16
550 3207 2.275380 GGGGCTGCGATTTGGTGTT 61.275 57.895 0.00 0.00 0.00 3.32
551 3208 0.963355 GGGGCTGCGATTTGGTGTTA 60.963 55.000 0.00 0.00 0.00 2.41
552 3209 0.451783 GGGCTGCGATTTGGTGTTAG 59.548 55.000 0.00 0.00 0.00 2.34
553 3210 0.451783 GGCTGCGATTTGGTGTTAGG 59.548 55.000 0.00 0.00 0.00 2.69
554 3211 0.179163 GCTGCGATTTGGTGTTAGGC 60.179 55.000 0.00 0.00 0.00 3.93
555 3212 1.164411 CTGCGATTTGGTGTTAGGCA 58.836 50.000 0.00 0.00 0.00 4.75
556 3213 1.539388 CTGCGATTTGGTGTTAGGCAA 59.461 47.619 0.00 0.00 0.00 4.52
557 3214 1.957177 TGCGATTTGGTGTTAGGCAAA 59.043 42.857 0.00 0.00 0.00 3.68
558 3215 2.030363 TGCGATTTGGTGTTAGGCAAAG 60.030 45.455 0.00 0.00 0.00 2.77
559 3216 2.595386 CGATTTGGTGTTAGGCAAAGC 58.405 47.619 0.00 0.00 0.00 3.51
560 3217 2.030363 CGATTTGGTGTTAGGCAAAGCA 60.030 45.455 0.00 0.00 0.00 3.91
561 3218 3.367292 CGATTTGGTGTTAGGCAAAGCAT 60.367 43.478 0.00 0.00 0.00 3.79
562 3219 4.142491 CGATTTGGTGTTAGGCAAAGCATA 60.142 41.667 0.00 0.00 0.00 3.14
563 3220 4.513198 TTTGGTGTTAGGCAAAGCATAC 57.487 40.909 0.00 0.00 0.00 2.39
564 3221 3.147553 TGGTGTTAGGCAAAGCATACA 57.852 42.857 0.00 0.00 0.00 2.29
565 3222 3.696045 TGGTGTTAGGCAAAGCATACAT 58.304 40.909 0.00 0.00 0.00 2.29
566 3223 3.694072 TGGTGTTAGGCAAAGCATACATC 59.306 43.478 0.00 0.00 0.00 3.06
567 3224 3.066760 GGTGTTAGGCAAAGCATACATCC 59.933 47.826 0.00 0.00 0.00 3.51
568 3225 3.066760 GTGTTAGGCAAAGCATACATCCC 59.933 47.826 0.00 0.00 0.00 3.85
569 3226 2.623416 GTTAGGCAAAGCATACATCCCC 59.377 50.000 0.00 0.00 0.00 4.81
570 3227 0.929244 AGGCAAAGCATACATCCCCT 59.071 50.000 0.00 0.00 0.00 4.79
571 3228 1.035139 GGCAAAGCATACATCCCCTG 58.965 55.000 0.00 0.00 0.00 4.45
572 3229 1.035139 GCAAAGCATACATCCCCTGG 58.965 55.000 0.00 0.00 0.00 4.45
573 3230 1.410083 GCAAAGCATACATCCCCTGGA 60.410 52.381 0.00 0.00 35.55 3.86
574 3231 2.949963 GCAAAGCATACATCCCCTGGAA 60.950 50.000 0.00 0.00 34.34 3.53
575 3232 3.569491 CAAAGCATACATCCCCTGGAAT 58.431 45.455 0.00 0.00 34.34 3.01
576 3233 3.515602 AAGCATACATCCCCTGGAATC 57.484 47.619 0.00 0.00 34.34 2.52
577 3234 2.711174 AGCATACATCCCCTGGAATCT 58.289 47.619 0.00 0.00 34.34 2.40
578 3235 3.059097 AGCATACATCCCCTGGAATCTT 58.941 45.455 0.00 0.00 34.34 2.40
579 3236 4.242811 AGCATACATCCCCTGGAATCTTA 58.757 43.478 0.00 0.00 34.34 2.10
580 3237 4.288105 AGCATACATCCCCTGGAATCTTAG 59.712 45.833 0.00 0.00 34.34 2.18
581 3238 4.287067 GCATACATCCCCTGGAATCTTAGA 59.713 45.833 0.00 0.00 34.34 2.10
582 3239 5.221925 GCATACATCCCCTGGAATCTTAGAA 60.222 44.000 0.00 0.00 34.34 2.10
583 3240 6.523150 GCATACATCCCCTGGAATCTTAGAAT 60.523 42.308 0.00 0.00 34.34 2.40
584 3241 5.316158 ACATCCCCTGGAATCTTAGAATG 57.684 43.478 0.00 0.00 34.34 2.67
585 3242 4.977739 ACATCCCCTGGAATCTTAGAATGA 59.022 41.667 0.00 0.00 34.34 2.57
586 3243 5.433051 ACATCCCCTGGAATCTTAGAATGAA 59.567 40.000 0.00 0.00 34.34 2.57
587 3244 6.068853 ACATCCCCTGGAATCTTAGAATGAAA 60.069 38.462 0.00 0.00 34.34 2.69
588 3245 6.596869 TCCCCTGGAATCTTAGAATGAAAT 57.403 37.500 0.00 0.00 0.00 2.17
589 3246 6.605119 TCCCCTGGAATCTTAGAATGAAATC 58.395 40.000 0.00 0.00 0.00 2.17
590 3247 5.772169 CCCCTGGAATCTTAGAATGAAATCC 59.228 44.000 0.00 0.00 0.00 3.01
591 3248 6.367983 CCCTGGAATCTTAGAATGAAATCCA 58.632 40.000 0.00 0.00 0.00 3.41
592 3249 7.008941 CCCTGGAATCTTAGAATGAAATCCAT 58.991 38.462 0.00 0.00 36.99 3.41
593 3250 7.176340 CCCTGGAATCTTAGAATGAAATCCATC 59.824 40.741 0.00 0.00 33.53 3.51
594 3251 7.094890 CCTGGAATCTTAGAATGAAATCCATCG 60.095 40.741 0.00 0.00 33.53 3.84
595 3252 7.282585 TGGAATCTTAGAATGAAATCCATCGT 58.717 34.615 0.00 0.00 33.53 3.73
596 3253 7.442364 TGGAATCTTAGAATGAAATCCATCGTC 59.558 37.037 0.00 0.00 33.53 4.20
597 3254 7.359598 GGAATCTTAGAATGAAATCCATCGTCG 60.360 40.741 0.00 0.00 33.53 5.12
598 3255 6.144078 TCTTAGAATGAAATCCATCGTCGA 57.856 37.500 0.00 0.00 33.53 4.20
599 3256 6.749139 TCTTAGAATGAAATCCATCGTCGAT 58.251 36.000 0.75 0.75 33.53 3.59
600 3257 7.210174 TCTTAGAATGAAATCCATCGTCGATT 58.790 34.615 4.63 0.00 33.53 3.34
601 3258 5.914085 AGAATGAAATCCATCGTCGATTC 57.086 39.130 4.63 1.73 33.53 2.52
602 3259 4.445718 AGAATGAAATCCATCGTCGATTCG 59.554 41.667 4.63 0.00 33.53 3.34
603 3260 1.858458 TGAAATCCATCGTCGATTCGC 59.142 47.619 4.63 0.00 0.00 4.70
604 3261 0.852777 AAATCCATCGTCGATTCGCG 59.147 50.000 4.63 0.00 42.69 5.87
605 3262 0.939577 AATCCATCGTCGATTCGCGG 60.940 55.000 6.13 3.96 41.33 6.46
606 3263 2.749110 ATCCATCGTCGATTCGCGGG 62.749 60.000 6.13 3.56 41.33 6.13
607 3264 3.692367 CATCGTCGATTCGCGGGC 61.692 66.667 6.13 0.00 41.33 6.13
608 3265 4.201679 ATCGTCGATTCGCGGGCA 62.202 61.111 6.13 0.00 41.33 5.36
609 3266 4.847516 TCGTCGATTCGCGGGCAG 62.848 66.667 6.13 0.00 41.33 4.85
614 3271 3.439540 GATTCGCGGGCAGCCAAA 61.440 61.111 15.19 1.81 44.76 3.28
615 3272 3.683587 GATTCGCGGGCAGCCAAAC 62.684 63.158 15.19 0.00 44.76 2.93
620 3277 2.047655 CGGGCAGCCAAACGAGTA 60.048 61.111 15.19 0.00 0.00 2.59
621 3278 2.100631 CGGGCAGCCAAACGAGTAG 61.101 63.158 15.19 0.00 0.00 2.57
622 3279 1.295423 GGGCAGCCAAACGAGTAGA 59.705 57.895 15.19 0.00 0.00 2.59
623 3280 0.107654 GGGCAGCCAAACGAGTAGAT 60.108 55.000 15.19 0.00 0.00 1.98
624 3281 1.138266 GGGCAGCCAAACGAGTAGATA 59.862 52.381 15.19 0.00 0.00 1.98
625 3282 2.224305 GGGCAGCCAAACGAGTAGATAT 60.224 50.000 15.19 0.00 0.00 1.63
626 3283 3.467803 GGCAGCCAAACGAGTAGATATT 58.532 45.455 6.55 0.00 0.00 1.28
627 3284 3.248602 GGCAGCCAAACGAGTAGATATTG 59.751 47.826 6.55 0.00 0.00 1.90
628 3285 3.248602 GCAGCCAAACGAGTAGATATTGG 59.751 47.826 0.00 0.00 42.68 3.16
629 3286 4.693283 CAGCCAAACGAGTAGATATTGGA 58.307 43.478 7.01 0.00 42.46 3.53
630 3287 5.300752 CAGCCAAACGAGTAGATATTGGAT 58.699 41.667 7.01 0.00 42.46 3.41
631 3288 5.760253 CAGCCAAACGAGTAGATATTGGATT 59.240 40.000 7.01 0.00 42.46 3.01
632 3289 6.260936 CAGCCAAACGAGTAGATATTGGATTT 59.739 38.462 7.01 0.00 42.46 2.17
633 3290 6.483640 AGCCAAACGAGTAGATATTGGATTTC 59.516 38.462 7.01 0.00 42.46 2.17
634 3291 6.564125 GCCAAACGAGTAGATATTGGATTTCG 60.564 42.308 7.01 0.00 42.46 3.46
635 3292 6.355638 CAAACGAGTAGATATTGGATTTCGC 58.644 40.000 0.00 0.00 0.00 4.70
636 3293 5.196341 ACGAGTAGATATTGGATTTCGCA 57.804 39.130 0.00 0.00 0.00 5.10
637 3294 5.597806 ACGAGTAGATATTGGATTTCGCAA 58.402 37.500 0.00 0.00 0.00 4.85
638 3295 6.046593 ACGAGTAGATATTGGATTTCGCAAA 58.953 36.000 0.00 0.00 0.00 3.68
639 3296 6.706270 ACGAGTAGATATTGGATTTCGCAAAT 59.294 34.615 0.00 0.00 0.00 2.32
640 3297 7.011773 CGAGTAGATATTGGATTTCGCAAATG 58.988 38.462 0.00 0.00 0.00 2.32
641 3298 7.095649 CGAGTAGATATTGGATTTCGCAAATGA 60.096 37.037 0.00 0.00 0.00 2.57
642 3299 8.450578 AGTAGATATTGGATTTCGCAAATGAA 57.549 30.769 0.00 0.00 0.00 2.57
643 3300 8.902806 AGTAGATATTGGATTTCGCAAATGAAA 58.097 29.630 0.00 0.00 41.69 2.69
651 3308 4.693538 TTTCGCAAATGAAATCCATCGA 57.306 36.364 0.00 0.00 33.12 3.59
652 3309 4.898829 TTCGCAAATGAAATCCATCGAT 57.101 36.364 0.00 0.00 33.53 3.59
653 3310 4.898829 TCGCAAATGAAATCCATCGATT 57.101 36.364 0.00 0.00 40.58 3.34
654 3311 4.600032 TCGCAAATGAAATCCATCGATTG 58.400 39.130 0.00 0.00 38.75 2.67
655 3312 3.180980 CGCAAATGAAATCCATCGATTGC 59.819 43.478 0.00 0.00 40.49 3.56
656 3313 4.114073 GCAAATGAAATCCATCGATTGCA 58.886 39.130 0.00 0.00 46.16 4.08
657 3314 4.567558 GCAAATGAAATCCATCGATTGCAA 59.432 37.500 0.00 0.00 45.41 4.08
658 3315 5.501252 GCAAATGAAATCCATCGATTGCAAC 60.501 40.000 0.00 0.00 45.41 4.17
659 3316 3.781079 TGAAATCCATCGATTGCAACC 57.219 42.857 0.00 0.00 40.51 3.77
660 3317 2.426738 TGAAATCCATCGATTGCAACCC 59.573 45.455 0.00 0.00 40.51 4.11
661 3318 2.142356 AATCCATCGATTGCAACCCA 57.858 45.000 0.00 0.00 37.33 4.51
662 3319 2.142356 ATCCATCGATTGCAACCCAA 57.858 45.000 0.00 0.00 37.94 4.12
663 3320 1.916506 TCCATCGATTGCAACCCAAA 58.083 45.000 0.00 0.00 36.92 3.28
664 3321 2.455557 TCCATCGATTGCAACCCAAAT 58.544 42.857 0.00 0.00 36.92 2.32
665 3322 2.166050 TCCATCGATTGCAACCCAAATG 59.834 45.455 0.00 1.84 36.92 2.32
666 3323 2.166050 CCATCGATTGCAACCCAAATGA 59.834 45.455 0.00 0.00 36.92 2.57
667 3324 3.181473 CCATCGATTGCAACCCAAATGAT 60.181 43.478 0.00 0.00 36.92 2.45
668 3325 3.507103 TCGATTGCAACCCAAATGATG 57.493 42.857 0.00 0.00 36.92 3.07
686 3343 4.492604 GGTACCAAACAGGCTGCA 57.507 55.556 15.89 0.00 43.14 4.41
687 3344 2.727103 GGTACCAAACAGGCTGCAA 58.273 52.632 15.89 0.00 43.14 4.08
688 3345 0.598065 GGTACCAAACAGGCTGCAAG 59.402 55.000 15.89 3.95 43.14 4.01
689 3346 0.598065 GTACCAAACAGGCTGCAAGG 59.402 55.000 15.89 15.68 43.14 3.61
690 3347 0.539438 TACCAAACAGGCTGCAAGGG 60.539 55.000 15.89 13.51 43.14 3.95
691 3348 1.833934 CCAAACAGGCTGCAAGGGT 60.834 57.895 15.89 0.00 0.00 4.34
692 3349 1.402107 CCAAACAGGCTGCAAGGGTT 61.402 55.000 15.89 0.00 0.00 4.11
693 3350 0.465287 CAAACAGGCTGCAAGGGTTT 59.535 50.000 15.89 3.41 32.33 3.27
694 3351 0.752658 AAACAGGCTGCAAGGGTTTC 59.247 50.000 15.89 0.00 0.00 2.78
695 3352 1.115326 AACAGGCTGCAAGGGTTTCC 61.115 55.000 15.89 0.00 0.00 3.13
696 3353 2.118294 AGGCTGCAAGGGTTTCCC 59.882 61.111 0.50 0.00 45.90 3.97
708 3365 3.292492 GGGTTTCCCTATTGGTGGTAG 57.708 52.381 0.00 0.00 41.34 3.18
709 3366 2.579400 GGGTTTCCCTATTGGTGGTAGT 59.421 50.000 0.00 0.00 41.34 2.73
710 3367 3.010920 GGGTTTCCCTATTGGTGGTAGTT 59.989 47.826 0.00 0.00 41.34 2.24
711 3368 4.227982 GGGTTTCCCTATTGGTGGTAGTTA 59.772 45.833 0.00 0.00 41.34 2.24
712 3369 5.281141 GGGTTTCCCTATTGGTGGTAGTTAA 60.281 44.000 0.00 0.00 41.34 2.01
713 3370 5.649395 GGTTTCCCTATTGGTGGTAGTTAAC 59.351 44.000 0.00 0.00 34.77 2.01
714 3371 6.479006 GTTTCCCTATTGGTGGTAGTTAACT 58.521 40.000 13.68 13.68 34.77 2.24
715 3372 7.311234 GGTTTCCCTATTGGTGGTAGTTAACTA 60.311 40.741 11.38 11.38 34.77 2.24
716 3373 6.796785 TCCCTATTGGTGGTAGTTAACTAC 57.203 41.667 29.86 29.86 40.67 2.73
717 3374 6.505754 TCCCTATTGGTGGTAGTTAACTACT 58.494 40.000 33.70 21.03 40.92 2.57
718 3375 6.608808 TCCCTATTGGTGGTAGTTAACTACTC 59.391 42.308 33.70 27.07 40.92 2.59
719 3376 6.183360 CCCTATTGGTGGTAGTTAACTACTCC 60.183 46.154 33.70 31.94 46.06 3.85
720 3377 6.610425 CCTATTGGTGGTAGTTAACTACTCCT 59.390 42.308 33.26 25.44 46.06 3.69
721 3378 6.947376 ATTGGTGGTAGTTAACTACTCCTT 57.053 37.500 33.26 25.74 46.06 3.36
722 3379 5.990120 TGGTGGTAGTTAACTACTCCTTC 57.010 43.478 33.26 23.91 46.06 3.46
723 3380 4.774200 TGGTGGTAGTTAACTACTCCTTCC 59.226 45.833 33.26 27.91 46.06 3.46
724 3381 4.142293 GGTGGTAGTTAACTACTCCTTCCG 60.142 50.000 33.70 0.00 46.06 4.30
725 3382 4.460731 GTGGTAGTTAACTACTCCTTCCGT 59.539 45.833 33.70 3.69 46.06 4.69
726 3383 4.702131 TGGTAGTTAACTACTCCTTCCGTC 59.298 45.833 33.70 19.85 46.06 4.79
727 3384 4.097135 GGTAGTTAACTACTCCTTCCGTCC 59.903 50.000 33.70 17.06 46.06 4.79
728 3385 3.771216 AGTTAACTACTCCTTCCGTCCA 58.229 45.455 6.26 0.00 28.23 4.02
729 3386 4.351127 AGTTAACTACTCCTTCCGTCCAT 58.649 43.478 6.26 0.00 28.23 3.41
730 3387 4.159879 AGTTAACTACTCCTTCCGTCCATG 59.840 45.833 6.26 0.00 28.23 3.66
731 3388 0.824759 ACTACTCCTTCCGTCCATGC 59.175 55.000 0.00 0.00 0.00 4.06
732 3389 0.824109 CTACTCCTTCCGTCCATGCA 59.176 55.000 0.00 0.00 0.00 3.96
733 3390 1.414181 CTACTCCTTCCGTCCATGCAT 59.586 52.381 0.00 0.00 0.00 3.96
734 3391 0.179000 ACTCCTTCCGTCCATGCATC 59.821 55.000 0.00 0.00 0.00 3.91
735 3392 0.533755 CTCCTTCCGTCCATGCATCC 60.534 60.000 0.00 0.00 0.00 3.51
736 3393 1.224315 CCTTCCGTCCATGCATCCA 59.776 57.895 0.00 0.00 0.00 3.41
737 3394 0.179009 CCTTCCGTCCATGCATCCAT 60.179 55.000 0.00 0.00 0.00 3.41
738 3395 1.683943 CTTCCGTCCATGCATCCATT 58.316 50.000 0.00 0.00 0.00 3.16
739 3396 2.026641 CTTCCGTCCATGCATCCATTT 58.973 47.619 0.00 0.00 0.00 2.32
740 3397 2.142356 TCCGTCCATGCATCCATTTT 57.858 45.000 0.00 0.00 0.00 1.82
741 3398 1.750206 TCCGTCCATGCATCCATTTTG 59.250 47.619 0.00 0.00 0.00 2.44
742 3399 1.750206 CCGTCCATGCATCCATTTTGA 59.250 47.619 0.00 0.00 0.00 2.69
743 3400 2.363038 CCGTCCATGCATCCATTTTGAT 59.637 45.455 0.00 0.00 0.00 2.57
744 3401 3.377439 CGTCCATGCATCCATTTTGATG 58.623 45.455 0.00 0.00 44.02 3.07
745 3402 3.067040 CGTCCATGCATCCATTTTGATGA 59.933 43.478 0.00 0.00 43.94 2.92
746 3403 4.365723 GTCCATGCATCCATTTTGATGAC 58.634 43.478 0.00 0.00 43.94 3.06
747 3404 4.024670 TCCATGCATCCATTTTGATGACA 58.975 39.130 0.00 3.59 43.94 3.58
748 3405 4.466726 TCCATGCATCCATTTTGATGACAA 59.533 37.500 0.00 0.00 43.94 3.18
749 3406 4.808895 CCATGCATCCATTTTGATGACAAG 59.191 41.667 0.00 1.07 43.94 3.16
750 3407 5.416083 CATGCATCCATTTTGATGACAAGT 58.584 37.500 0.00 0.00 43.94 3.16
751 3408 6.406065 CCATGCATCCATTTTGATGACAAGTA 60.406 38.462 0.00 0.00 43.94 2.24
752 3409 6.778834 TGCATCCATTTTGATGACAAGTAT 57.221 33.333 5.26 0.00 43.94 2.12
753 3410 7.172868 TGCATCCATTTTGATGACAAGTATT 57.827 32.000 5.26 0.00 43.94 1.89
754 3411 7.613585 TGCATCCATTTTGATGACAAGTATTT 58.386 30.769 5.26 0.00 43.94 1.40
755 3412 7.760794 TGCATCCATTTTGATGACAAGTATTTC 59.239 33.333 5.26 0.00 43.94 2.17
756 3413 7.223387 GCATCCATTTTGATGACAAGTATTTCC 59.777 37.037 5.26 0.00 43.94 3.13
757 3414 6.851609 TCCATTTTGATGACAAGTATTTCCG 58.148 36.000 0.00 0.00 37.32 4.30
758 3415 6.035843 CCATTTTGATGACAAGTATTTCCGG 58.964 40.000 0.00 0.00 37.32 5.14
759 3416 6.127758 CCATTTTGATGACAAGTATTTCCGGA 60.128 38.462 0.00 0.00 37.32 5.14
760 3417 5.873179 TTTGATGACAAGTATTTCCGGAC 57.127 39.130 1.83 0.00 37.32 4.79
761 3418 3.517602 TGATGACAAGTATTTCCGGACG 58.482 45.455 1.83 0.00 0.00 4.79
762 3419 2.373540 TGACAAGTATTTCCGGACGG 57.626 50.000 1.83 3.96 0.00 4.79
763 3420 1.894466 TGACAAGTATTTCCGGACGGA 59.106 47.619 1.83 9.76 43.52 4.69
764 3421 2.094390 TGACAAGTATTTCCGGACGGAG 60.094 50.000 13.64 3.15 46.06 4.63
765 3422 1.206371 ACAAGTATTTCCGGACGGAGG 59.794 52.381 13.64 0.00 46.06 4.30
766 3423 0.828677 AAGTATTTCCGGACGGAGGG 59.171 55.000 13.64 0.00 46.06 4.30
767 3424 0.032813 AGTATTTCCGGACGGAGGGA 60.033 55.000 13.64 4.95 46.06 4.20
768 3425 0.388294 GTATTTCCGGACGGAGGGAG 59.612 60.000 13.64 0.00 46.06 4.30
769 3426 0.032813 TATTTCCGGACGGAGGGAGT 60.033 55.000 13.64 0.00 46.06 3.85
770 3427 0.032813 ATTTCCGGACGGAGGGAGTA 60.033 55.000 13.64 0.00 46.06 2.59
771 3428 0.032813 TTTCCGGACGGAGGGAGTAT 60.033 55.000 13.64 0.00 46.06 2.12
772 3429 0.754217 TTCCGGACGGAGGGAGTATG 60.754 60.000 13.64 0.00 46.06 2.39
773 3430 1.455217 CCGGACGGAGGGAGTATGT 60.455 63.158 4.40 0.00 37.50 2.29
774 3431 0.179009 CCGGACGGAGGGAGTATGTA 60.179 60.000 4.40 0.00 37.50 2.29
775 3432 1.236628 CGGACGGAGGGAGTATGTAG 58.763 60.000 0.00 0.00 0.00 2.74
776 3433 1.476471 CGGACGGAGGGAGTATGTAGT 60.476 57.143 0.00 0.00 0.00 2.73
777 3434 2.664015 GGACGGAGGGAGTATGTAGTT 58.336 52.381 0.00 0.00 0.00 2.24
778 3435 3.745480 CGGACGGAGGGAGTATGTAGTTA 60.745 52.174 0.00 0.00 0.00 2.24
779 3436 4.405548 GGACGGAGGGAGTATGTAGTTAT 58.594 47.826 0.00 0.00 0.00 1.89
780 3437 4.217983 GGACGGAGGGAGTATGTAGTTATG 59.782 50.000 0.00 0.00 0.00 1.90
781 3438 4.801164 ACGGAGGGAGTATGTAGTTATGT 58.199 43.478 0.00 0.00 0.00 2.29
782 3439 5.945310 ACGGAGGGAGTATGTAGTTATGTA 58.055 41.667 0.00 0.00 0.00 2.29
783 3440 6.002704 ACGGAGGGAGTATGTAGTTATGTAG 58.997 44.000 0.00 0.00 0.00 2.74
784 3441 6.183361 ACGGAGGGAGTATGTAGTTATGTAGA 60.183 42.308 0.00 0.00 0.00 2.59
785 3442 6.713903 CGGAGGGAGTATGTAGTTATGTAGAA 59.286 42.308 0.00 0.00 0.00 2.10
786 3443 7.230108 CGGAGGGAGTATGTAGTTATGTAGAAA 59.770 40.741 0.00 0.00 0.00 2.52
787 3444 8.921205 GGAGGGAGTATGTAGTTATGTAGAAAA 58.079 37.037 0.00 0.00 0.00 2.29
788 3445 9.747293 GAGGGAGTATGTAGTTATGTAGAAAAC 57.253 37.037 0.00 0.00 0.00 2.43
789 3446 8.411683 AGGGAGTATGTAGTTATGTAGAAAACG 58.588 37.037 0.00 0.00 0.00 3.60
790 3447 8.408601 GGGAGTATGTAGTTATGTAGAAAACGA 58.591 37.037 0.00 0.00 0.00 3.85
791 3448 9.230932 GGAGTATGTAGTTATGTAGAAAACGAC 57.769 37.037 0.00 0.00 33.46 4.34
792 3449 8.832487 AGTATGTAGTTATGTAGAAAACGACG 57.168 34.615 0.00 0.00 34.96 5.12
793 3450 8.668353 AGTATGTAGTTATGTAGAAAACGACGA 58.332 33.333 0.00 0.00 34.96 4.20
794 3451 7.731556 ATGTAGTTATGTAGAAAACGACGAC 57.268 36.000 0.00 0.00 34.96 4.34
795 3452 5.790003 TGTAGTTATGTAGAAAACGACGACG 59.210 40.000 5.58 5.58 45.75 5.12
805 3462 3.767230 CGACGACGTGCTGCCTTG 61.767 66.667 4.58 0.00 34.56 3.61
806 3463 2.355837 GACGACGTGCTGCCTTGA 60.356 61.111 4.58 0.00 0.00 3.02
807 3464 1.954146 GACGACGTGCTGCCTTGAA 60.954 57.895 4.58 0.00 0.00 2.69
808 3465 1.291877 GACGACGTGCTGCCTTGAAT 61.292 55.000 4.58 0.00 0.00 2.57
809 3466 0.884704 ACGACGTGCTGCCTTGAATT 60.885 50.000 0.00 0.00 0.00 2.17
810 3467 0.238289 CGACGTGCTGCCTTGAATTT 59.762 50.000 0.00 0.00 0.00 1.82
811 3468 1.689959 GACGTGCTGCCTTGAATTTG 58.310 50.000 0.00 0.00 0.00 2.32
812 3469 1.266718 GACGTGCTGCCTTGAATTTGA 59.733 47.619 0.00 0.00 0.00 2.69
813 3470 1.680735 ACGTGCTGCCTTGAATTTGAA 59.319 42.857 0.00 0.00 0.00 2.69
814 3471 2.100584 ACGTGCTGCCTTGAATTTGAAA 59.899 40.909 0.00 0.00 0.00 2.69
815 3472 3.243839 ACGTGCTGCCTTGAATTTGAAAT 60.244 39.130 0.00 0.00 0.00 2.17
816 3473 4.022416 ACGTGCTGCCTTGAATTTGAAATA 60.022 37.500 0.00 0.00 0.00 1.40
817 3474 4.324402 CGTGCTGCCTTGAATTTGAAATAC 59.676 41.667 0.00 0.00 0.00 1.89
818 3475 5.473039 GTGCTGCCTTGAATTTGAAATACT 58.527 37.500 0.00 0.00 0.00 2.12
819 3476 6.620678 GTGCTGCCTTGAATTTGAAATACTA 58.379 36.000 0.00 0.00 0.00 1.82
820 3477 6.528072 GTGCTGCCTTGAATTTGAAATACTAC 59.472 38.462 0.00 0.00 0.00 2.73
821 3478 5.739161 GCTGCCTTGAATTTGAAATACTACG 59.261 40.000 0.00 0.00 0.00 3.51
822 3479 6.622896 GCTGCCTTGAATTTGAAATACTACGT 60.623 38.462 0.00 0.00 0.00 3.57
823 3480 7.209471 TGCCTTGAATTTGAAATACTACGTT 57.791 32.000 0.00 0.00 0.00 3.99
824 3481 7.653647 TGCCTTGAATTTGAAATACTACGTTT 58.346 30.769 0.00 0.00 0.00 3.60
825 3482 8.138712 TGCCTTGAATTTGAAATACTACGTTTT 58.861 29.630 0.00 0.00 0.00 2.43
826 3483 8.974408 GCCTTGAATTTGAAATACTACGTTTTT 58.026 29.630 0.00 0.00 0.00 1.94
865 3522 9.929180 TTCCCTCTTTATATACGATTCAATCAG 57.071 33.333 0.00 0.00 0.00 2.90
866 3523 8.035394 TCCCTCTTTATATACGATTCAATCAGC 58.965 37.037 0.00 0.00 0.00 4.26
867 3524 7.009631 CCCTCTTTATATACGATTCAATCAGCG 59.990 40.741 0.00 0.00 0.00 5.18
868 3525 7.542477 CCTCTTTATATACGATTCAATCAGCGT 59.458 37.037 0.00 0.00 40.42 5.07
869 3526 8.449085 TCTTTATATACGATTCAATCAGCGTC 57.551 34.615 0.00 0.00 38.09 5.19
870 3527 8.079809 TCTTTATATACGATTCAATCAGCGTCA 58.920 33.333 0.00 0.00 38.09 4.35
871 3528 7.562640 TTATATACGATTCAATCAGCGTCAC 57.437 36.000 0.00 0.00 38.09 3.67
872 3529 2.078849 ACGATTCAATCAGCGTCACA 57.921 45.000 0.00 0.00 30.15 3.58
873 3530 2.621338 ACGATTCAATCAGCGTCACAT 58.379 42.857 0.00 0.00 30.15 3.21
874 3531 2.604914 ACGATTCAATCAGCGTCACATC 59.395 45.455 0.00 0.00 30.15 3.06
875 3532 2.604462 CGATTCAATCAGCGTCACATCA 59.396 45.455 0.00 0.00 0.00 3.07
876 3533 3.542875 CGATTCAATCAGCGTCACATCAC 60.543 47.826 0.00 0.00 0.00 3.06
877 3534 2.749280 TCAATCAGCGTCACATCACT 57.251 45.000 0.00 0.00 0.00 3.41
878 3535 3.044235 TCAATCAGCGTCACATCACTT 57.956 42.857 0.00 0.00 0.00 3.16
879 3536 2.738314 TCAATCAGCGTCACATCACTTG 59.262 45.455 0.00 0.00 0.00 3.16
880 3537 2.738314 CAATCAGCGTCACATCACTTGA 59.262 45.455 0.00 0.00 0.00 3.02
881 3538 2.524569 TCAGCGTCACATCACTTGAA 57.475 45.000 0.00 0.00 0.00 2.69
882 3539 2.832563 TCAGCGTCACATCACTTGAAA 58.167 42.857 0.00 0.00 0.00 2.69
883 3540 3.202097 TCAGCGTCACATCACTTGAAAA 58.798 40.909 0.00 0.00 0.00 2.29
898 3555 3.902881 TGAAAAGAGAGGGATGAGCTC 57.097 47.619 6.82 6.82 0.00 4.09
899 3556 2.167281 TGAAAAGAGAGGGATGAGCTCG 59.833 50.000 9.64 0.00 33.98 5.03
900 3557 0.463620 AAAGAGAGGGATGAGCTCGC 59.536 55.000 9.64 3.37 37.09 5.03
901 3558 1.398958 AAGAGAGGGATGAGCTCGCC 61.399 60.000 15.18 15.18 37.53 5.54
902 3559 3.206211 GAGAGGGATGAGCTCGCCG 62.206 68.421 16.51 0.00 37.53 6.46
903 3560 4.292178 GAGGGATGAGCTCGCCGG 62.292 72.222 16.51 0.00 37.53 6.13
904 3561 4.841617 AGGGATGAGCTCGCCGGA 62.842 66.667 5.05 0.00 37.53 5.14
905 3562 4.292178 GGGATGAGCTCGCCGGAG 62.292 72.222 5.05 0.00 43.46 4.63
913 3570 4.069232 CTCGCCGGAGCCTCAACA 62.069 66.667 5.05 0.00 32.61 3.33
914 3571 3.589654 CTCGCCGGAGCCTCAACAA 62.590 63.158 5.05 0.00 32.61 2.83
915 3572 2.668212 CGCCGGAGCCTCAACAAA 60.668 61.111 5.05 0.00 34.57 2.83
916 3573 2.258013 CGCCGGAGCCTCAACAAAA 61.258 57.895 5.05 0.00 34.57 2.44
917 3574 1.791103 CGCCGGAGCCTCAACAAAAA 61.791 55.000 5.05 0.00 34.57 1.94
942 3599 6.704289 AAAACTATTAATAAGAACGGGGGC 57.296 37.500 0.00 0.00 0.00 5.80
943 3600 4.362470 ACTATTAATAAGAACGGGGGCC 57.638 45.455 0.00 0.00 0.00 5.80
954 3611 3.094498 GGGGGCCGGTAGTTCCAT 61.094 66.667 1.90 0.00 35.57 3.41
955 3612 2.192175 GGGGCCGGTAGTTCCATG 59.808 66.667 1.90 0.00 35.57 3.66
956 3613 2.372074 GGGGCCGGTAGTTCCATGA 61.372 63.158 1.90 0.00 35.57 3.07
957 3614 1.153229 GGGCCGGTAGTTCCATGAC 60.153 63.158 1.90 0.00 35.57 3.06
958 3615 1.623542 GGGCCGGTAGTTCCATGACT 61.624 60.000 1.90 0.00 35.57 3.41
959 3616 0.252197 GGCCGGTAGTTCCATGACTT 59.748 55.000 1.90 0.00 35.57 3.01
960 3617 1.369625 GCCGGTAGTTCCATGACTTG 58.630 55.000 1.90 0.00 35.57 3.16
962 3619 1.369625 CGGTAGTTCCATGACTTGGC 58.630 55.000 2.42 0.00 46.01 4.52
963 3620 1.751437 GGTAGTTCCATGACTTGGCC 58.249 55.000 0.00 0.00 46.01 5.36
964 3621 1.682087 GGTAGTTCCATGACTTGGCCC 60.682 57.143 0.00 0.00 46.01 5.80
965 3622 1.004277 GTAGTTCCATGACTTGGCCCA 59.996 52.381 0.00 0.00 46.01 5.36
966 3623 0.706433 AGTTCCATGACTTGGCCCAT 59.294 50.000 0.00 0.00 46.01 4.00
967 3624 1.922447 AGTTCCATGACTTGGCCCATA 59.078 47.619 0.00 0.00 46.01 2.74
968 3625 2.515429 AGTTCCATGACTTGGCCCATAT 59.485 45.455 0.00 0.00 46.01 1.78
969 3626 3.721575 AGTTCCATGACTTGGCCCATATA 59.278 43.478 0.00 0.00 46.01 0.86
970 3627 4.354987 AGTTCCATGACTTGGCCCATATAT 59.645 41.667 0.00 0.00 46.01 0.86
971 3628 4.305539 TCCATGACTTGGCCCATATATG 57.694 45.455 0.00 5.68 46.01 1.78
972 3629 3.010472 TCCATGACTTGGCCCATATATGG 59.990 47.826 22.97 22.97 46.01 2.74
973 3630 3.245371 CCATGACTTGGCCCATATATGGT 60.245 47.826 26.59 10.11 40.55 3.55
974 3631 3.507162 TGACTTGGCCCATATATGGTG 57.493 47.619 26.59 19.42 46.65 4.17
975 3632 2.162681 GACTTGGCCCATATATGGTGC 58.837 52.381 26.59 25.97 46.65 5.01
976 3633 1.167851 CTTGGCCCATATATGGTGCG 58.832 55.000 26.59 14.79 46.65 5.34
977 3634 0.251121 TTGGCCCATATATGGTGCGG 60.251 55.000 26.59 14.47 46.65 5.69
978 3635 2.046285 GGCCCATATATGGTGCGGC 61.046 63.158 26.59 21.85 46.65 6.53
979 3636 1.002134 GCCCATATATGGTGCGGCT 60.002 57.895 26.59 0.00 46.65 5.52
980 3637 1.308069 GCCCATATATGGTGCGGCTG 61.308 60.000 26.59 12.87 46.65 4.85
981 3638 1.308069 CCCATATATGGTGCGGCTGC 61.308 60.000 26.59 11.65 46.65 5.25
982 3639 0.606130 CCATATATGGTGCGGCTGCA 60.606 55.000 18.37 18.37 43.79 4.41
991 3648 2.202349 GCGGCTGCATTCGTTGAC 60.202 61.111 14.08 0.00 42.15 3.18
992 3649 2.480555 CGGCTGCATTCGTTGACC 59.519 61.111 0.50 0.00 0.00 4.02
993 3650 2.877691 GGCTGCATTCGTTGACCC 59.122 61.111 0.50 0.00 0.00 4.46
994 3651 2.480555 GCTGCATTCGTTGACCCG 59.519 61.111 0.00 0.00 0.00 5.28
995 3652 3.039202 GCTGCATTCGTTGACCCGG 62.039 63.158 0.00 0.00 0.00 5.73
996 3653 1.375396 CTGCATTCGTTGACCCGGA 60.375 57.895 0.73 0.00 0.00 5.14
997 3654 0.953471 CTGCATTCGTTGACCCGGAA 60.953 55.000 0.73 0.00 0.00 4.30
998 3655 0.953471 TGCATTCGTTGACCCGGAAG 60.953 55.000 0.73 0.00 0.00 3.46
999 3656 1.794222 CATTCGTTGACCCGGAAGC 59.206 57.895 0.73 0.00 0.00 3.86
1000 3657 0.953471 CATTCGTTGACCCGGAAGCA 60.953 55.000 0.73 0.00 0.00 3.91
1001 3658 0.250553 ATTCGTTGACCCGGAAGCAA 60.251 50.000 0.73 0.49 0.00 3.91
1002 3659 0.464013 TTCGTTGACCCGGAAGCAAA 60.464 50.000 0.73 0.00 0.00 3.68
1003 3660 1.161563 TCGTTGACCCGGAAGCAAAC 61.162 55.000 0.73 0.00 0.00 2.93
1004 3661 1.440938 CGTTGACCCGGAAGCAAACA 61.441 55.000 0.73 0.00 0.00 2.83
1005 3662 0.958822 GTTGACCCGGAAGCAAACAT 59.041 50.000 0.73 0.00 0.00 2.71
1006 3663 1.068541 GTTGACCCGGAAGCAAACATC 60.069 52.381 0.73 0.00 0.00 3.06
1007 3664 0.109532 TGACCCGGAAGCAAACATCA 59.890 50.000 0.73 0.00 0.00 3.07
1008 3665 1.271871 TGACCCGGAAGCAAACATCAT 60.272 47.619 0.73 0.00 0.00 2.45
1009 3666 1.133025 GACCCGGAAGCAAACATCATG 59.867 52.381 0.73 0.00 0.00 3.07
1010 3667 1.271871 ACCCGGAAGCAAACATCATGA 60.272 47.619 0.73 0.00 0.00 3.07
1011 3668 1.818060 CCCGGAAGCAAACATCATGAA 59.182 47.619 0.73 0.00 0.00 2.57
1012 3669 2.159338 CCCGGAAGCAAACATCATGAAG 60.159 50.000 0.73 0.00 0.00 3.02
1013 3670 2.523015 CGGAAGCAAACATCATGAAGC 58.477 47.619 0.00 0.00 0.00 3.86
1014 3671 2.095110 CGGAAGCAAACATCATGAAGCA 60.095 45.455 0.00 0.00 0.00 3.91
1015 3672 3.508762 GGAAGCAAACATCATGAAGCAG 58.491 45.455 0.00 0.00 0.00 4.24
1016 3673 3.057033 GGAAGCAAACATCATGAAGCAGT 60.057 43.478 0.00 0.00 0.00 4.40
1017 3674 3.844577 AGCAAACATCATGAAGCAGTC 57.155 42.857 0.00 0.00 0.00 3.51
1018 3675 3.151554 AGCAAACATCATGAAGCAGTCA 58.848 40.909 0.00 0.00 41.67 3.41
1019 3676 3.570975 AGCAAACATCATGAAGCAGTCAA 59.429 39.130 0.00 0.00 40.50 3.18
1020 3677 3.918591 GCAAACATCATGAAGCAGTCAAG 59.081 43.478 0.00 0.00 40.50 3.02
1021 3678 4.482386 CAAACATCATGAAGCAGTCAAGG 58.518 43.478 0.00 0.00 40.50 3.61
1022 3679 3.708403 ACATCATGAAGCAGTCAAGGA 57.292 42.857 0.00 0.00 40.50 3.36
1023 3680 4.025040 ACATCATGAAGCAGTCAAGGAA 57.975 40.909 0.00 0.00 40.50 3.36
1024 3681 4.008330 ACATCATGAAGCAGTCAAGGAAG 58.992 43.478 0.00 0.00 40.50 3.46
1025 3682 3.063510 TCATGAAGCAGTCAAGGAAGG 57.936 47.619 0.00 0.00 40.50 3.46
1026 3683 2.639347 TCATGAAGCAGTCAAGGAAGGA 59.361 45.455 0.00 0.00 40.50 3.36
1027 3684 3.072915 TCATGAAGCAGTCAAGGAAGGAA 59.927 43.478 0.00 0.00 40.50 3.36
1028 3685 3.576078 TGAAGCAGTCAAGGAAGGAAA 57.424 42.857 0.00 0.00 31.51 3.13
1029 3686 3.480470 TGAAGCAGTCAAGGAAGGAAAG 58.520 45.455 0.00 0.00 31.51 2.62
1030 3687 1.902938 AGCAGTCAAGGAAGGAAAGC 58.097 50.000 0.00 0.00 0.00 3.51
1031 3688 0.519077 GCAGTCAAGGAAGGAAAGCG 59.481 55.000 0.00 0.00 0.00 4.68
1032 3689 1.160137 CAGTCAAGGAAGGAAAGCGG 58.840 55.000 0.00 0.00 0.00 5.52
1033 3690 0.765510 AGTCAAGGAAGGAAAGCGGT 59.234 50.000 0.00 0.00 0.00 5.68
1034 3691 1.157585 GTCAAGGAAGGAAAGCGGTC 58.842 55.000 0.00 0.00 0.00 4.79
1035 3692 0.762418 TCAAGGAAGGAAAGCGGTCA 59.238 50.000 0.00 0.00 0.00 4.02
1036 3693 1.160137 CAAGGAAGGAAAGCGGTCAG 58.840 55.000 0.00 0.00 0.00 3.51
1037 3694 0.036875 AAGGAAGGAAAGCGGTCAGG 59.963 55.000 0.00 0.00 0.00 3.86
1038 3695 0.836400 AGGAAGGAAAGCGGTCAGGA 60.836 55.000 0.00 0.00 0.00 3.86
1081 3738 2.105128 GTCATCGGCCTGACCTCG 59.895 66.667 13.01 0.00 39.72 4.63
1125 3782 3.857038 GGTATCCGCGGCCTTCCA 61.857 66.667 23.51 1.11 0.00 3.53
1141 3798 3.753434 CAGTCGGCGGCAGACTCT 61.753 66.667 28.73 10.60 46.16 3.24
1157 3814 3.680786 CTGACGCCGTGTGGGAGA 61.681 66.667 0.00 0.00 37.92 3.71
1170 3827 3.394836 GGAGAGGTTCCTGCCGCT 61.395 66.667 0.00 0.00 43.16 5.52
1171 3828 2.125350 GAGAGGTTCCTGCCGCTG 60.125 66.667 0.00 0.00 38.78 5.18
1249 3906 0.540923 AGCTCTTCATGGACCTCAGC 59.459 55.000 0.00 0.00 0.00 4.26
1255 3912 1.517257 CATGGACCTCAGCGACGAC 60.517 63.158 0.00 0.00 0.00 4.34
1272 3929 2.005960 GACCATGTCCTCCTCGACGG 62.006 65.000 0.00 0.00 35.40 4.79
1273 3930 2.105128 CATGTCCTCCTCGACGGC 59.895 66.667 0.00 0.00 35.40 5.68
1290 3947 2.743928 CGGCAAGAGGGTGAGTGC 60.744 66.667 0.00 0.00 36.24 4.40
1292 3949 2.431683 GCAAGAGGGTGAGTGCCA 59.568 61.111 0.00 0.00 0.00 4.92
1293 3950 1.228245 GCAAGAGGGTGAGTGCCAA 60.228 57.895 0.00 0.00 0.00 4.52
1294 3951 0.823356 GCAAGAGGGTGAGTGCCAAA 60.823 55.000 0.00 0.00 0.00 3.28
1296 3953 2.242043 CAAGAGGGTGAGTGCCAAATT 58.758 47.619 0.00 0.00 0.00 1.82
1297 3954 2.629617 CAAGAGGGTGAGTGCCAAATTT 59.370 45.455 0.00 0.00 0.00 1.82
1298 3955 2.519013 AGAGGGTGAGTGCCAAATTTC 58.481 47.619 0.00 0.00 0.00 2.17
1299 3956 1.546029 GAGGGTGAGTGCCAAATTTCC 59.454 52.381 0.00 0.00 0.00 3.13
1300 3957 0.243636 GGGTGAGTGCCAAATTTCCG 59.756 55.000 0.00 0.00 0.00 4.30
1301 3958 0.243636 GGTGAGTGCCAAATTTCCGG 59.756 55.000 0.00 0.00 0.00 5.14
1302 3959 0.958822 GTGAGTGCCAAATTTCCGGT 59.041 50.000 0.00 0.00 0.00 5.28
1304 3961 1.243902 GAGTGCCAAATTTCCGGTCA 58.756 50.000 0.00 0.00 0.00 4.02
1305 3962 1.818674 GAGTGCCAAATTTCCGGTCAT 59.181 47.619 0.00 0.00 0.00 3.06
1306 3963 2.231235 GAGTGCCAAATTTCCGGTCATT 59.769 45.455 0.00 0.00 0.00 2.57
1308 3965 2.029470 GTGCCAAATTTCCGGTCATTCA 60.029 45.455 0.00 0.00 0.00 2.57
1309 3966 2.830923 TGCCAAATTTCCGGTCATTCAT 59.169 40.909 0.00 0.00 0.00 2.57
1310 3967 3.189285 GCCAAATTTCCGGTCATTCATG 58.811 45.455 0.00 0.00 0.00 3.07
1311 3968 3.119173 GCCAAATTTCCGGTCATTCATGA 60.119 43.478 0.00 0.00 0.00 3.07
1359 4016 9.967245 CGATTTGTCTAATTTGTTTCTTCGATA 57.033 29.630 0.00 0.00 0.00 2.92
1366 4023 9.496873 TCTAATTTGTTTCTTCGATAAAGTGGA 57.503 29.630 0.00 0.00 36.31 4.02
1374 4031 7.406031 TTCTTCGATAAAGTGGATCAGTACT 57.594 36.000 0.00 0.00 36.31 2.73
1393 4050 9.907229 TCAGTACTGATTGATCGGATATACTAT 57.093 33.333 21.74 0.00 36.97 2.12
1394 4051 9.943163 CAGTACTGATTGATCGGATATACTATG 57.057 37.037 18.45 0.00 36.97 2.23
1395 4052 8.625651 AGTACTGATTGATCGGATATACTATGC 58.374 37.037 6.81 0.00 36.97 3.14
1396 4053 6.810911 ACTGATTGATCGGATATACTATGCC 58.189 40.000 6.81 0.00 36.97 4.40
1416 4073 4.836125 CCGCATGGCTTCTAATTAACAT 57.164 40.909 0.00 0.00 0.00 2.71
1417 4074 5.186996 CCGCATGGCTTCTAATTAACATT 57.813 39.130 0.00 0.00 0.00 2.71
1418 4075 5.215160 CCGCATGGCTTCTAATTAACATTC 58.785 41.667 0.00 0.00 0.00 2.67
1419 4076 5.009010 CCGCATGGCTTCTAATTAACATTCT 59.991 40.000 0.00 0.00 0.00 2.40
1420 4077 5.911280 CGCATGGCTTCTAATTAACATTCTG 59.089 40.000 0.00 0.00 0.00 3.02
1432 4089 9.864034 CTAATTAACATTCTGCTGGTTAATACG 57.136 33.333 13.08 7.10 43.28 3.06
1433 4090 7.859325 ATTAACATTCTGCTGGTTAATACGT 57.141 32.000 11.84 0.00 42.65 3.57
1434 4091 5.796350 AACATTCTGCTGGTTAATACGTC 57.204 39.130 0.00 0.00 0.00 4.34
1435 4092 5.086104 ACATTCTGCTGGTTAATACGTCT 57.914 39.130 0.00 0.00 0.00 4.18
1436 4093 5.488341 ACATTCTGCTGGTTAATACGTCTT 58.512 37.500 0.00 0.00 0.00 3.01
1437 4094 6.636705 ACATTCTGCTGGTTAATACGTCTTA 58.363 36.000 0.00 0.00 0.00 2.10
1438 4095 7.101054 ACATTCTGCTGGTTAATACGTCTTAA 58.899 34.615 0.00 0.00 0.00 1.85
1457 4114 5.944007 TCTTAATTAGAGTTTTGGGCTCCAC 59.056 40.000 0.00 0.00 30.78 4.02
1465 4122 2.238847 TTTGGGCTCCACCGATCGAG 62.239 60.000 18.66 9.42 40.62 4.04
1496 4153 3.703556 AGTGCTACATGCTATCTGTGAGT 59.296 43.478 0.00 0.00 43.37 3.41
1499 4156 4.202090 TGCTACATGCTATCTGTGAGTGAG 60.202 45.833 0.00 0.00 43.37 3.51
1516 4173 0.181350 GAGATGGGAATCGCTTGGGT 59.819 55.000 0.00 0.00 0.00 4.51
1518 4175 1.843851 AGATGGGAATCGCTTGGGTTA 59.156 47.619 0.00 0.00 0.00 2.85
1519 4176 1.947456 GATGGGAATCGCTTGGGTTAC 59.053 52.381 0.00 0.00 0.00 2.50
1520 4177 0.693622 TGGGAATCGCTTGGGTTACA 59.306 50.000 0.00 0.00 0.00 2.41
1521 4178 1.339631 TGGGAATCGCTTGGGTTACAG 60.340 52.381 0.00 0.00 0.00 2.74
1542 4199 6.154203 CAGCAGATCTGTACTGGATAAAGA 57.846 41.667 23.38 0.00 38.02 2.52
1543 4200 6.215121 CAGCAGATCTGTACTGGATAAAGAG 58.785 44.000 23.38 0.00 38.02 2.85
1557 4214 1.657804 AAAGAGGTCGGACCCAGATT 58.342 50.000 23.21 10.82 39.75 2.40
1560 4217 0.902531 GAGGTCGGACCCAGATTCAA 59.097 55.000 23.21 0.00 39.75 2.69
1572 4229 7.717875 CGGACCCAGATTCAAGGTAATTAATTA 59.282 37.037 3.71 3.71 32.81 1.40
1573 4230 9.416284 GGACCCAGATTCAAGGTAATTAATTAA 57.584 33.333 9.48 0.00 32.81 1.40
1575 4232 9.990868 ACCCAGATTCAAGGTAATTAATTAACT 57.009 29.630 18.25 18.25 41.82 2.24
1598 4255 8.465798 ACTCCCATATATACTACTGTACCTCT 57.534 38.462 0.00 0.00 0.00 3.69
1599 4256 8.550585 ACTCCCATATATACTACTGTACCTCTC 58.449 40.741 0.00 0.00 0.00 3.20
1600 4257 8.458951 TCCCATATATACTACTGTACCTCTCA 57.541 38.462 0.00 0.00 0.00 3.27
1601 4258 8.897692 TCCCATATATACTACTGTACCTCTCAA 58.102 37.037 0.00 0.00 0.00 3.02
1602 4259 9.702253 CCCATATATACTACTGTACCTCTCAAT 57.298 37.037 0.00 0.00 0.00 2.57
1609 4266 7.811117 ACTACTGTACCTCTCAATCTCATAC 57.189 40.000 0.00 0.00 0.00 2.39
1610 4267 7.579105 ACTACTGTACCTCTCAATCTCATACT 58.421 38.462 0.00 0.00 0.00 2.12
1611 4268 8.715842 ACTACTGTACCTCTCAATCTCATACTA 58.284 37.037 0.00 0.00 0.00 1.82
1612 4269 9.733556 CTACTGTACCTCTCAATCTCATACTAT 57.266 37.037 0.00 0.00 0.00 2.12
1613 4270 8.630054 ACTGTACCTCTCAATCTCATACTATC 57.370 38.462 0.00 0.00 0.00 2.08
1614 4271 8.444783 ACTGTACCTCTCAATCTCATACTATCT 58.555 37.037 0.00 0.00 0.00 1.98
1615 4272 8.856153 TGTACCTCTCAATCTCATACTATCTC 57.144 38.462 0.00 0.00 0.00 2.75
1616 4273 8.440771 TGTACCTCTCAATCTCATACTATCTCA 58.559 37.037 0.00 0.00 0.00 3.27
1617 4274 8.946085 GTACCTCTCAATCTCATACTATCTCAG 58.054 40.741 0.00 0.00 0.00 3.35
1618 4275 7.754624 ACCTCTCAATCTCATACTATCTCAGA 58.245 38.462 0.00 0.00 0.00 3.27
1619 4276 8.224025 ACCTCTCAATCTCATACTATCTCAGAA 58.776 37.037 0.00 0.00 0.00 3.02
1620 4277 9.076781 CCTCTCAATCTCATACTATCTCAGAAA 57.923 37.037 0.00 0.00 0.00 2.52
1624 4281 9.486497 TCAATCTCATACTATCTCAGAAATTGC 57.514 33.333 0.00 0.00 0.00 3.56
1625 4282 9.491675 CAATCTCATACTATCTCAGAAATTGCT 57.508 33.333 0.00 0.00 0.00 3.91
1627 4284 8.883954 TCTCATACTATCTCAGAAATTGCTTG 57.116 34.615 0.00 0.00 0.00 4.01
1628 4285 8.699130 TCTCATACTATCTCAGAAATTGCTTGA 58.301 33.333 0.00 0.00 0.00 3.02
1629 4286 9.491675 CTCATACTATCTCAGAAATTGCTTGAT 57.508 33.333 4.60 4.60 0.00 2.57
1630 4287 9.842775 TCATACTATCTCAGAAATTGCTTGATT 57.157 29.630 4.52 0.00 0.00 2.57
1636 4293 8.763984 ATCTCAGAAATTGCTTGATTTATCCT 57.236 30.769 0.00 0.00 29.75 3.24
1637 4294 8.585471 TCTCAGAAATTGCTTGATTTATCCTT 57.415 30.769 0.00 0.00 29.75 3.36
1638 4295 8.464404 TCTCAGAAATTGCTTGATTTATCCTTG 58.536 33.333 0.00 0.00 29.75 3.61
1639 4296 7.037438 TCAGAAATTGCTTGATTTATCCTTGC 58.963 34.615 0.00 0.00 29.75 4.01
1640 4297 7.039882 CAGAAATTGCTTGATTTATCCTTGCT 58.960 34.615 0.00 0.00 29.75 3.91
1641 4298 7.548075 CAGAAATTGCTTGATTTATCCTTGCTT 59.452 33.333 0.00 0.00 29.75 3.91
1642 4299 7.548075 AGAAATTGCTTGATTTATCCTTGCTTG 59.452 33.333 0.00 0.00 29.75 4.01
1643 4300 5.981088 TTGCTTGATTTATCCTTGCTTGA 57.019 34.783 0.00 0.00 0.00 3.02
1644 4301 5.314923 TGCTTGATTTATCCTTGCTTGAC 57.685 39.130 0.00 0.00 0.00 3.18
1645 4302 4.766373 TGCTTGATTTATCCTTGCTTGACA 59.234 37.500 0.00 0.00 0.00 3.58
1646 4303 5.243507 TGCTTGATTTATCCTTGCTTGACAA 59.756 36.000 0.00 0.00 36.62 3.18
1647 4304 6.071221 TGCTTGATTTATCCTTGCTTGACAAT 60.071 34.615 0.00 0.00 37.72 2.71
1648 4305 6.815142 GCTTGATTTATCCTTGCTTGACAATT 59.185 34.615 0.00 0.00 37.72 2.32
1649 4306 7.975616 GCTTGATTTATCCTTGCTTGACAATTA 59.024 33.333 0.00 0.00 37.72 1.40
1650 4307 9.859427 CTTGATTTATCCTTGCTTGACAATTAA 57.141 29.630 0.00 0.00 37.72 1.40
1651 4308 9.859427 TTGATTTATCCTTGCTTGACAATTAAG 57.141 29.630 0.00 0.00 37.72 1.85
1661 4318 6.502136 GCTTGACAATTAAGCTTAGGTTCT 57.498 37.500 6.24 0.00 45.34 3.01
1662 4319 6.547283 GCTTGACAATTAAGCTTAGGTTCTC 58.453 40.000 6.24 4.56 45.34 2.87
1663 4320 6.403746 GCTTGACAATTAAGCTTAGGTTCTCC 60.404 42.308 6.24 0.00 45.34 3.71
1664 4321 6.121776 TGACAATTAAGCTTAGGTTCTCCA 57.878 37.500 6.24 0.00 35.89 3.86
1665 4322 6.539173 TGACAATTAAGCTTAGGTTCTCCAA 58.461 36.000 6.24 0.00 35.89 3.53
1666 4323 6.655003 TGACAATTAAGCTTAGGTTCTCCAAG 59.345 38.462 6.24 0.00 35.89 3.61
1667 4324 5.946377 ACAATTAAGCTTAGGTTCTCCAAGG 59.054 40.000 6.24 0.00 35.89 3.61
1668 4325 5.780958 ATTAAGCTTAGGTTCTCCAAGGT 57.219 39.130 6.24 0.00 35.66 3.50
1669 4326 3.425162 AAGCTTAGGTTCTCCAAGGTG 57.575 47.619 0.00 0.00 34.98 4.00
1670 4327 1.630878 AGCTTAGGTTCTCCAAGGTGG 59.369 52.381 0.00 0.00 39.43 4.61
1671 4328 1.950954 GCTTAGGTTCTCCAAGGTGGC 60.951 57.143 0.00 0.00 37.47 5.01
1672 4329 1.351017 CTTAGGTTCTCCAAGGTGGCA 59.649 52.381 0.00 0.00 37.47 4.92
1673 4330 0.984230 TAGGTTCTCCAAGGTGGCAG 59.016 55.000 0.00 0.00 37.47 4.85
1674 4331 0.768221 AGGTTCTCCAAGGTGGCAGA 60.768 55.000 0.00 0.00 37.47 4.26
1675 4332 0.322008 GGTTCTCCAAGGTGGCAGAG 60.322 60.000 0.00 0.00 37.47 3.35
1676 4333 0.957888 GTTCTCCAAGGTGGCAGAGC 60.958 60.000 0.00 0.00 37.47 4.09
1677 4334 1.130054 TTCTCCAAGGTGGCAGAGCT 61.130 55.000 0.00 0.00 37.47 4.09
1678 4335 1.078567 CTCCAAGGTGGCAGAGCTC 60.079 63.158 5.27 5.27 37.47 4.09
1679 4336 1.834856 CTCCAAGGTGGCAGAGCTCA 61.835 60.000 17.77 0.00 37.47 4.26
1680 4337 1.203441 TCCAAGGTGGCAGAGCTCAT 61.203 55.000 17.77 0.00 37.47 2.90
1681 4338 1.030488 CCAAGGTGGCAGAGCTCATG 61.030 60.000 17.77 12.21 0.00 3.07
1682 4339 0.322277 CAAGGTGGCAGAGCTCATGT 60.322 55.000 17.77 0.00 0.00 3.21
1683 4340 0.035630 AAGGTGGCAGAGCTCATGTC 60.036 55.000 17.77 13.09 0.00 3.06
1684 4341 1.196766 AGGTGGCAGAGCTCATGTCA 61.197 55.000 17.77 15.55 0.00 3.58
1685 4342 0.743701 GGTGGCAGAGCTCATGTCAG 60.744 60.000 17.77 0.00 31.84 3.51
1686 4343 0.036577 GTGGCAGAGCTCATGTCAGT 60.037 55.000 17.77 0.00 31.84 3.41
1687 4344 0.036671 TGGCAGAGCTCATGTCAGTG 60.037 55.000 17.77 4.40 0.00 3.66
1688 4345 0.036577 GGCAGAGCTCATGTCAGTGT 60.037 55.000 17.77 0.00 0.00 3.55
1689 4346 1.077123 GCAGAGCTCATGTCAGTGTG 58.923 55.000 17.77 2.83 0.00 3.82
1690 4347 1.077123 CAGAGCTCATGTCAGTGTGC 58.923 55.000 17.77 0.00 38.51 4.57
1692 4349 1.077123 GAGCTCATGTCAGTGTGCTG 58.923 55.000 9.40 0.00 45.73 4.41
1693 4350 0.321387 AGCTCATGTCAGTGTGCTGG 60.321 55.000 3.04 0.00 44.53 4.85
1694 4351 0.604780 GCTCATGTCAGTGTGCTGGT 60.605 55.000 0.00 0.00 42.78 4.00
1695 4352 1.888215 CTCATGTCAGTGTGCTGGTT 58.112 50.000 0.00 0.00 42.78 3.67
1696 4353 1.802960 CTCATGTCAGTGTGCTGGTTC 59.197 52.381 0.00 0.00 42.78 3.62
1697 4354 1.140652 TCATGTCAGTGTGCTGGTTCA 59.859 47.619 0.00 0.00 42.78 3.18
1698 4355 1.534163 CATGTCAGTGTGCTGGTTCAG 59.466 52.381 0.00 0.00 42.78 3.02
1708 4365 3.056628 CTGGTTCAGCATCTCCGAC 57.943 57.895 0.00 0.00 0.00 4.79
1709 4366 0.460987 CTGGTTCAGCATCTCCGACC 60.461 60.000 0.00 0.00 0.00 4.79
1710 4367 1.519455 GGTTCAGCATCTCCGACCG 60.519 63.158 0.00 0.00 0.00 4.79
1711 4368 2.167861 GTTCAGCATCTCCGACCGC 61.168 63.158 0.00 0.00 0.00 5.68
1712 4369 2.645192 TTCAGCATCTCCGACCGCA 61.645 57.895 0.00 0.00 0.00 5.69
1713 4370 1.960040 TTCAGCATCTCCGACCGCAT 61.960 55.000 0.00 0.00 0.00 4.73
1714 4371 1.953138 CAGCATCTCCGACCGCATC 60.953 63.158 0.00 0.00 0.00 3.91
1715 4372 2.106938 GCATCTCCGACCGCATCA 59.893 61.111 0.00 0.00 0.00 3.07
1716 4373 1.953138 GCATCTCCGACCGCATCAG 60.953 63.158 0.00 0.00 0.00 2.90
1717 4374 1.953138 CATCTCCGACCGCATCAGC 60.953 63.158 0.00 0.00 37.42 4.26
1718 4375 2.426406 ATCTCCGACCGCATCAGCA 61.426 57.895 0.00 0.00 42.27 4.41
1719 4376 2.360949 ATCTCCGACCGCATCAGCAG 62.361 60.000 0.00 0.00 42.27 4.24
1720 4377 4.819761 TCCGACCGCATCAGCAGC 62.820 66.667 0.00 0.00 42.27 5.25
1722 4379 3.120385 CGACCGCATCAGCAGCAA 61.120 61.111 0.00 0.00 42.27 3.91
1723 4380 2.789917 GACCGCATCAGCAGCAAG 59.210 61.111 0.00 0.00 42.27 4.01
1724 4381 2.749044 ACCGCATCAGCAGCAAGG 60.749 61.111 0.00 0.00 42.27 3.61
1725 4382 2.437180 CCGCATCAGCAGCAAGGA 60.437 61.111 0.00 0.00 42.27 3.36
1726 4383 2.470362 CCGCATCAGCAGCAAGGAG 61.470 63.158 0.00 0.00 42.27 3.69
1727 4384 2.799371 GCATCAGCAGCAAGGAGC 59.201 61.111 0.00 0.00 46.19 4.70
1736 4393 2.125350 GCAAGGAGCTCTCACCGG 60.125 66.667 14.64 0.00 41.15 5.28
1737 4394 2.581354 CAAGGAGCTCTCACCGGG 59.419 66.667 14.64 0.00 0.00 5.73
1738 4395 3.394836 AAGGAGCTCTCACCGGGC 61.395 66.667 14.64 0.00 0.00 6.13
1739 4396 4.704103 AGGAGCTCTCACCGGGCA 62.704 66.667 14.64 0.00 0.00 5.36
1740 4397 4.459089 GGAGCTCTCACCGGGCAC 62.459 72.222 14.64 0.00 0.00 5.01
1755 4412 2.502093 CACCCAATACGCGGCCTA 59.498 61.111 12.47 0.00 0.00 3.93
1756 4413 1.885850 CACCCAATACGCGGCCTAC 60.886 63.158 12.47 0.00 0.00 3.18
1757 4414 2.280592 CCCAATACGCGGCCTACC 60.281 66.667 12.47 0.00 0.00 3.18
1758 4415 2.803817 CCCAATACGCGGCCTACCT 61.804 63.158 12.47 0.00 0.00 3.08
1759 4416 1.145377 CCAATACGCGGCCTACCTT 59.855 57.895 12.47 0.00 0.00 3.50
1760 4417 1.157870 CCAATACGCGGCCTACCTTG 61.158 60.000 12.47 2.99 0.00 3.61
1761 4418 0.461339 CAATACGCGGCCTACCTTGT 60.461 55.000 12.47 0.00 0.00 3.16
1762 4419 0.461339 AATACGCGGCCTACCTTGTG 60.461 55.000 12.47 0.00 0.00 3.33
1763 4420 1.610554 ATACGCGGCCTACCTTGTGT 61.611 55.000 12.47 0.00 0.00 3.72
1764 4421 0.964860 TACGCGGCCTACCTTGTGTA 60.965 55.000 12.47 0.00 0.00 2.90
1765 4422 1.808390 CGCGGCCTACCTTGTGTAC 60.808 63.158 0.00 0.00 0.00 2.90
1766 4423 1.294138 GCGGCCTACCTTGTGTACA 59.706 57.895 0.00 0.00 0.00 2.90
1767 4424 0.320946 GCGGCCTACCTTGTGTACAA 60.321 55.000 0.00 0.00 0.00 2.41
1778 4435 2.820059 TGTGTACAAGCTCACTCAGG 57.180 50.000 0.00 0.00 35.82 3.86
1779 4436 2.316108 TGTGTACAAGCTCACTCAGGA 58.684 47.619 0.00 0.00 35.82 3.86
1780 4437 2.035961 TGTGTACAAGCTCACTCAGGAC 59.964 50.000 0.00 0.00 35.82 3.85
1781 4438 1.269723 TGTACAAGCTCACTCAGGACG 59.730 52.381 0.00 0.00 0.00 4.79
1782 4439 0.243907 TACAAGCTCACTCAGGACGC 59.756 55.000 0.00 0.00 0.00 5.19
1783 4440 1.005748 CAAGCTCACTCAGGACGCA 60.006 57.895 0.00 0.00 0.00 5.24
1784 4441 0.390866 CAAGCTCACTCAGGACGCAT 60.391 55.000 0.00 0.00 0.00 4.73
1785 4442 0.108424 AAGCTCACTCAGGACGCATC 60.108 55.000 0.00 0.00 0.00 3.91
1786 4443 1.520342 GCTCACTCAGGACGCATCC 60.520 63.158 0.00 0.00 46.69 3.51
1794 4451 2.105128 GGACGCATCCGGTCTCAG 59.895 66.667 0.00 0.00 39.22 3.35
1795 4452 2.583593 GACGCATCCGGTCTCAGC 60.584 66.667 0.00 0.00 39.22 4.26
1796 4453 3.069980 GACGCATCCGGTCTCAGCT 62.070 63.158 0.00 0.00 39.22 4.24
1797 4454 2.279120 CGCATCCGGTCTCAGCTC 60.279 66.667 0.00 0.00 0.00 4.09
1798 4455 2.107953 GCATCCGGTCTCAGCTCC 59.892 66.667 0.00 0.00 0.00 4.70
1799 4456 2.818132 CATCCGGTCTCAGCTCCC 59.182 66.667 0.00 0.00 0.00 4.30
1800 4457 2.444895 ATCCGGTCTCAGCTCCCC 60.445 66.667 0.00 0.00 0.00 4.81
1801 4458 3.317436 ATCCGGTCTCAGCTCCCCA 62.317 63.158 0.00 0.00 0.00 4.96
1802 4459 3.775654 CCGGTCTCAGCTCCCCAC 61.776 72.222 0.00 0.00 0.00 4.61
1803 4460 4.135153 CGGTCTCAGCTCCCCACG 62.135 72.222 0.00 0.00 0.00 4.94
1804 4461 3.775654 GGTCTCAGCTCCCCACGG 61.776 72.222 0.00 0.00 0.00 4.94
1805 4462 4.459089 GTCTCAGCTCCCCACGGC 62.459 72.222 0.00 0.00 0.00 5.68
1807 4464 4.463879 CTCAGCTCCCCACGGCAG 62.464 72.222 0.00 0.00 0.00 4.85
1809 4466 3.790437 CAGCTCCCCACGGCAGAT 61.790 66.667 0.00 0.00 0.00 2.90
1810 4467 2.041922 AGCTCCCCACGGCAGATA 60.042 61.111 0.00 0.00 0.00 1.98
1811 4468 1.460305 AGCTCCCCACGGCAGATAT 60.460 57.895 0.00 0.00 0.00 1.63
1812 4469 1.004440 GCTCCCCACGGCAGATATC 60.004 63.158 0.00 0.00 0.00 1.63
1813 4470 1.290324 CTCCCCACGGCAGATATCG 59.710 63.158 0.00 0.00 0.00 2.92
1814 4471 1.456892 TCCCCACGGCAGATATCGT 60.457 57.895 0.00 0.00 40.49 3.73
1815 4472 1.046472 TCCCCACGGCAGATATCGTT 61.046 55.000 0.00 0.00 37.53 3.85
1816 4473 0.600255 CCCCACGGCAGATATCGTTC 60.600 60.000 0.00 0.00 37.53 3.95
1817 4474 0.104120 CCCACGGCAGATATCGTTCA 59.896 55.000 0.00 0.00 37.53 3.18
1818 4475 1.270305 CCCACGGCAGATATCGTTCAT 60.270 52.381 0.00 0.00 37.53 2.57
1819 4476 2.483876 CCACGGCAGATATCGTTCATT 58.516 47.619 0.00 0.00 37.53 2.57
1820 4477 2.221749 CCACGGCAGATATCGTTCATTG 59.778 50.000 0.00 0.00 37.53 2.82
1821 4478 3.123050 CACGGCAGATATCGTTCATTGA 58.877 45.455 0.00 0.00 37.53 2.57
1822 4479 3.183172 CACGGCAGATATCGTTCATTGAG 59.817 47.826 0.00 0.00 37.53 3.02
1823 4480 2.733552 CGGCAGATATCGTTCATTGAGG 59.266 50.000 0.00 0.00 0.00 3.86
1824 4481 3.733337 GGCAGATATCGTTCATTGAGGT 58.267 45.455 0.00 0.00 0.00 3.85
1825 4482 4.558697 CGGCAGATATCGTTCATTGAGGTA 60.559 45.833 0.00 0.00 0.00 3.08
1826 4483 4.926238 GGCAGATATCGTTCATTGAGGTAG 59.074 45.833 0.00 0.00 0.00 3.18
1827 4484 4.926238 GCAGATATCGTTCATTGAGGTAGG 59.074 45.833 0.00 0.00 0.00 3.18
1828 4485 5.509840 GCAGATATCGTTCATTGAGGTAGGT 60.510 44.000 0.00 0.00 0.00 3.08
1829 4486 5.923114 CAGATATCGTTCATTGAGGTAGGTG 59.077 44.000 0.00 0.00 0.00 4.00
1830 4487 3.543680 ATCGTTCATTGAGGTAGGTGG 57.456 47.619 0.00 0.00 0.00 4.61
1831 4488 1.553248 TCGTTCATTGAGGTAGGTGGG 59.447 52.381 0.00 0.00 0.00 4.61
1832 4489 1.751437 GTTCATTGAGGTAGGTGGGC 58.249 55.000 0.00 0.00 0.00 5.36
1833 4490 1.004277 GTTCATTGAGGTAGGTGGGCA 59.996 52.381 0.00 0.00 0.00 5.36
1834 4491 0.911769 TCATTGAGGTAGGTGGGCAG 59.088 55.000 0.00 0.00 0.00 4.85
1835 4492 0.749454 CATTGAGGTAGGTGGGCAGC 60.749 60.000 0.00 0.00 0.00 5.25
1836 4493 0.916358 ATTGAGGTAGGTGGGCAGCT 60.916 55.000 0.00 0.00 42.47 4.24
1837 4494 0.252513 TTGAGGTAGGTGGGCAGCTA 60.253 55.000 0.00 0.00 40.09 3.32
1838 4495 0.687757 TGAGGTAGGTGGGCAGCTAG 60.688 60.000 0.00 0.00 41.46 3.42
1839 4496 0.688087 GAGGTAGGTGGGCAGCTAGT 60.688 60.000 0.00 0.00 41.46 2.57
1840 4497 0.252742 AGGTAGGTGGGCAGCTAGTT 60.253 55.000 0.00 0.00 41.46 2.24
1841 4498 0.107654 GGTAGGTGGGCAGCTAGTTG 60.108 60.000 1.58 1.58 41.46 3.16
1842 4499 0.107654 GTAGGTGGGCAGCTAGTTGG 60.108 60.000 8.78 0.00 41.46 3.77
1843 4500 1.271840 TAGGTGGGCAGCTAGTTGGG 61.272 60.000 8.78 0.00 40.09 4.12
1844 4501 2.602676 GGTGGGCAGCTAGTTGGGA 61.603 63.158 8.78 0.00 0.00 4.37
1845 4502 1.078143 GTGGGCAGCTAGTTGGGAG 60.078 63.158 8.78 0.00 0.00 4.30
1846 4503 2.124529 GGGCAGCTAGTTGGGAGC 60.125 66.667 8.78 0.00 40.42 4.70
1847 4504 2.671070 GGCAGCTAGTTGGGAGCA 59.329 61.111 8.78 0.00 42.69 4.26
1848 4505 1.225704 GGCAGCTAGTTGGGAGCAT 59.774 57.895 8.78 0.00 42.69 3.79
1849 4506 0.817229 GGCAGCTAGTTGGGAGCATC 60.817 60.000 8.78 0.00 42.69 3.91
1863 4520 3.461773 CATCCACCCGGCGTCTCT 61.462 66.667 6.01 0.00 0.00 3.10
1864 4521 3.148279 ATCCACCCGGCGTCTCTC 61.148 66.667 6.01 0.00 0.00 3.20
1867 4524 3.461773 CACCCGGCGTCTCTCCAT 61.462 66.667 6.01 0.00 0.00 3.41
1868 4525 3.148279 ACCCGGCGTCTCTCCATC 61.148 66.667 6.01 0.00 0.00 3.51
1869 4526 3.917760 CCCGGCGTCTCTCCATCC 61.918 72.222 6.01 0.00 0.00 3.51
1870 4527 3.917760 CCGGCGTCTCTCCATCCC 61.918 72.222 6.01 0.00 0.00 3.85
1871 4528 2.835431 CGGCGTCTCTCCATCCCT 60.835 66.667 0.00 0.00 0.00 4.20
1872 4529 2.818132 GGCGTCTCTCCATCCCTG 59.182 66.667 0.00 0.00 0.00 4.45
1873 4530 2.107953 GCGTCTCTCCATCCCTGC 59.892 66.667 0.00 0.00 0.00 4.85
1874 4531 2.415010 CGTCTCTCCATCCCTGCG 59.585 66.667 0.00 0.00 0.00 5.18
1875 4532 2.121538 CGTCTCTCCATCCCTGCGA 61.122 63.158 0.00 0.00 0.00 5.10
1876 4533 1.439644 GTCTCTCCATCCCTGCGAC 59.560 63.158 0.00 0.00 0.00 5.19
1877 4534 1.758514 TCTCTCCATCCCTGCGACC 60.759 63.158 0.00 0.00 0.00 4.79
1878 4535 3.144120 CTCTCCATCCCTGCGACCG 62.144 68.421 0.00 0.00 0.00 4.79
1879 4536 3.461773 CTCCATCCCTGCGACCGT 61.462 66.667 0.00 0.00 0.00 4.83
1880 4537 3.000819 TCCATCCCTGCGACCGTT 61.001 61.111 0.00 0.00 0.00 4.44
1881 4538 2.819595 CCATCCCTGCGACCGTTG 60.820 66.667 0.00 0.00 0.00 4.10
1882 4539 2.047274 CATCCCTGCGACCGTTGT 60.047 61.111 0.00 0.00 0.00 3.32
1883 4540 1.671054 CATCCCTGCGACCGTTGTT 60.671 57.895 0.00 0.00 0.00 2.83
1884 4541 1.375523 ATCCCTGCGACCGTTGTTC 60.376 57.895 0.00 0.00 0.00 3.18
1885 4542 2.798148 ATCCCTGCGACCGTTGTTCC 62.798 60.000 0.00 0.00 0.00 3.62
1886 4543 2.030562 CCTGCGACCGTTGTTCCT 59.969 61.111 0.00 0.00 0.00 3.36
1887 4544 2.317609 CCTGCGACCGTTGTTCCTG 61.318 63.158 0.00 0.00 0.00 3.86
1888 4545 2.954753 CTGCGACCGTTGTTCCTGC 61.955 63.158 0.00 0.00 0.00 4.85
1889 4546 4.072088 GCGACCGTTGTTCCTGCG 62.072 66.667 0.00 0.00 0.00 5.18
1890 4547 4.072088 CGACCGTTGTTCCTGCGC 62.072 66.667 0.00 0.00 0.00 6.09
1891 4548 3.723348 GACCGTTGTTCCTGCGCC 61.723 66.667 4.18 0.00 0.00 6.53
1892 4549 4.555709 ACCGTTGTTCCTGCGCCA 62.556 61.111 4.18 0.00 0.00 5.69
1893 4550 4.025401 CCGTTGTTCCTGCGCCAC 62.025 66.667 4.18 0.00 0.00 5.01
1894 4551 3.276091 CGTTGTTCCTGCGCCACA 61.276 61.111 4.18 0.00 0.00 4.17
1895 4552 2.331451 GTTGTTCCTGCGCCACAC 59.669 61.111 4.18 0.00 0.00 3.82
1897 4554 4.539083 TGTTCCTGCGCCACACGT 62.539 61.111 4.18 0.00 46.11 4.49
1898 4555 4.012895 GTTCCTGCGCCACACGTG 62.013 66.667 15.48 15.48 46.11 4.49
1899 4556 4.228567 TTCCTGCGCCACACGTGA 62.229 61.111 25.01 0.00 46.11 4.35
1900 4557 3.529341 TTCCTGCGCCACACGTGAT 62.529 57.895 25.01 3.37 46.11 3.06
1901 4558 3.792047 CCTGCGCCACACGTGATG 61.792 66.667 25.01 16.07 46.11 3.07
1902 4559 3.792047 CTGCGCCACACGTGATGG 61.792 66.667 25.01 24.53 46.11 3.51
1907 4564 2.048222 CCACACGTGATGGCGAGT 60.048 61.111 25.01 0.00 36.21 4.18
1908 4565 2.094659 CCACACGTGATGGCGAGTC 61.095 63.158 25.01 0.00 33.77 3.36
1909 4566 2.126463 ACACGTGATGGCGAGTCG 60.126 61.111 25.01 8.54 30.48 4.18
1910 4567 2.126463 CACGTGATGGCGAGTCGT 60.126 61.111 10.90 0.00 35.59 4.34
1911 4568 2.152699 CACGTGATGGCGAGTCGTC 61.153 63.158 10.90 10.93 35.59 4.20
1917 4574 2.483745 TGGCGAGTCGTCATCGTC 59.516 61.111 17.32 0.00 44.77 4.20
1918 4575 2.648102 GGCGAGTCGTCATCGTCG 60.648 66.667 13.24 0.00 42.13 5.12
1919 4576 2.097918 GCGAGTCGTCATCGTCGT 59.902 61.111 15.08 0.00 42.13 4.34
1920 4577 1.928769 GCGAGTCGTCATCGTCGTC 60.929 63.158 15.08 0.00 42.13 4.20
1921 4578 1.644655 CGAGTCGTCATCGTCGTCG 60.645 63.158 3.82 0.00 38.33 5.12
1935 4592 3.519120 GTCGACGACGTCCACAAC 58.481 61.111 21.63 11.20 40.69 3.32
1951 4608 4.644230 ACGAACGTTGCCGCCGTA 62.644 61.111 5.00 0.00 42.21 4.02
1952 4609 4.125097 CGAACGTTGCCGCCGTAC 62.125 66.667 5.00 0.00 37.61 3.67
1953 4610 3.037249 GAACGTTGCCGCCGTACA 61.037 61.111 5.00 0.00 37.61 2.90
1954 4611 3.007070 GAACGTTGCCGCCGTACAG 62.007 63.158 5.00 0.00 37.61 2.74
1962 4619 4.710695 CGCCGTACAGGTGCACGA 62.711 66.667 11.45 0.00 44.46 4.35
1963 4620 2.809601 GCCGTACAGGTGCACGAG 60.810 66.667 11.45 8.22 43.70 4.18
1964 4621 2.809601 CCGTACAGGTGCACGAGC 60.810 66.667 11.45 0.00 40.56 5.03
1974 4631 4.284123 GCACGAGCACATGAAGGA 57.716 55.556 0.00 0.00 41.58 3.36
1975 4632 2.772739 GCACGAGCACATGAAGGAT 58.227 52.632 0.00 0.00 41.58 3.24
1976 4633 0.376152 GCACGAGCACATGAAGGATG 59.624 55.000 0.00 0.00 41.58 3.51
1977 4634 2.008543 GCACGAGCACATGAAGGATGA 61.009 52.381 0.00 0.00 41.58 2.92
1978 4635 2.349590 CACGAGCACATGAAGGATGAA 58.650 47.619 0.00 0.00 35.80 2.57
1979 4636 2.350804 CACGAGCACATGAAGGATGAAG 59.649 50.000 0.00 0.00 35.80 3.02
1980 4637 1.938577 CGAGCACATGAAGGATGAAGG 59.061 52.381 0.00 0.00 35.80 3.46
1981 4638 2.419159 CGAGCACATGAAGGATGAAGGA 60.419 50.000 0.00 0.00 35.80 3.36
1982 4639 3.204526 GAGCACATGAAGGATGAAGGAG 58.795 50.000 0.00 0.00 35.80 3.69
1983 4640 2.092538 AGCACATGAAGGATGAAGGAGG 60.093 50.000 0.00 0.00 35.80 4.30
1984 4641 2.295885 CACATGAAGGATGAAGGAGGC 58.704 52.381 0.00 0.00 35.80 4.70
1985 4642 1.213926 ACATGAAGGATGAAGGAGGCC 59.786 52.381 0.00 0.00 35.80 5.19
1986 4643 1.493871 CATGAAGGATGAAGGAGGCCT 59.506 52.381 3.86 3.86 33.31 5.19
1987 4644 1.207791 TGAAGGATGAAGGAGGCCTC 58.792 55.000 25.59 25.59 30.89 4.70
1988 4645 1.207791 GAAGGATGAAGGAGGCCTCA 58.792 55.000 33.29 15.16 30.89 3.86
1989 4646 1.773653 GAAGGATGAAGGAGGCCTCAT 59.226 52.381 33.29 25.66 30.89 2.90
1990 4647 1.904440 AGGATGAAGGAGGCCTCATT 58.096 50.000 31.65 31.65 36.19 2.57
1991 4648 1.493871 AGGATGAAGGAGGCCTCATTG 59.506 52.381 35.67 0.00 33.38 2.82
1992 4649 1.213926 GGATGAAGGAGGCCTCATTGT 59.786 52.381 35.67 23.42 33.38 2.71
1993 4650 2.570135 GATGAAGGAGGCCTCATTGTC 58.430 52.381 35.67 26.59 33.38 3.18
1994 4651 1.361204 TGAAGGAGGCCTCATTGTCA 58.639 50.000 35.67 25.30 33.38 3.58
1995 4652 1.280133 TGAAGGAGGCCTCATTGTCAG 59.720 52.381 35.67 0.00 33.38 3.51
1996 4653 0.622665 AAGGAGGCCTCATTGTCAGG 59.377 55.000 30.76 0.00 31.87 3.86
1997 4654 0.548682 AGGAGGCCTCATTGTCAGGT 60.549 55.000 33.29 3.76 32.98 4.00
1998 4655 1.204146 GGAGGCCTCATTGTCAGGTA 58.796 55.000 33.29 0.00 32.98 3.08
1999 4656 1.134371 GGAGGCCTCATTGTCAGGTAC 60.134 57.143 33.29 8.26 32.98 3.34
2000 4657 0.912486 AGGCCTCATTGTCAGGTACC 59.088 55.000 2.73 2.73 32.98 3.34
2001 4658 0.107165 GGCCTCATTGTCAGGTACCC 60.107 60.000 8.74 0.00 32.98 3.69
2002 4659 0.462047 GCCTCATTGTCAGGTACCCG 60.462 60.000 8.74 0.00 32.98 5.28
2003 4660 0.462047 CCTCATTGTCAGGTACCCGC 60.462 60.000 8.74 0.00 0.00 6.13
2004 4661 0.806102 CTCATTGTCAGGTACCCGCG 60.806 60.000 8.74 0.00 0.00 6.46
2005 4662 1.813753 CATTGTCAGGTACCCGCGG 60.814 63.158 21.04 21.04 0.00 6.46
2006 4663 3.675619 ATTGTCAGGTACCCGCGGC 62.676 63.158 22.85 6.08 0.00 6.53
2008 4665 4.382320 GTCAGGTACCCGCGGCAA 62.382 66.667 22.85 6.59 0.00 4.52
2009 4666 4.382320 TCAGGTACCCGCGGCAAC 62.382 66.667 22.85 19.39 0.00 4.17
2028 4685 3.998672 GGTCGACGGCTGGTTGGA 61.999 66.667 9.92 0.00 0.00 3.53
2029 4686 2.432628 GTCGACGGCTGGTTGGAG 60.433 66.667 0.00 0.00 0.00 3.86
2030 4687 2.915659 TCGACGGCTGGTTGGAGT 60.916 61.111 0.00 0.00 0.00 3.85
2031 4688 2.030562 CGACGGCTGGTTGGAGTT 59.969 61.111 0.00 0.00 0.00 3.01
2032 4689 2.027625 CGACGGCTGGTTGGAGTTC 61.028 63.158 0.00 0.00 0.00 3.01
2033 4690 2.027625 GACGGCTGGTTGGAGTTCG 61.028 63.158 0.00 0.00 0.00 3.95
2034 4691 2.342279 CGGCTGGTTGGAGTTCGA 59.658 61.111 0.00 0.00 0.00 3.71
2035 4692 1.738099 CGGCTGGTTGGAGTTCGAG 60.738 63.158 0.00 0.00 0.00 4.04
2036 4693 1.671742 GGCTGGTTGGAGTTCGAGA 59.328 57.895 0.00 0.00 0.00 4.04
2037 4694 0.250513 GGCTGGTTGGAGTTCGAGAT 59.749 55.000 0.00 0.00 0.00 2.75
2038 4695 1.480954 GGCTGGTTGGAGTTCGAGATA 59.519 52.381 0.00 0.00 0.00 1.98
2039 4696 2.482142 GGCTGGTTGGAGTTCGAGATAG 60.482 54.545 0.00 0.00 0.00 2.08
2040 4697 2.482142 GCTGGTTGGAGTTCGAGATAGG 60.482 54.545 0.00 0.00 0.00 2.57
2041 4698 2.761208 CTGGTTGGAGTTCGAGATAGGT 59.239 50.000 0.00 0.00 0.00 3.08
2042 4699 2.496070 TGGTTGGAGTTCGAGATAGGTG 59.504 50.000 0.00 0.00 0.00 4.00
2043 4700 2.758979 GGTTGGAGTTCGAGATAGGTGA 59.241 50.000 0.00 0.00 0.00 4.02
2044 4701 3.429135 GGTTGGAGTTCGAGATAGGTGAC 60.429 52.174 0.00 0.00 0.00 3.67
2046 4703 3.698289 TGGAGTTCGAGATAGGTGACTT 58.302 45.455 0.00 0.00 43.67 3.01
2047 4704 3.695060 TGGAGTTCGAGATAGGTGACTTC 59.305 47.826 0.00 0.00 43.67 3.01
2048 4705 3.067040 GGAGTTCGAGATAGGTGACTTCC 59.933 52.174 0.00 0.00 43.67 3.46
2049 4706 3.695060 GAGTTCGAGATAGGTGACTTCCA 59.305 47.826 0.00 0.00 43.67 3.53
2050 4707 3.444388 AGTTCGAGATAGGTGACTTCCAC 59.556 47.826 0.00 0.00 44.95 4.02
2066 4723 3.773117 CACACAGGTGGCGATTTTC 57.227 52.632 4.24 0.00 41.45 2.29
2067 4724 1.238439 CACACAGGTGGCGATTTTCT 58.762 50.000 4.24 0.00 41.45 2.52
2068 4725 1.608590 CACACAGGTGGCGATTTTCTT 59.391 47.619 4.24 0.00 41.45 2.52
2069 4726 1.880027 ACACAGGTGGCGATTTTCTTC 59.120 47.619 4.24 0.00 34.19 2.87
2070 4727 1.200020 CACAGGTGGCGATTTTCTTCC 59.800 52.381 0.00 0.00 0.00 3.46
2071 4728 1.073923 ACAGGTGGCGATTTTCTTCCT 59.926 47.619 0.00 0.00 0.00 3.36
2072 4729 2.162681 CAGGTGGCGATTTTCTTCCTT 58.837 47.619 0.00 0.00 0.00 3.36
2073 4730 2.558359 CAGGTGGCGATTTTCTTCCTTT 59.442 45.455 0.00 0.00 0.00 3.11
2074 4731 3.005791 CAGGTGGCGATTTTCTTCCTTTT 59.994 43.478 0.00 0.00 0.00 2.27
2075 4732 4.217550 CAGGTGGCGATTTTCTTCCTTTTA 59.782 41.667 0.00 0.00 0.00 1.52
2076 4733 4.830600 AGGTGGCGATTTTCTTCCTTTTAA 59.169 37.500 0.00 0.00 0.00 1.52
2077 4734 5.303333 AGGTGGCGATTTTCTTCCTTTTAAA 59.697 36.000 0.00 0.00 0.00 1.52
2078 4735 5.986741 GGTGGCGATTTTCTTCCTTTTAAAA 59.013 36.000 0.00 0.00 0.00 1.52
2079 4736 6.073980 GGTGGCGATTTTCTTCCTTTTAAAAC 60.074 38.462 0.00 0.00 0.00 2.43
2080 4737 6.477360 GTGGCGATTTTCTTCCTTTTAAAACA 59.523 34.615 0.00 0.00 0.00 2.83
2081 4738 7.010645 GTGGCGATTTTCTTCCTTTTAAAACAA 59.989 33.333 0.00 0.00 0.00 2.83
2082 4739 7.713073 TGGCGATTTTCTTCCTTTTAAAACAAT 59.287 29.630 0.00 0.00 0.00 2.71
2083 4740 9.198837 GGCGATTTTCTTCCTTTTAAAACAATA 57.801 29.630 0.00 0.00 0.00 1.90
2104 4761 9.793259 ACAATATGAAGTTTTTCCTTACTCTCA 57.207 29.630 0.00 0.00 32.09 3.27
2106 4763 9.793259 AATATGAAGTTTTTCCTTACTCTCACA 57.207 29.630 0.00 0.00 32.09 3.58
2107 4764 7.736447 ATGAAGTTTTTCCTTACTCTCACAG 57.264 36.000 0.00 0.00 32.09 3.66
2108 4765 5.527582 TGAAGTTTTTCCTTACTCTCACAGC 59.472 40.000 0.00 0.00 32.09 4.40
2109 4766 4.390264 AGTTTTTCCTTACTCTCACAGCC 58.610 43.478 0.00 0.00 0.00 4.85
2110 4767 4.103311 AGTTTTTCCTTACTCTCACAGCCT 59.897 41.667 0.00 0.00 0.00 4.58
2111 4768 3.963428 TTTCCTTACTCTCACAGCCTC 57.037 47.619 0.00 0.00 0.00 4.70
2112 4769 1.464734 TCCTTACTCTCACAGCCTCG 58.535 55.000 0.00 0.00 0.00 4.63
2113 4770 0.457851 CCTTACTCTCACAGCCTCGG 59.542 60.000 0.00 0.00 0.00 4.63
2114 4771 1.178276 CTTACTCTCACAGCCTCGGT 58.822 55.000 0.00 0.00 0.00 4.69
2115 4772 2.366533 CTTACTCTCACAGCCTCGGTA 58.633 52.381 0.00 0.00 0.00 4.02
2116 4773 2.730934 TACTCTCACAGCCTCGGTAT 57.269 50.000 0.00 0.00 0.00 2.73
2117 4774 1.853963 ACTCTCACAGCCTCGGTATT 58.146 50.000 0.00 0.00 0.00 1.89
2118 4775 2.180276 ACTCTCACAGCCTCGGTATTT 58.820 47.619 0.00 0.00 0.00 1.40
2119 4776 2.093973 ACTCTCACAGCCTCGGTATTTG 60.094 50.000 0.00 0.00 0.00 2.32
2120 4777 2.166459 CTCTCACAGCCTCGGTATTTGA 59.834 50.000 0.00 0.00 0.00 2.69
2121 4778 2.766263 TCTCACAGCCTCGGTATTTGAT 59.234 45.455 0.00 0.00 0.00 2.57
2122 4779 3.126831 CTCACAGCCTCGGTATTTGATC 58.873 50.000 0.00 0.00 0.00 2.92
2123 4780 1.860950 CACAGCCTCGGTATTTGATCG 59.139 52.381 0.00 0.00 0.00 3.69
2124 4781 1.754803 ACAGCCTCGGTATTTGATCGA 59.245 47.619 0.00 0.00 0.00 3.59
2125 4782 2.223829 ACAGCCTCGGTATTTGATCGAG 60.224 50.000 0.22 0.22 46.73 4.04
2131 4788 4.238761 TCGGTATTTGATCGAGATGACC 57.761 45.455 0.00 0.00 0.00 4.02
2132 4789 3.005472 TCGGTATTTGATCGAGATGACCC 59.995 47.826 0.00 0.00 0.00 4.46
2133 4790 3.243737 CGGTATTTGATCGAGATGACCCA 60.244 47.826 0.00 0.00 0.00 4.51
2134 4791 4.561530 CGGTATTTGATCGAGATGACCCAT 60.562 45.833 0.00 0.00 0.00 4.00
2135 4792 4.932200 GGTATTTGATCGAGATGACCCATC 59.068 45.833 0.00 0.00 40.80 3.51
2136 4793 4.694760 ATTTGATCGAGATGACCCATCA 57.305 40.909 9.30 0.00 42.72 3.07
2137 4794 3.459232 TTGATCGAGATGACCCATCAC 57.541 47.619 9.30 2.62 42.72 3.06
2138 4795 2.387757 TGATCGAGATGACCCATCACA 58.612 47.619 9.30 0.00 42.72 3.58
2139 4796 2.363359 TGATCGAGATGACCCATCACAG 59.637 50.000 9.30 1.24 42.72 3.66
2140 4797 1.114627 TCGAGATGACCCATCACAGG 58.885 55.000 9.30 0.00 42.72 4.00
2141 4798 0.826715 CGAGATGACCCATCACAGGT 59.173 55.000 9.30 0.00 42.72 4.00
2142 4799 1.472201 CGAGATGACCCATCACAGGTG 60.472 57.143 9.30 0.00 42.72 4.00
2143 4800 1.833630 GAGATGACCCATCACAGGTGA 59.166 52.381 4.37 4.37 42.72 4.02
2152 4809 1.375908 TCACAGGTGATGAAGCCGC 60.376 57.895 0.00 0.00 34.14 6.53
2153 4810 2.434884 ACAGGTGATGAAGCCGCG 60.435 61.111 0.00 0.00 0.00 6.46
2154 4811 3.197790 CAGGTGATGAAGCCGCGG 61.198 66.667 24.05 24.05 0.00 6.46
2172 4829 1.508632 GGCTGCAGTAGACGTTTTGA 58.491 50.000 16.64 0.00 0.00 2.69
2173 4830 2.076863 GGCTGCAGTAGACGTTTTGAT 58.923 47.619 16.64 0.00 0.00 2.57
2174 4831 2.159653 GGCTGCAGTAGACGTTTTGATG 60.160 50.000 16.64 0.00 0.00 3.07
2175 4832 2.159653 GCTGCAGTAGACGTTTTGATGG 60.160 50.000 16.64 0.00 0.00 3.51
2176 4833 3.067106 CTGCAGTAGACGTTTTGATGGT 58.933 45.455 5.25 0.00 0.00 3.55
2177 4834 2.805671 TGCAGTAGACGTTTTGATGGTG 59.194 45.455 0.00 0.00 0.00 4.17
2178 4835 2.412847 GCAGTAGACGTTTTGATGGTGC 60.413 50.000 0.00 0.00 0.00 5.01
2179 4836 3.067106 CAGTAGACGTTTTGATGGTGCT 58.933 45.455 0.00 0.00 0.00 4.40
2180 4837 3.067106 AGTAGACGTTTTGATGGTGCTG 58.933 45.455 0.00 0.00 0.00 4.41
2181 4838 0.593128 AGACGTTTTGATGGTGCTGC 59.407 50.000 0.00 0.00 0.00 5.25
2182 4839 0.310543 GACGTTTTGATGGTGCTGCA 59.689 50.000 0.00 0.00 0.00 4.41
2183 4840 0.743688 ACGTTTTGATGGTGCTGCAA 59.256 45.000 2.77 0.00 0.00 4.08
2184 4841 1.269206 ACGTTTTGATGGTGCTGCAAG 60.269 47.619 2.77 0.00 0.00 4.01
2185 4842 1.001487 CGTTTTGATGGTGCTGCAAGA 60.001 47.619 2.77 0.00 34.07 3.02
2186 4843 2.669364 GTTTTGATGGTGCTGCAAGAG 58.331 47.619 2.77 0.00 34.07 2.85
2194 4851 4.709840 GCTGCAAGAGCTTGAGGA 57.290 55.556 14.04 0.00 45.21 3.71
2195 4852 2.469058 GCTGCAAGAGCTTGAGGAG 58.531 57.895 14.04 7.08 45.21 3.69
2204 4861 4.298009 CTTGAGGAGCTGCAGTGG 57.702 61.111 16.64 0.00 0.00 4.00
2205 4862 1.675801 CTTGAGGAGCTGCAGTGGA 59.324 57.895 16.64 0.00 0.00 4.02
2206 4863 0.035881 CTTGAGGAGCTGCAGTGGAA 59.964 55.000 16.64 0.00 0.00 3.53
2207 4864 0.035881 TTGAGGAGCTGCAGTGGAAG 59.964 55.000 16.64 0.00 0.00 3.46
2208 4865 0.833409 TGAGGAGCTGCAGTGGAAGA 60.833 55.000 16.64 0.00 0.00 2.87
2209 4866 0.322975 GAGGAGCTGCAGTGGAAGAA 59.677 55.000 16.64 0.00 0.00 2.52
2210 4867 0.324285 AGGAGCTGCAGTGGAAGAAG 59.676 55.000 16.64 0.00 0.00 2.85
2211 4868 0.676151 GGAGCTGCAGTGGAAGAAGG 60.676 60.000 16.64 0.00 0.00 3.46
2212 4869 0.676151 GAGCTGCAGTGGAAGAAGGG 60.676 60.000 16.64 0.00 0.00 3.95
2213 4870 1.676967 GCTGCAGTGGAAGAAGGGG 60.677 63.158 16.64 0.00 0.00 4.79
2214 4871 1.676967 CTGCAGTGGAAGAAGGGGC 60.677 63.158 5.25 0.00 0.00 5.80
2215 4872 2.134630 CTGCAGTGGAAGAAGGGGCT 62.135 60.000 5.25 0.00 0.00 5.19
2216 4873 1.377856 GCAGTGGAAGAAGGGGCTC 60.378 63.158 0.00 0.00 0.00 4.70
2217 4874 2.069776 CAGTGGAAGAAGGGGCTCA 58.930 57.895 0.00 0.00 0.00 4.26
2218 4875 0.622665 CAGTGGAAGAAGGGGCTCAT 59.377 55.000 0.00 0.00 0.00 2.90
2219 4876 0.915364 AGTGGAAGAAGGGGCTCATC 59.085 55.000 0.00 0.00 0.00 2.92
2220 4877 0.620556 GTGGAAGAAGGGGCTCATCA 59.379 55.000 0.00 0.00 0.00 3.07
2221 4878 1.213926 GTGGAAGAAGGGGCTCATCAT 59.786 52.381 0.00 0.00 0.00 2.45
2222 4879 1.492176 TGGAAGAAGGGGCTCATCATC 59.508 52.381 0.00 0.00 0.00 2.92
2223 4880 1.542108 GGAAGAAGGGGCTCATCATCG 60.542 57.143 0.00 0.00 0.00 3.84
2224 4881 1.414181 GAAGAAGGGGCTCATCATCGA 59.586 52.381 0.00 0.00 0.00 3.59
2225 4882 1.500474 AGAAGGGGCTCATCATCGAA 58.500 50.000 0.00 0.00 0.00 3.71
2226 4883 1.415659 AGAAGGGGCTCATCATCGAAG 59.584 52.381 0.00 0.00 0.00 3.79
2227 4884 0.471617 AAGGGGCTCATCATCGAAGG 59.528 55.000 0.00 0.00 0.00 3.46
2228 4885 1.599240 GGGGCTCATCATCGAAGGC 60.599 63.158 0.00 0.00 0.00 4.35
2229 4886 1.146930 GGGCTCATCATCGAAGGCA 59.853 57.895 9.50 0.00 0.00 4.75
2230 4887 0.250640 GGGCTCATCATCGAAGGCAT 60.251 55.000 9.50 0.00 0.00 4.40
2231 4888 1.602311 GGCTCATCATCGAAGGCATT 58.398 50.000 2.98 0.00 0.00 3.56
2232 4889 1.266175 GGCTCATCATCGAAGGCATTG 59.734 52.381 2.98 0.00 0.00 2.82
2233 4890 2.216046 GCTCATCATCGAAGGCATTGA 58.784 47.619 0.00 0.00 0.00 2.57
2234 4891 2.223611 GCTCATCATCGAAGGCATTGAG 59.776 50.000 0.00 0.00 33.86 3.02
2235 4892 3.725490 CTCATCATCGAAGGCATTGAGA 58.275 45.455 0.00 0.00 32.77 3.27
2236 4893 4.316645 CTCATCATCGAAGGCATTGAGAT 58.683 43.478 0.00 0.00 32.77 2.75
2237 4894 5.473066 TCATCATCGAAGGCATTGAGATA 57.527 39.130 0.00 0.00 0.00 1.98
2238 4895 5.857268 TCATCATCGAAGGCATTGAGATAA 58.143 37.500 0.00 0.00 0.00 1.75
2239 4896 5.930569 TCATCATCGAAGGCATTGAGATAAG 59.069 40.000 0.00 0.00 0.00 1.73
2240 4897 4.635223 TCATCGAAGGCATTGAGATAAGG 58.365 43.478 0.00 0.00 0.00 2.69
2241 4898 2.838736 TCGAAGGCATTGAGATAAGGC 58.161 47.619 0.00 0.00 0.00 4.35
2242 4899 1.876156 CGAAGGCATTGAGATAAGGCC 59.124 52.381 7.19 7.19 46.54 5.19
2244 4901 3.706055 GGCATTGAGATAAGGCCGA 57.294 52.632 0.00 0.00 37.36 5.54
2245 4902 1.517242 GGCATTGAGATAAGGCCGAG 58.483 55.000 0.00 0.00 37.36 4.63
2246 4903 1.070758 GGCATTGAGATAAGGCCGAGA 59.929 52.381 0.00 0.00 37.36 4.04
2247 4904 2.485479 GGCATTGAGATAAGGCCGAGAA 60.485 50.000 0.00 0.00 37.36 2.87
2248 4905 3.206150 GCATTGAGATAAGGCCGAGAAA 58.794 45.455 0.00 0.00 0.00 2.52
2249 4906 3.002759 GCATTGAGATAAGGCCGAGAAAC 59.997 47.826 0.00 0.00 0.00 2.78
2250 4907 4.446371 CATTGAGATAAGGCCGAGAAACT 58.554 43.478 0.00 0.00 0.00 2.66
2251 4908 5.601662 CATTGAGATAAGGCCGAGAAACTA 58.398 41.667 0.00 0.00 0.00 2.24
2252 4909 5.670792 TTGAGATAAGGCCGAGAAACTAA 57.329 39.130 0.00 0.00 0.00 2.24
2253 4910 5.670792 TGAGATAAGGCCGAGAAACTAAA 57.329 39.130 0.00 0.00 0.00 1.85
2254 4911 6.235231 TGAGATAAGGCCGAGAAACTAAAT 57.765 37.500 0.00 0.00 0.00 1.40
2255 4912 7.356089 TGAGATAAGGCCGAGAAACTAAATA 57.644 36.000 0.00 0.00 0.00 1.40
2256 4913 7.788026 TGAGATAAGGCCGAGAAACTAAATAA 58.212 34.615 0.00 0.00 0.00 1.40
2257 4914 8.262227 TGAGATAAGGCCGAGAAACTAAATAAA 58.738 33.333 0.00 0.00 0.00 1.40
2258 4915 9.274206 GAGATAAGGCCGAGAAACTAAATAAAT 57.726 33.333 0.00 0.00 0.00 1.40
2307 4964 9.560860 AACATATAATACCAGATATGTCAGGGA 57.439 33.333 5.88 0.00 44.65 4.20
2308 4965 9.735362 ACATATAATACCAGATATGTCAGGGAT 57.265 33.333 5.88 0.00 42.82 3.85
2311 4968 5.768980 ATACCAGATATGTCAGGGATTGG 57.231 43.478 5.88 0.00 30.75 3.16
2312 4969 2.713167 ACCAGATATGTCAGGGATTGGG 59.287 50.000 5.88 0.00 35.44 4.12
2313 4970 2.040813 CCAGATATGTCAGGGATTGGGG 59.959 54.545 0.00 0.00 0.00 4.96
2314 4971 2.713167 CAGATATGTCAGGGATTGGGGT 59.287 50.000 0.00 0.00 0.00 4.95
2315 4972 2.713167 AGATATGTCAGGGATTGGGGTG 59.287 50.000 0.00 0.00 0.00 4.61
2316 4973 1.221635 TATGTCAGGGATTGGGGTGG 58.778 55.000 0.00 0.00 0.00 4.61
2317 4974 2.043953 GTCAGGGATTGGGGTGGC 60.044 66.667 0.00 0.00 0.00 5.01
2318 4975 2.204291 TCAGGGATTGGGGTGGCT 60.204 61.111 0.00 0.00 0.00 4.75
2319 4976 1.856873 TCAGGGATTGGGGTGGCTT 60.857 57.895 0.00 0.00 0.00 4.35
2320 4977 1.683365 CAGGGATTGGGGTGGCTTG 60.683 63.158 0.00 0.00 0.00 4.01
2321 4978 3.076916 GGGATTGGGGTGGCTTGC 61.077 66.667 0.00 0.00 0.00 4.01
2322 4979 2.037847 GGATTGGGGTGGCTTGCT 59.962 61.111 0.00 0.00 0.00 3.91
2323 4980 1.306296 GGATTGGGGTGGCTTGCTA 59.694 57.895 0.00 0.00 0.00 3.49
2324 4981 0.753111 GGATTGGGGTGGCTTGCTAG 60.753 60.000 0.00 0.00 0.00 3.42
2325 4982 0.753111 GATTGGGGTGGCTTGCTAGG 60.753 60.000 0.00 0.00 0.00 3.02
2326 4983 1.214305 ATTGGGGTGGCTTGCTAGGA 61.214 55.000 0.00 0.00 0.00 2.94
2327 4984 1.431195 TTGGGGTGGCTTGCTAGGAA 61.431 55.000 0.00 0.00 0.00 3.36
2328 4985 1.382629 GGGGTGGCTTGCTAGGAAA 59.617 57.895 0.00 0.00 0.00 3.13
2329 4986 0.033109 GGGGTGGCTTGCTAGGAAAT 60.033 55.000 0.00 0.00 0.00 2.17
2330 4987 1.619704 GGGGTGGCTTGCTAGGAAATT 60.620 52.381 0.00 0.00 0.00 1.82
2331 4988 1.751351 GGGTGGCTTGCTAGGAAATTC 59.249 52.381 0.00 0.00 0.00 2.17
2332 4989 2.446435 GGTGGCTTGCTAGGAAATTCA 58.554 47.619 0.00 0.00 0.00 2.57
2333 4990 3.026694 GGTGGCTTGCTAGGAAATTCAT 58.973 45.455 0.00 0.00 0.00 2.57
2334 4991 3.181483 GGTGGCTTGCTAGGAAATTCATG 60.181 47.826 0.00 0.00 0.00 3.07
2335 4992 3.445096 GTGGCTTGCTAGGAAATTCATGT 59.555 43.478 0.00 0.00 0.00 3.21
2336 4993 3.696051 TGGCTTGCTAGGAAATTCATGTC 59.304 43.478 0.00 0.00 0.00 3.06
2337 4994 3.696051 GGCTTGCTAGGAAATTCATGTCA 59.304 43.478 0.00 0.00 0.00 3.58
2338 4995 4.439289 GGCTTGCTAGGAAATTCATGTCAC 60.439 45.833 0.00 0.00 0.00 3.67
2339 4996 4.728882 GCTTGCTAGGAAATTCATGTCACG 60.729 45.833 0.00 0.00 0.00 4.35
2340 4997 2.677836 TGCTAGGAAATTCATGTCACGC 59.322 45.455 0.00 0.00 0.00 5.34
2341 4998 2.939103 GCTAGGAAATTCATGTCACGCT 59.061 45.455 0.00 0.00 0.00 5.07
2342 4999 3.375299 GCTAGGAAATTCATGTCACGCTT 59.625 43.478 0.00 0.00 0.00 4.68
2343 5000 4.142600 GCTAGGAAATTCATGTCACGCTTT 60.143 41.667 0.00 0.00 0.00 3.51
2344 5001 4.164822 AGGAAATTCATGTCACGCTTTG 57.835 40.909 0.00 0.00 0.00 2.77
2345 5002 3.057315 AGGAAATTCATGTCACGCTTTGG 60.057 43.478 0.00 0.00 0.00 3.28
2346 5003 3.057596 GGAAATTCATGTCACGCTTTGGA 60.058 43.478 0.00 0.00 0.00 3.53
2347 5004 4.380867 GGAAATTCATGTCACGCTTTGGAT 60.381 41.667 0.00 0.00 0.00 3.41
2348 5005 3.770263 ATTCATGTCACGCTTTGGATG 57.230 42.857 0.00 0.00 0.00 3.51
2349 5006 2.183478 TCATGTCACGCTTTGGATGT 57.817 45.000 0.00 0.00 0.00 3.06
2350 5007 2.076100 TCATGTCACGCTTTGGATGTC 58.924 47.619 0.00 0.00 0.00 3.06
2351 5008 1.078709 ATGTCACGCTTTGGATGTCG 58.921 50.000 0.00 0.00 0.00 4.35
2352 5009 0.032815 TGTCACGCTTTGGATGTCGA 59.967 50.000 0.00 0.00 0.00 4.20
2353 5010 0.716108 GTCACGCTTTGGATGTCGAG 59.284 55.000 0.00 0.00 0.00 4.04
2354 5011 1.014044 TCACGCTTTGGATGTCGAGC 61.014 55.000 0.00 0.00 0.00 5.03
2355 5012 1.005037 ACGCTTTGGATGTCGAGCA 60.005 52.632 0.00 0.00 34.90 4.26
2356 5013 1.016130 ACGCTTTGGATGTCGAGCAG 61.016 55.000 0.00 0.00 34.90 4.24
2357 5014 1.699656 CGCTTTGGATGTCGAGCAGG 61.700 60.000 0.00 0.00 34.90 4.85
2358 5015 0.391661 GCTTTGGATGTCGAGCAGGA 60.392 55.000 0.00 0.00 35.29 3.86
2359 5016 1.745141 GCTTTGGATGTCGAGCAGGAT 60.745 52.381 0.00 0.00 35.29 3.24
2360 5017 2.208431 CTTTGGATGTCGAGCAGGATC 58.792 52.381 0.00 0.00 0.00 3.36
2361 5018 1.489481 TTGGATGTCGAGCAGGATCT 58.511 50.000 0.00 0.00 0.00 2.75
2362 5019 2.364972 TGGATGTCGAGCAGGATCTA 57.635 50.000 0.00 0.00 0.00 1.98
2363 5020 2.666317 TGGATGTCGAGCAGGATCTAA 58.334 47.619 0.00 0.00 0.00 2.10
2364 5021 3.234353 TGGATGTCGAGCAGGATCTAAT 58.766 45.455 0.00 0.00 0.00 1.73
2365 5022 3.643320 TGGATGTCGAGCAGGATCTAATT 59.357 43.478 0.00 0.00 0.00 1.40
2366 5023 4.832823 TGGATGTCGAGCAGGATCTAATTA 59.167 41.667 0.00 0.00 0.00 1.40
2367 5024 5.304357 TGGATGTCGAGCAGGATCTAATTAA 59.696 40.000 0.00 0.00 0.00 1.40
2368 5025 6.014242 TGGATGTCGAGCAGGATCTAATTAAT 60.014 38.462 0.00 0.00 0.00 1.40
2369 5026 6.312426 GGATGTCGAGCAGGATCTAATTAATG 59.688 42.308 0.00 0.00 0.00 1.90
2370 5027 6.161855 TGTCGAGCAGGATCTAATTAATGT 57.838 37.500 0.00 0.00 0.00 2.71
2371 5028 6.582636 TGTCGAGCAGGATCTAATTAATGTT 58.417 36.000 0.00 0.00 0.00 2.71
2372 5029 7.047891 TGTCGAGCAGGATCTAATTAATGTTT 58.952 34.615 0.00 0.00 0.00 2.83
2373 5030 7.011389 TGTCGAGCAGGATCTAATTAATGTTTG 59.989 37.037 0.00 0.00 0.00 2.93
2374 5031 6.017934 TCGAGCAGGATCTAATTAATGTTTGC 60.018 38.462 0.00 3.88 0.00 3.68
2375 5032 6.017605 CGAGCAGGATCTAATTAATGTTTGCT 60.018 38.462 11.14 11.14 40.49 3.91
2376 5033 7.467811 CGAGCAGGATCTAATTAATGTTTGCTT 60.468 37.037 12.09 1.47 38.19 3.91
2377 5034 8.071177 AGCAGGATCTAATTAATGTTTGCTTT 57.929 30.769 7.32 0.00 34.83 3.51
2378 5035 8.534496 AGCAGGATCTAATTAATGTTTGCTTTT 58.466 29.630 7.32 0.00 34.83 2.27
2379 5036 8.811378 GCAGGATCTAATTAATGTTTGCTTTTC 58.189 33.333 0.00 0.00 0.00 2.29
2380 5037 9.859427 CAGGATCTAATTAATGTTTGCTTTTCA 57.141 29.630 0.00 0.00 0.00 2.69
2387 5044 8.947055 AATTAATGTTTGCTTTTCAGAAGTGT 57.053 26.923 0.00 0.00 0.00 3.55
2388 5045 7.985634 TTAATGTTTGCTTTTCAGAAGTGTC 57.014 32.000 0.00 0.00 0.00 3.67
2389 5046 4.370364 TGTTTGCTTTTCAGAAGTGTCC 57.630 40.909 0.00 0.00 0.00 4.02
2390 5047 4.016444 TGTTTGCTTTTCAGAAGTGTCCT 58.984 39.130 0.00 0.00 0.00 3.85
2391 5048 4.142403 TGTTTGCTTTTCAGAAGTGTCCTG 60.142 41.667 0.00 0.00 0.00 3.86
2392 5049 1.949525 TGCTTTTCAGAAGTGTCCTGC 59.050 47.619 0.00 0.00 0.00 4.85
2393 5050 2.225467 GCTTTTCAGAAGTGTCCTGCT 58.775 47.619 0.00 0.00 0.00 4.24
2394 5051 2.225255 GCTTTTCAGAAGTGTCCTGCTC 59.775 50.000 0.00 0.00 0.00 4.26
2395 5052 3.470709 CTTTTCAGAAGTGTCCTGCTCA 58.529 45.455 0.00 0.00 0.00 4.26
2396 5053 3.777106 TTTCAGAAGTGTCCTGCTCAT 57.223 42.857 0.00 0.00 0.00 2.90
2397 5054 2.756840 TCAGAAGTGTCCTGCTCATG 57.243 50.000 0.00 0.00 0.00 3.07
2398 5055 2.250924 TCAGAAGTGTCCTGCTCATGA 58.749 47.619 0.00 0.00 0.00 3.07
2399 5056 2.233186 TCAGAAGTGTCCTGCTCATGAG 59.767 50.000 18.84 18.84 0.00 2.90
2400 5057 2.028294 CAGAAGTGTCCTGCTCATGAGT 60.028 50.000 23.38 0.26 0.00 3.41
2401 5058 2.636893 AGAAGTGTCCTGCTCATGAGTT 59.363 45.455 23.38 7.56 0.00 3.01
2402 5059 3.072184 AGAAGTGTCCTGCTCATGAGTTT 59.928 43.478 23.38 6.18 0.00 2.66
2403 5060 3.051081 AGTGTCCTGCTCATGAGTTTC 57.949 47.619 23.38 8.14 0.00 2.78
2404 5061 2.079925 GTGTCCTGCTCATGAGTTTCC 58.920 52.381 23.38 7.78 0.00 3.13
2405 5062 1.980765 TGTCCTGCTCATGAGTTTCCT 59.019 47.619 23.38 0.00 0.00 3.36
2406 5063 2.373169 TGTCCTGCTCATGAGTTTCCTT 59.627 45.455 23.38 0.00 0.00 3.36
2407 5064 3.181440 TGTCCTGCTCATGAGTTTCCTTT 60.181 43.478 23.38 0.00 0.00 3.11
2408 5065 4.041567 TGTCCTGCTCATGAGTTTCCTTTA 59.958 41.667 23.38 2.15 0.00 1.85
2409 5066 5.189180 GTCCTGCTCATGAGTTTCCTTTAT 58.811 41.667 23.38 0.00 0.00 1.40
2410 5067 5.065731 GTCCTGCTCATGAGTTTCCTTTATG 59.934 44.000 23.38 0.00 0.00 1.90
2411 5068 4.337555 CCTGCTCATGAGTTTCCTTTATGG 59.662 45.833 23.38 7.59 37.10 2.74
2412 5069 4.922206 TGCTCATGAGTTTCCTTTATGGT 58.078 39.130 23.38 0.00 37.07 3.55
2413 5070 4.701651 TGCTCATGAGTTTCCTTTATGGTG 59.298 41.667 23.38 0.00 37.07 4.17
2414 5071 4.439289 GCTCATGAGTTTCCTTTATGGTGC 60.439 45.833 23.38 0.69 37.07 5.01
2415 5072 4.661222 TCATGAGTTTCCTTTATGGTGCA 58.339 39.130 0.00 0.00 37.07 4.57
2416 5073 5.076182 TCATGAGTTTCCTTTATGGTGCAA 58.924 37.500 0.00 0.00 37.07 4.08
2417 5074 5.716228 TCATGAGTTTCCTTTATGGTGCAAT 59.284 36.000 0.00 0.00 37.07 3.56
2418 5075 6.889177 TCATGAGTTTCCTTTATGGTGCAATA 59.111 34.615 0.00 0.00 37.07 1.90
2419 5076 7.560991 TCATGAGTTTCCTTTATGGTGCAATAT 59.439 33.333 0.00 0.00 37.07 1.28
2420 5077 8.849168 CATGAGTTTCCTTTATGGTGCAATATA 58.151 33.333 0.00 0.00 37.07 0.86
2421 5078 8.995027 TGAGTTTCCTTTATGGTGCAATATAT 57.005 30.769 0.00 0.00 37.07 0.86
2433 5090 7.433708 TGGTGCAATATATATAGTTGTGTGC 57.566 36.000 6.42 6.42 0.00 4.57
2434 5091 6.995091 TGGTGCAATATATATAGTTGTGTGCA 59.005 34.615 10.52 10.52 37.15 4.57
2435 5092 7.665145 TGGTGCAATATATATAGTTGTGTGCAT 59.335 33.333 15.45 0.00 41.09 3.96
2436 5093 8.177663 GGTGCAATATATATAGTTGTGTGCATC 58.822 37.037 15.45 12.56 41.09 3.91
2437 5094 8.939929 GTGCAATATATATAGTTGTGTGCATCT 58.060 33.333 15.45 0.00 41.09 2.90
2444 5101 9.809096 ATATATAGTTGTGTGCATCTATACAGC 57.191 33.333 0.00 0.00 40.13 4.40
2445 5102 3.535561 AGTTGTGTGCATCTATACAGCC 58.464 45.455 0.00 0.00 0.00 4.85
2446 5103 3.055167 AGTTGTGTGCATCTATACAGCCA 60.055 43.478 0.00 0.00 0.00 4.75
2447 5104 3.625649 TGTGTGCATCTATACAGCCAA 57.374 42.857 0.00 0.00 0.00 4.52
2448 5105 4.155063 TGTGTGCATCTATACAGCCAAT 57.845 40.909 0.00 0.00 0.00 3.16
2449 5106 5.289083 TGTGTGCATCTATACAGCCAATA 57.711 39.130 0.00 0.00 0.00 1.90
2450 5107 5.868454 TGTGTGCATCTATACAGCCAATAT 58.132 37.500 0.00 0.00 0.00 1.28
2451 5108 7.003402 TGTGTGCATCTATACAGCCAATATA 57.997 36.000 0.00 0.00 0.00 0.86
2452 5109 6.873605 TGTGTGCATCTATACAGCCAATATAC 59.126 38.462 0.00 0.00 0.00 1.47
2453 5110 7.099764 GTGTGCATCTATACAGCCAATATACT 58.900 38.462 0.00 0.00 0.00 2.12
2454 5111 8.251026 GTGTGCATCTATACAGCCAATATACTA 58.749 37.037 0.00 0.00 0.00 1.82
2455 5112 8.811994 TGTGCATCTATACAGCCAATATACTAA 58.188 33.333 0.00 0.00 0.00 2.24
2456 5113 9.653287 GTGCATCTATACAGCCAATATACTAAA 57.347 33.333 0.00 0.00 0.00 1.85
2476 5133 7.891561 ACTAAATAAACAATTTGCTGCCTACA 58.108 30.769 0.00 0.00 38.29 2.74
2477 5134 8.531146 ACTAAATAAACAATTTGCTGCCTACAT 58.469 29.630 0.00 0.00 38.29 2.29
2478 5135 7.832503 AAATAAACAATTTGCTGCCTACATC 57.167 32.000 0.00 0.00 36.41 3.06
2479 5136 4.870123 AAACAATTTGCTGCCTACATCA 57.130 36.364 0.00 0.00 0.00 3.07
2480 5137 4.445452 AACAATTTGCTGCCTACATCAG 57.555 40.909 0.00 0.00 34.79 2.90
2488 5145 3.865011 CTGCCTACATCAGCTATCGAT 57.135 47.619 2.16 2.16 0.00 3.59
2489 5146 3.509740 CTGCCTACATCAGCTATCGATG 58.490 50.000 8.54 10.21 44.77 3.84
2490 5147 2.232208 TGCCTACATCAGCTATCGATGG 59.768 50.000 8.54 6.23 43.75 3.51
2491 5148 2.417924 GCCTACATCAGCTATCGATGGG 60.418 54.545 8.54 9.41 43.75 4.00
2492 5149 2.828520 CCTACATCAGCTATCGATGGGT 59.171 50.000 8.54 8.12 43.75 4.51
2493 5150 2.827800 ACATCAGCTATCGATGGGTG 57.172 50.000 28.74 28.74 43.75 4.61
2494 5151 1.345741 ACATCAGCTATCGATGGGTGG 59.654 52.381 31.97 22.37 43.75 4.61
2495 5152 0.322975 ATCAGCTATCGATGGGTGGC 59.677 55.000 31.97 17.20 37.37 5.01
2496 5153 1.048160 TCAGCTATCGATGGGTGGCA 61.048 55.000 31.97 17.06 37.37 4.92
2497 5154 0.179048 CAGCTATCGATGGGTGGCAA 60.179 55.000 27.47 0.00 33.81 4.52
2498 5155 0.179045 AGCTATCGATGGGTGGCAAC 60.179 55.000 13.01 0.00 0.00 4.17
2511 5168 2.865119 TGGCAACAGATCTGATGTGT 57.135 45.000 29.27 14.04 46.17 3.72
2512 5169 3.979101 TGGCAACAGATCTGATGTGTA 57.021 42.857 29.27 14.19 46.17 2.90
2513 5170 3.599343 TGGCAACAGATCTGATGTGTAC 58.401 45.455 29.27 17.54 46.17 2.90
2514 5171 2.939103 GGCAACAGATCTGATGTGTACC 59.061 50.000 29.27 18.32 35.51 3.34
2515 5172 2.604914 GCAACAGATCTGATGTGTACCG 59.395 50.000 29.27 12.44 35.51 4.02
2516 5173 3.676049 GCAACAGATCTGATGTGTACCGA 60.676 47.826 29.27 0.00 35.51 4.69
2517 5174 4.494484 CAACAGATCTGATGTGTACCGAA 58.506 43.478 29.27 0.00 35.51 4.30
2518 5175 5.111989 CAACAGATCTGATGTGTACCGAAT 58.888 41.667 29.27 1.76 35.51 3.34
2519 5176 4.686972 ACAGATCTGATGTGTACCGAATG 58.313 43.478 29.27 0.00 34.71 2.67
2520 5177 4.402474 ACAGATCTGATGTGTACCGAATGA 59.598 41.667 29.27 0.00 34.71 2.57
2521 5178 5.105351 ACAGATCTGATGTGTACCGAATGAA 60.105 40.000 29.27 0.00 34.71 2.57
2522 5179 5.812127 CAGATCTGATGTGTACCGAATGAAA 59.188 40.000 18.34 0.00 0.00 2.69
2523 5180 6.481313 CAGATCTGATGTGTACCGAATGAAAT 59.519 38.462 18.34 0.00 0.00 2.17
2524 5181 6.481313 AGATCTGATGTGTACCGAATGAAATG 59.519 38.462 0.00 0.00 0.00 2.32
2525 5182 5.729510 TCTGATGTGTACCGAATGAAATGA 58.270 37.500 0.00 0.00 0.00 2.57
2526 5183 6.169800 TCTGATGTGTACCGAATGAAATGAA 58.830 36.000 0.00 0.00 0.00 2.57
2527 5184 6.652900 TCTGATGTGTACCGAATGAAATGAAA 59.347 34.615 0.00 0.00 0.00 2.69
2528 5185 6.607689 TGATGTGTACCGAATGAAATGAAAC 58.392 36.000 0.00 0.00 0.00 2.78
2529 5186 5.024768 TGTGTACCGAATGAAATGAAACG 57.975 39.130 0.00 0.00 0.00 3.60
2530 5187 4.512198 TGTGTACCGAATGAAATGAAACGT 59.488 37.500 0.00 0.00 0.00 3.99
2531 5188 5.007823 TGTGTACCGAATGAAATGAAACGTT 59.992 36.000 0.00 0.00 0.00 3.99
2532 5189 5.338559 GTGTACCGAATGAAATGAAACGTTG 59.661 40.000 0.00 0.00 0.00 4.10
2533 5190 4.561735 ACCGAATGAAATGAAACGTTGT 57.438 36.364 0.00 0.00 0.00 3.32
2534 5191 4.533222 ACCGAATGAAATGAAACGTTGTC 58.467 39.130 0.00 2.49 0.00 3.18
2535 5192 3.911964 CCGAATGAAATGAAACGTTGTCC 59.088 43.478 0.00 0.00 0.00 4.02
2536 5193 4.532276 CGAATGAAATGAAACGTTGTCCA 58.468 39.130 0.00 0.71 0.00 4.02
2537 5194 5.153513 CGAATGAAATGAAACGTTGTCCAT 58.846 37.500 0.00 3.36 0.00 3.41
2538 5195 6.310960 CGAATGAAATGAAACGTTGTCCATA 58.689 36.000 0.00 0.00 0.00 2.74
2539 5196 6.966632 CGAATGAAATGAAACGTTGTCCATAT 59.033 34.615 0.00 0.00 0.00 1.78
2540 5197 8.119845 CGAATGAAATGAAACGTTGTCCATATA 58.880 33.333 0.00 0.00 0.00 0.86
2541 5198 9.950680 GAATGAAATGAAACGTTGTCCATATAT 57.049 29.630 0.00 0.24 0.00 0.86
2544 5201 9.781834 TGAAATGAAACGTTGTCCATATATTTC 57.218 29.630 0.00 11.88 33.65 2.17
2545 5202 8.835467 AAATGAAACGTTGTCCATATATTTCG 57.165 30.769 0.00 0.00 0.00 3.46
2546 5203 5.802064 TGAAACGTTGTCCATATATTTCGC 58.198 37.500 0.00 0.00 0.00 4.70
2547 5204 4.806342 AACGTTGTCCATATATTTCGCC 57.194 40.909 0.00 0.00 0.00 5.54
2548 5205 3.135994 ACGTTGTCCATATATTTCGCCC 58.864 45.455 0.00 0.00 0.00 6.13
2549 5206 2.156891 CGTTGTCCATATATTTCGCCCG 59.843 50.000 0.00 0.00 0.00 6.13
2550 5207 3.395639 GTTGTCCATATATTTCGCCCGA 58.604 45.455 0.00 0.00 0.00 5.14
2551 5208 3.973206 TGTCCATATATTTCGCCCGAT 57.027 42.857 0.00 0.00 0.00 4.18
2552 5209 3.595173 TGTCCATATATTTCGCCCGATG 58.405 45.455 0.00 0.00 0.00 3.84
2553 5210 3.259625 TGTCCATATATTTCGCCCGATGA 59.740 43.478 0.00 0.00 0.00 2.92
2554 5211 4.081142 TGTCCATATATTTCGCCCGATGAT 60.081 41.667 0.00 0.00 0.00 2.45
2555 5212 4.508124 GTCCATATATTTCGCCCGATGATC 59.492 45.833 0.00 0.00 0.00 2.92
2556 5213 3.809832 CCATATATTTCGCCCGATGATCC 59.190 47.826 0.00 0.00 0.00 3.36
2557 5214 4.441792 CATATATTTCGCCCGATGATCCA 58.558 43.478 0.00 0.00 0.00 3.41
2558 5215 2.455674 TATTTCGCCCGATGATCCAG 57.544 50.000 0.00 0.00 0.00 3.86
2559 5216 0.469917 ATTTCGCCCGATGATCCAGT 59.530 50.000 0.00 0.00 0.00 4.00
2560 5217 0.461870 TTTCGCCCGATGATCCAGTG 60.462 55.000 0.00 0.00 0.00 3.66
2561 5218 2.923426 TTCGCCCGATGATCCAGTGC 62.923 60.000 0.00 0.00 0.00 4.40
2562 5219 2.190313 GCCCGATGATCCAGTGCA 59.810 61.111 0.00 0.00 0.00 4.57
2563 5220 1.451927 GCCCGATGATCCAGTGCAA 60.452 57.895 0.00 0.00 0.00 4.08
2564 5221 1.031571 GCCCGATGATCCAGTGCAAA 61.032 55.000 0.00 0.00 0.00 3.68
2565 5222 1.462616 CCCGATGATCCAGTGCAAAA 58.537 50.000 0.00 0.00 0.00 2.44
2566 5223 1.133025 CCCGATGATCCAGTGCAAAAC 59.867 52.381 0.00 0.00 0.00 2.43
2567 5224 1.811965 CCGATGATCCAGTGCAAAACA 59.188 47.619 0.00 0.00 0.00 2.83
2568 5225 2.159476 CCGATGATCCAGTGCAAAACAG 60.159 50.000 0.00 0.00 0.00 3.16
2569 5226 2.730090 CGATGATCCAGTGCAAAACAGC 60.730 50.000 0.00 0.00 0.00 4.40
2570 5227 0.961019 TGATCCAGTGCAAAACAGCC 59.039 50.000 0.00 0.00 0.00 4.85
2571 5228 0.244721 GATCCAGTGCAAAACAGCCC 59.755 55.000 0.00 0.00 0.00 5.19
2572 5229 0.469705 ATCCAGTGCAAAACAGCCCA 60.470 50.000 0.00 0.00 0.00 5.36
2573 5230 0.469705 TCCAGTGCAAAACAGCCCAT 60.470 50.000 0.00 0.00 0.00 4.00
2574 5231 0.037975 CCAGTGCAAAACAGCCCATC 60.038 55.000 0.00 0.00 0.00 3.51
2575 5232 0.675083 CAGTGCAAAACAGCCCATCA 59.325 50.000 0.00 0.00 0.00 3.07
2576 5233 1.274167 CAGTGCAAAACAGCCCATCAT 59.726 47.619 0.00 0.00 0.00 2.45
2577 5234 2.492881 CAGTGCAAAACAGCCCATCATA 59.507 45.455 0.00 0.00 0.00 2.15
2578 5235 3.131577 CAGTGCAAAACAGCCCATCATAT 59.868 43.478 0.00 0.00 0.00 1.78
2579 5236 3.382546 AGTGCAAAACAGCCCATCATATC 59.617 43.478 0.00 0.00 0.00 1.63
2580 5237 2.358582 TGCAAAACAGCCCATCATATCG 59.641 45.455 0.00 0.00 0.00 2.92
2581 5238 2.618241 GCAAAACAGCCCATCATATCGA 59.382 45.455 0.00 0.00 0.00 3.59
2582 5239 3.254166 GCAAAACAGCCCATCATATCGAT 59.746 43.478 2.16 2.16 33.27 3.59
2583 5240 4.614535 GCAAAACAGCCCATCATATCGATC 60.615 45.833 0.00 0.00 29.21 3.69
2584 5241 3.340814 AACAGCCCATCATATCGATCC 57.659 47.619 0.00 0.00 29.21 3.36
2585 5242 2.259917 ACAGCCCATCATATCGATCCA 58.740 47.619 0.00 0.00 29.21 3.41
2586 5243 2.235650 ACAGCCCATCATATCGATCCAG 59.764 50.000 0.00 0.00 29.21 3.86
2587 5244 2.235650 CAGCCCATCATATCGATCCAGT 59.764 50.000 0.00 0.00 29.21 4.00
2588 5245 3.448660 CAGCCCATCATATCGATCCAGTA 59.551 47.826 0.00 0.00 29.21 2.74
2589 5246 4.081476 CAGCCCATCATATCGATCCAGTAA 60.081 45.833 0.00 0.00 29.21 2.24
2590 5247 4.718774 AGCCCATCATATCGATCCAGTAAT 59.281 41.667 0.00 0.00 29.21 1.89
2591 5248 5.190528 AGCCCATCATATCGATCCAGTAATT 59.809 40.000 0.00 0.00 29.21 1.40
2592 5249 6.384015 AGCCCATCATATCGATCCAGTAATTA 59.616 38.462 0.00 0.00 29.21 1.40
2593 5250 6.703607 GCCCATCATATCGATCCAGTAATTAG 59.296 42.308 0.00 0.00 29.21 1.73
2594 5251 7.212976 CCCATCATATCGATCCAGTAATTAGG 58.787 42.308 0.00 0.00 29.21 2.69
2595 5252 7.147655 CCCATCATATCGATCCAGTAATTAGGT 60.148 40.741 0.00 0.00 29.21 3.08
2596 5253 7.708322 CCATCATATCGATCCAGTAATTAGGTG 59.292 40.741 0.00 0.00 29.21 4.00
2597 5254 8.470002 CATCATATCGATCCAGTAATTAGGTGA 58.530 37.037 0.00 0.00 29.21 4.02
2598 5255 8.595362 TCATATCGATCCAGTAATTAGGTGAT 57.405 34.615 0.00 0.00 0.00 3.06
2599 5256 8.687242 TCATATCGATCCAGTAATTAGGTGATC 58.313 37.037 0.00 7.50 0.00 2.92
2600 5257 6.918067 ATCGATCCAGTAATTAGGTGATCA 57.082 37.500 13.96 0.00 31.27 2.92
2601 5258 6.332735 TCGATCCAGTAATTAGGTGATCAG 57.667 41.667 0.00 9.21 31.27 2.90
2602 5259 4.926238 CGATCCAGTAATTAGGTGATCAGC 59.074 45.833 17.19 17.19 31.27 4.26
2603 5260 4.689612 TCCAGTAATTAGGTGATCAGCC 57.310 45.455 20.92 12.97 0.00 4.85
2604 5261 4.298626 TCCAGTAATTAGGTGATCAGCCT 58.701 43.478 20.92 18.88 40.00 4.58
2605 5262 4.721776 TCCAGTAATTAGGTGATCAGCCTT 59.278 41.667 20.92 14.12 37.54 4.35
2606 5263 5.903010 TCCAGTAATTAGGTGATCAGCCTTA 59.097 40.000 20.92 13.20 37.54 2.69
2607 5264 6.558775 TCCAGTAATTAGGTGATCAGCCTTAT 59.441 38.462 20.92 13.85 37.54 1.73
2608 5265 6.876257 CCAGTAATTAGGTGATCAGCCTTATC 59.124 42.308 20.92 8.11 37.54 1.75
2609 5266 7.445121 CAGTAATTAGGTGATCAGCCTTATCA 58.555 38.462 20.92 2.26 37.54 2.15
2610 5267 8.099537 CAGTAATTAGGTGATCAGCCTTATCAT 58.900 37.037 20.92 3.64 35.87 2.45
2611 5268 8.099537 AGTAATTAGGTGATCAGCCTTATCATG 58.900 37.037 20.92 0.00 35.87 3.07
2612 5269 5.894298 TTAGGTGATCAGCCTTATCATGT 57.106 39.130 20.92 2.18 35.87 3.21
2613 5270 4.785346 AGGTGATCAGCCTTATCATGTT 57.215 40.909 20.92 0.00 35.87 2.71
2614 5271 4.458397 AGGTGATCAGCCTTATCATGTTG 58.542 43.478 20.92 0.00 35.87 3.33
2615 5272 3.567164 GGTGATCAGCCTTATCATGTTGG 59.433 47.826 14.08 0.00 35.87 3.77
2616 5273 4.202441 GTGATCAGCCTTATCATGTTGGT 58.798 43.478 0.00 0.00 35.87 3.67
2617 5274 5.368145 GTGATCAGCCTTATCATGTTGGTA 58.632 41.667 0.00 0.00 35.87 3.25
2618 5275 6.000219 GTGATCAGCCTTATCATGTTGGTAT 59.000 40.000 0.00 0.00 35.87 2.73
2619 5276 7.161404 GTGATCAGCCTTATCATGTTGGTATA 58.839 38.462 0.00 0.00 35.87 1.47
2620 5277 7.826252 GTGATCAGCCTTATCATGTTGGTATAT 59.174 37.037 0.00 0.00 35.87 0.86
2621 5278 9.045745 TGATCAGCCTTATCATGTTGGTATATA 57.954 33.333 0.00 0.00 0.00 0.86
2622 5279 9.319143 GATCAGCCTTATCATGTTGGTATATAC 57.681 37.037 4.14 4.14 0.00 1.47
2623 5280 8.435931 TCAGCCTTATCATGTTGGTATATACT 57.564 34.615 12.54 0.00 0.00 2.12
2624 5281 8.531982 TCAGCCTTATCATGTTGGTATATACTC 58.468 37.037 12.54 3.99 0.00 2.59
2625 5282 7.766278 CAGCCTTATCATGTTGGTATATACTCC 59.234 40.741 12.54 0.00 0.00 3.85
2626 5283 7.048512 GCCTTATCATGTTGGTATATACTCCC 58.951 42.308 12.54 0.00 0.00 4.30
2627 5284 7.092846 GCCTTATCATGTTGGTATATACTCCCT 60.093 40.741 12.54 0.00 0.00 4.20
2628 5285 8.478877 CCTTATCATGTTGGTATATACTCCCTC 58.521 40.741 12.54 0.00 0.00 4.30
2629 5286 9.261035 CTTATCATGTTGGTATATACTCCCTCT 57.739 37.037 12.54 0.00 0.00 3.69
2630 5287 6.918067 TCATGTTGGTATATACTCCCTCTG 57.082 41.667 12.54 4.70 0.00 3.35
2631 5288 6.382087 TCATGTTGGTATATACTCCCTCTGT 58.618 40.000 12.54 0.00 0.00 3.41
2632 5289 6.844388 TCATGTTGGTATATACTCCCTCTGTT 59.156 38.462 12.54 0.00 0.00 3.16
2633 5290 6.726490 TGTTGGTATATACTCCCTCTGTTC 57.274 41.667 12.54 0.00 0.00 3.18
2634 5291 5.601313 TGTTGGTATATACTCCCTCTGTTCC 59.399 44.000 12.54 0.00 0.00 3.62
2635 5292 5.681494 TGGTATATACTCCCTCTGTTCCT 57.319 43.478 12.54 0.00 0.00 3.36
2636 5293 5.394738 TGGTATATACTCCCTCTGTTCCTG 58.605 45.833 12.54 0.00 0.00 3.86
2637 5294 4.773149 GGTATATACTCCCTCTGTTCCTGG 59.227 50.000 12.54 0.00 0.00 4.45
2638 5295 4.834406 ATATACTCCCTCTGTTCCTGGA 57.166 45.455 0.00 0.00 0.00 3.86
2639 5296 3.491766 ATACTCCCTCTGTTCCTGGAA 57.508 47.619 4.68 4.68 0.00 3.53
2640 5297 1.353091 ACTCCCTCTGTTCCTGGAAC 58.647 55.000 28.50 28.50 42.26 3.62
2641 5298 0.247736 CTCCCTCTGTTCCTGGAACG 59.752 60.000 28.92 23.47 44.55 3.95
2642 5299 1.192146 TCCCTCTGTTCCTGGAACGG 61.192 60.000 33.14 33.14 46.70 4.44
2646 5303 3.478780 TGTTCCTGGAACGGAGGG 58.521 61.111 28.92 0.00 44.55 4.30
2647 5304 1.152204 TGTTCCTGGAACGGAGGGA 60.152 57.895 28.92 12.10 44.55 4.20
2648 5305 1.192146 TGTTCCTGGAACGGAGGGAG 61.192 60.000 28.92 0.00 44.55 4.30
2649 5306 1.157751 TTCCTGGAACGGAGGGAGT 59.842 57.895 4.68 0.00 36.31 3.85
2650 5307 0.410663 TTCCTGGAACGGAGGGAGTA 59.589 55.000 4.68 0.00 36.31 2.59
2651 5308 0.635009 TCCTGGAACGGAGGGAGTAT 59.365 55.000 0.00 0.00 36.31 2.12
2652 5309 1.007963 TCCTGGAACGGAGGGAGTATT 59.992 52.381 0.00 0.00 36.31 1.89
2653 5310 1.838077 CCTGGAACGGAGGGAGTATTT 59.162 52.381 0.00 0.00 36.31 1.40
2654 5311 2.238898 CCTGGAACGGAGGGAGTATTTT 59.761 50.000 0.00 0.00 36.31 1.82
2655 5312 3.308188 CCTGGAACGGAGGGAGTATTTTT 60.308 47.826 0.00 0.00 36.31 1.94
2677 5334 4.855298 TTTTTATGGTCACCCTAGGGAG 57.145 45.455 35.38 26.87 38.96 4.30
2678 5335 1.802553 TTATGGTCACCCTAGGGAGC 58.197 55.000 35.38 22.15 38.96 4.70
2679 5336 0.469331 TATGGTCACCCTAGGGAGCG 60.469 60.000 35.38 20.88 38.96 5.03
2680 5337 2.043248 GGTCACCCTAGGGAGCGA 60.043 66.667 35.38 22.77 38.96 4.93
2681 5338 1.457831 GGTCACCCTAGGGAGCGAT 60.458 63.158 35.38 8.68 38.96 4.58
2682 5339 1.049289 GGTCACCCTAGGGAGCGATT 61.049 60.000 35.38 7.81 38.96 3.34
2683 5340 0.389757 GTCACCCTAGGGAGCGATTC 59.610 60.000 35.38 12.15 38.96 2.52
2684 5341 0.759436 TCACCCTAGGGAGCGATTCC 60.759 60.000 35.38 0.00 46.00 3.01
2703 5360 4.779475 CACCGGAAAGTGCAGAGT 57.221 55.556 9.46 0.00 0.00 3.24
2704 5361 3.006672 CACCGGAAAGTGCAGAGTT 57.993 52.632 9.46 0.00 0.00 3.01
2705 5362 1.308998 CACCGGAAAGTGCAGAGTTT 58.691 50.000 9.46 0.00 0.00 2.66
2706 5363 1.676006 CACCGGAAAGTGCAGAGTTTT 59.324 47.619 9.46 0.00 0.00 2.43
2707 5364 1.947456 ACCGGAAAGTGCAGAGTTTTC 59.053 47.619 9.46 0.00 0.00 2.29
2708 5365 1.266989 CCGGAAAGTGCAGAGTTTTCC 59.733 52.381 16.35 16.35 44.01 3.13
2709 5366 2.688364 GGAAAGTGCAGAGTTTTCCG 57.312 50.000 13.14 0.00 40.12 4.30
2710 5367 1.947456 GGAAAGTGCAGAGTTTTCCGT 59.053 47.619 13.14 0.00 40.12 4.69
2711 5368 2.357952 GGAAAGTGCAGAGTTTTCCGTT 59.642 45.455 13.14 0.00 40.12 4.44
2712 5369 3.363178 GAAAGTGCAGAGTTTTCCGTTG 58.637 45.455 0.00 0.00 0.00 4.10
2713 5370 2.325583 AGTGCAGAGTTTTCCGTTGA 57.674 45.000 0.00 0.00 0.00 3.18
2714 5371 2.851195 AGTGCAGAGTTTTCCGTTGAT 58.149 42.857 0.00 0.00 0.00 2.57
2715 5372 2.549754 AGTGCAGAGTTTTCCGTTGATG 59.450 45.455 0.00 0.00 0.00 3.07
2716 5373 2.548057 GTGCAGAGTTTTCCGTTGATGA 59.452 45.455 0.00 0.00 0.00 2.92
2717 5374 3.003275 GTGCAGAGTTTTCCGTTGATGAA 59.997 43.478 0.00 0.00 0.00 2.57
2718 5375 3.629855 TGCAGAGTTTTCCGTTGATGAAA 59.370 39.130 0.00 0.00 0.00 2.69
2719 5376 4.222114 GCAGAGTTTTCCGTTGATGAAAG 58.778 43.478 0.00 0.00 33.58 2.62
2720 5377 4.222114 CAGAGTTTTCCGTTGATGAAAGC 58.778 43.478 0.00 0.00 33.58 3.51
2721 5378 4.023707 CAGAGTTTTCCGTTGATGAAAGCT 60.024 41.667 2.41 2.41 43.21 3.74
2722 5379 4.023707 AGAGTTTTCCGTTGATGAAAGCTG 60.024 41.667 6.80 0.00 41.44 4.24
2723 5380 2.704725 TTTCCGTTGATGAAAGCTGC 57.295 45.000 0.00 0.00 0.00 5.25
2724 5381 1.603456 TTCCGTTGATGAAAGCTGCA 58.397 45.000 1.02 0.00 0.00 4.41
2725 5382 1.159285 TCCGTTGATGAAAGCTGCAG 58.841 50.000 10.11 10.11 0.00 4.41
2726 5383 0.455633 CCGTTGATGAAAGCTGCAGC 60.456 55.000 31.53 31.53 42.49 5.25
2727 5384 0.455633 CGTTGATGAAAGCTGCAGCC 60.456 55.000 34.39 20.05 43.38 4.85
2728 5385 0.599558 GTTGATGAAAGCTGCAGCCA 59.400 50.000 34.39 25.03 43.38 4.75
2729 5386 1.000060 GTTGATGAAAGCTGCAGCCAA 60.000 47.619 34.39 25.26 43.38 4.52
2730 5387 0.885879 TGATGAAAGCTGCAGCCAAG 59.114 50.000 34.39 0.00 43.38 3.61
2731 5388 0.172803 GATGAAAGCTGCAGCCAAGG 59.827 55.000 34.39 0.00 43.38 3.61
2732 5389 0.541296 ATGAAAGCTGCAGCCAAGGT 60.541 50.000 34.39 13.75 43.38 3.50
2733 5390 1.288127 GAAAGCTGCAGCCAAGGTG 59.712 57.895 34.39 0.00 43.38 4.00
2734 5391 2.151049 GAAAGCTGCAGCCAAGGTGG 62.151 60.000 34.39 0.00 43.38 4.61
2735 5392 4.673375 AGCTGCAGCCAAGGTGGG 62.673 66.667 34.39 0.00 43.38 4.61
2742 5399 4.366684 GCCAAGGTGGGTGAGGGG 62.367 72.222 0.00 0.00 38.19 4.79
2743 5400 3.661648 CCAAGGTGGGTGAGGGGG 61.662 72.222 0.00 0.00 32.67 5.40
2744 5401 2.858974 CAAGGTGGGTGAGGGGGT 60.859 66.667 0.00 0.00 0.00 4.95
2745 5402 2.858974 AAGGTGGGTGAGGGGGTG 60.859 66.667 0.00 0.00 0.00 4.61
2748 5405 4.995058 GTGGGTGAGGGGGTGGGA 62.995 72.222 0.00 0.00 0.00 4.37
2749 5406 4.209620 TGGGTGAGGGGGTGGGAA 62.210 66.667 0.00 0.00 0.00 3.97
2750 5407 3.339093 GGGTGAGGGGGTGGGAAG 61.339 72.222 0.00 0.00 0.00 3.46
2751 5408 2.204090 GGTGAGGGGGTGGGAAGA 60.204 66.667 0.00 0.00 0.00 2.87
2752 5409 1.619669 GGTGAGGGGGTGGGAAGAT 60.620 63.158 0.00 0.00 0.00 2.40
2753 5410 0.327191 GGTGAGGGGGTGGGAAGATA 60.327 60.000 0.00 0.00 0.00 1.98
2754 5411 1.591768 GTGAGGGGGTGGGAAGATAA 58.408 55.000 0.00 0.00 0.00 1.75
2755 5412 1.212195 GTGAGGGGGTGGGAAGATAAC 59.788 57.143 0.00 0.00 0.00 1.89
2756 5413 1.203505 TGAGGGGGTGGGAAGATAACA 60.204 52.381 0.00 0.00 0.00 2.41
2757 5414 1.212195 GAGGGGGTGGGAAGATAACAC 59.788 57.143 0.00 0.00 0.00 3.32
2758 5415 0.996583 GGGGGTGGGAAGATAACACA 59.003 55.000 0.00 0.00 36.87 3.72
2759 5416 1.356398 GGGGGTGGGAAGATAACACAA 59.644 52.381 0.00 0.00 36.87 3.33
2760 5417 2.443416 GGGGTGGGAAGATAACACAAC 58.557 52.381 0.00 0.00 36.87 3.32
2761 5418 2.224917 GGGGTGGGAAGATAACACAACA 60.225 50.000 0.00 0.00 36.87 3.33
2762 5419 3.492337 GGGTGGGAAGATAACACAACAA 58.508 45.455 0.00 0.00 36.87 2.83
2763 5420 3.254903 GGGTGGGAAGATAACACAACAAC 59.745 47.826 0.00 0.00 36.87 3.32
2764 5421 4.142038 GGTGGGAAGATAACACAACAACT 58.858 43.478 0.00 0.00 36.87 3.16
2765 5422 5.310451 GGTGGGAAGATAACACAACAACTA 58.690 41.667 0.00 0.00 36.87 2.24
2766 5423 5.180680 GGTGGGAAGATAACACAACAACTAC 59.819 44.000 0.00 0.00 36.87 2.73
2767 5424 5.761234 GTGGGAAGATAACACAACAACTACA 59.239 40.000 0.00 0.00 35.30 2.74
2768 5425 5.761234 TGGGAAGATAACACAACAACTACAC 59.239 40.000 0.00 0.00 0.00 2.90
2769 5426 5.761234 GGGAAGATAACACAACAACTACACA 59.239 40.000 0.00 0.00 0.00 3.72
2770 5427 6.293244 GGGAAGATAACACAACAACTACACAC 60.293 42.308 0.00 0.00 0.00 3.82
2771 5428 6.259167 GGAAGATAACACAACAACTACACACA 59.741 38.462 0.00 0.00 0.00 3.72
2772 5429 6.598753 AGATAACACAACAACTACACACAC 57.401 37.500 0.00 0.00 0.00 3.82
2773 5430 6.110033 AGATAACACAACAACTACACACACA 58.890 36.000 0.00 0.00 0.00 3.72
2774 5431 4.678509 AACACAACAACTACACACACAG 57.321 40.909 0.00 0.00 0.00 3.66
2775 5432 3.670625 ACACAACAACTACACACACAGT 58.329 40.909 0.00 0.00 0.00 3.55
2776 5433 4.069304 ACACAACAACTACACACACAGTT 58.931 39.130 0.00 0.00 35.38 3.16
2777 5434 4.153475 ACACAACAACTACACACACAGTTC 59.847 41.667 0.00 0.00 32.72 3.01
2778 5435 4.391830 CACAACAACTACACACACAGTTCT 59.608 41.667 0.00 0.00 32.72 3.01
2779 5436 4.630069 ACAACAACTACACACACAGTTCTC 59.370 41.667 0.00 0.00 32.72 2.87
2780 5437 3.444916 ACAACTACACACACAGTTCTCG 58.555 45.455 0.00 0.00 32.72 4.04
2781 5438 3.129813 ACAACTACACACACAGTTCTCGA 59.870 43.478 0.00 0.00 32.72 4.04
2782 5439 3.351020 ACTACACACACAGTTCTCGAC 57.649 47.619 0.00 0.00 0.00 4.20
2783 5440 2.686405 ACTACACACACAGTTCTCGACA 59.314 45.455 0.00 0.00 0.00 4.35
2784 5441 2.890808 ACACACACAGTTCTCGACAT 57.109 45.000 0.00 0.00 0.00 3.06
2785 5442 2.473816 ACACACACAGTTCTCGACATG 58.526 47.619 0.00 0.00 0.00 3.21
2786 5443 1.794701 CACACACAGTTCTCGACATGG 59.205 52.381 0.00 0.00 0.00 3.66
2787 5444 1.412710 ACACACAGTTCTCGACATGGT 59.587 47.619 0.00 0.00 0.00 3.55
2788 5445 2.061773 CACACAGTTCTCGACATGGTC 58.938 52.381 0.00 0.00 0.00 4.02
2789 5446 1.964223 ACACAGTTCTCGACATGGTCT 59.036 47.619 0.00 0.00 0.00 3.85
2790 5447 2.029828 ACACAGTTCTCGACATGGTCTC 60.030 50.000 0.00 0.00 0.00 3.36
2791 5448 1.200252 ACAGTTCTCGACATGGTCTCG 59.800 52.381 0.00 0.00 0.00 4.04
2792 5449 1.468914 CAGTTCTCGACATGGTCTCGA 59.531 52.381 6.71 6.71 37.82 4.04
2795 5452 3.996614 TCGACATGGTCTCGAGCA 58.003 55.556 7.81 0.63 43.48 4.26
2800 5457 2.507944 ATGGTCTCGAGCATGGGC 59.492 61.111 7.81 0.00 46.50 5.36
2801 5458 3.451556 ATGGTCTCGAGCATGGGCG 62.452 63.158 7.81 0.00 46.50 6.13
2810 5467 4.504596 GCATGGGCGGGATGGTGA 62.505 66.667 0.00 0.00 0.00 4.02
2811 5468 2.275089 CATGGGCGGGATGGTGAA 59.725 61.111 0.00 0.00 0.00 3.18
2812 5469 2.120909 CATGGGCGGGATGGTGAAC 61.121 63.158 0.00 0.00 0.00 3.18
2813 5470 3.697439 ATGGGCGGGATGGTGAACG 62.697 63.158 0.00 0.00 0.00 3.95
2814 5471 4.090588 GGGCGGGATGGTGAACGA 62.091 66.667 0.00 0.00 0.00 3.85
2815 5472 2.511600 GGCGGGATGGTGAACGAG 60.512 66.667 0.00 0.00 0.00 4.18
2816 5473 3.195698 GCGGGATGGTGAACGAGC 61.196 66.667 0.00 0.00 0.00 5.03
2817 5474 2.511600 CGGGATGGTGAACGAGCC 60.512 66.667 0.00 0.00 0.00 4.70
2818 5475 2.668632 GGGATGGTGAACGAGCCA 59.331 61.111 2.16 0.00 39.33 4.75
2820 5477 1.097547 GGGATGGTGAACGAGCCATG 61.098 60.000 2.16 0.00 44.73 3.66
2821 5478 1.718757 GGATGGTGAACGAGCCATGC 61.719 60.000 0.36 0.00 44.73 4.06
2822 5479 1.002257 ATGGTGAACGAGCCATGCA 60.002 52.632 0.00 0.00 43.25 3.96
2823 5480 1.308069 ATGGTGAACGAGCCATGCAC 61.308 55.000 0.00 0.00 43.25 4.57
2824 5481 1.965930 GGTGAACGAGCCATGCACA 60.966 57.895 0.00 0.00 0.00 4.57
2825 5482 1.207593 GTGAACGAGCCATGCACAC 59.792 57.895 0.00 0.00 0.00 3.82
2826 5483 2.316867 TGAACGAGCCATGCACACG 61.317 57.895 0.00 3.04 0.00 4.49
2827 5484 3.651480 GAACGAGCCATGCACACGC 62.651 63.158 0.00 0.00 39.24 5.34
2833 5490 3.520862 CCATGCACACGCCCCATC 61.521 66.667 0.00 0.00 37.32 3.51
2834 5491 2.438975 CATGCACACGCCCCATCT 60.439 61.111 0.00 0.00 37.32 2.90
2835 5492 2.124570 ATGCACACGCCCCATCTC 60.125 61.111 0.00 0.00 37.32 2.75
2836 5493 2.673200 ATGCACACGCCCCATCTCT 61.673 57.895 0.00 0.00 37.32 3.10
2837 5494 2.821366 GCACACGCCCCATCTCTG 60.821 66.667 0.00 0.00 0.00 3.35
2838 5495 2.821366 CACACGCCCCATCTCTGC 60.821 66.667 0.00 0.00 0.00 4.26
2839 5496 3.321648 ACACGCCCCATCTCTGCA 61.322 61.111 0.00 0.00 0.00 4.41
2840 5497 2.821366 CACGCCCCATCTCTGCAC 60.821 66.667 0.00 0.00 0.00 4.57
2841 5498 3.321648 ACGCCCCATCTCTGCACA 61.322 61.111 0.00 0.00 0.00 4.57
2842 5499 2.191375 CGCCCCATCTCTGCACAT 59.809 61.111 0.00 0.00 0.00 3.21
2843 5500 1.890979 CGCCCCATCTCTGCACATC 60.891 63.158 0.00 0.00 0.00 3.06
2844 5501 1.530771 GCCCCATCTCTGCACATCT 59.469 57.895 0.00 0.00 0.00 2.90
2845 5502 0.534652 GCCCCATCTCTGCACATCTC 60.535 60.000 0.00 0.00 0.00 2.75
2846 5503 0.835276 CCCCATCTCTGCACATCTCA 59.165 55.000 0.00 0.00 0.00 3.27
2847 5504 1.211212 CCCCATCTCTGCACATCTCAA 59.789 52.381 0.00 0.00 0.00 3.02
2848 5505 2.562635 CCCATCTCTGCACATCTCAAG 58.437 52.381 0.00 0.00 0.00 3.02
2849 5506 1.941294 CCATCTCTGCACATCTCAAGC 59.059 52.381 0.00 0.00 0.00 4.01
2850 5507 2.629051 CATCTCTGCACATCTCAAGCA 58.371 47.619 0.00 0.00 36.72 3.91
2851 5508 3.206964 CATCTCTGCACATCTCAAGCAT 58.793 45.455 0.00 0.00 37.68 3.79
2852 5509 3.345508 TCTCTGCACATCTCAAGCATT 57.654 42.857 0.00 0.00 37.68 3.56
2853 5510 3.682696 TCTCTGCACATCTCAAGCATTT 58.317 40.909 0.00 0.00 37.68 2.32
2854 5511 4.835678 TCTCTGCACATCTCAAGCATTTA 58.164 39.130 0.00 0.00 37.68 1.40
2855 5512 4.874396 TCTCTGCACATCTCAAGCATTTAG 59.126 41.667 0.00 0.00 37.68 1.85
2856 5513 3.943381 TCTGCACATCTCAAGCATTTAGG 59.057 43.478 0.00 0.00 37.68 2.69
2857 5514 3.018856 TGCACATCTCAAGCATTTAGGG 58.981 45.455 0.00 0.00 32.55 3.53
2858 5515 2.223665 GCACATCTCAAGCATTTAGGGC 60.224 50.000 0.00 0.00 0.00 5.19
2859 5516 3.018856 CACATCTCAAGCATTTAGGGCA 58.981 45.455 0.00 0.00 0.00 5.36
2860 5517 3.635373 CACATCTCAAGCATTTAGGGCAT 59.365 43.478 0.00 0.00 0.00 4.40
2861 5518 4.098960 CACATCTCAAGCATTTAGGGCATT 59.901 41.667 0.00 0.00 0.00 3.56
2862 5519 4.713321 ACATCTCAAGCATTTAGGGCATTT 59.287 37.500 0.00 0.00 0.00 2.32
2863 5520 4.989279 TCTCAAGCATTTAGGGCATTTC 57.011 40.909 0.00 0.00 0.00 2.17
2864 5521 4.603131 TCTCAAGCATTTAGGGCATTTCT 58.397 39.130 0.00 0.00 0.00 2.52
2865 5522 4.400251 TCTCAAGCATTTAGGGCATTTCTG 59.600 41.667 0.00 0.00 0.00 3.02
2866 5523 3.448301 TCAAGCATTTAGGGCATTTCTGG 59.552 43.478 0.00 0.00 0.00 3.86
2867 5524 2.391678 AGCATTTAGGGCATTTCTGGG 58.608 47.619 0.00 0.00 0.00 4.45
2868 5525 1.202568 GCATTTAGGGCATTTCTGGGC 60.203 52.381 0.00 0.00 0.00 5.36
2869 5526 1.067516 CATTTAGGGCATTTCTGGGCG 59.932 52.381 0.00 0.00 0.00 6.13
2870 5527 0.039035 TTTAGGGCATTTCTGGGCGT 59.961 50.000 0.00 0.00 0.00 5.68
2871 5528 0.039035 TTAGGGCATTTCTGGGCGTT 59.961 50.000 0.00 0.00 0.00 4.84
2872 5529 0.679640 TAGGGCATTTCTGGGCGTTG 60.680 55.000 0.00 0.00 0.00 4.10
2873 5530 1.976474 GGGCATTTCTGGGCGTTGA 60.976 57.895 0.00 0.00 0.00 3.18
2874 5531 1.322538 GGGCATTTCTGGGCGTTGAT 61.323 55.000 0.00 0.00 0.00 2.57
2875 5532 0.101219 GGCATTTCTGGGCGTTGATC 59.899 55.000 0.00 0.00 0.00 2.92
2876 5533 0.248215 GCATTTCTGGGCGTTGATCG 60.248 55.000 0.00 0.00 43.12 3.69
2885 5542 2.776072 CGTTGATCGCGGAACACC 59.224 61.111 6.13 0.00 0.00 4.16
2886 5543 2.736682 CGTTGATCGCGGAACACCC 61.737 63.158 6.13 0.00 0.00 4.61
2887 5544 2.046700 TTGATCGCGGAACACCCC 60.047 61.111 6.13 0.00 0.00 4.95
2888 5545 2.884980 TTGATCGCGGAACACCCCA 61.885 57.895 6.13 0.00 0.00 4.96
2889 5546 2.189521 GATCGCGGAACACCCCAT 59.810 61.111 6.13 0.00 0.00 4.00
2890 5547 1.887707 GATCGCGGAACACCCCATC 60.888 63.158 6.13 0.00 0.00 3.51
2891 5548 3.400599 ATCGCGGAACACCCCATCC 62.401 63.158 6.13 0.00 0.00 3.51
2892 5549 4.096003 CGCGGAACACCCCATCCT 62.096 66.667 0.00 0.00 33.36 3.24
2893 5550 2.355115 GCGGAACACCCCATCCTT 59.645 61.111 0.00 0.00 33.36 3.36
2894 5551 1.749258 GCGGAACACCCCATCCTTC 60.749 63.158 0.00 0.00 33.36 3.46
2895 5552 1.077716 CGGAACACCCCATCCTTCC 60.078 63.158 0.00 0.00 33.36 3.46
2896 5553 1.562672 CGGAACACCCCATCCTTCCT 61.563 60.000 0.00 0.00 33.36 3.36
2897 5554 0.704664 GGAACACCCCATCCTTCCTT 59.295 55.000 0.00 0.00 32.75 3.36
2898 5555 1.920351 GGAACACCCCATCCTTCCTTA 59.080 52.381 0.00 0.00 32.75 2.69
2899 5556 2.092375 GGAACACCCCATCCTTCCTTAG 60.092 54.545 0.00 0.00 32.75 2.18
2900 5557 2.361085 ACACCCCATCCTTCCTTAGT 57.639 50.000 0.00 0.00 0.00 2.24
2901 5558 3.502051 ACACCCCATCCTTCCTTAGTA 57.498 47.619 0.00 0.00 0.00 1.82
2902 5559 3.113043 ACACCCCATCCTTCCTTAGTAC 58.887 50.000 0.00 0.00 0.00 2.73
2903 5560 3.246387 ACACCCCATCCTTCCTTAGTACT 60.246 47.826 0.00 0.00 0.00 2.73
2904 5561 3.780850 CACCCCATCCTTCCTTAGTACTT 59.219 47.826 0.00 0.00 0.00 2.24
2905 5562 4.038633 ACCCCATCCTTCCTTAGTACTTC 58.961 47.826 0.00 0.00 0.00 3.01
2906 5563 4.265353 ACCCCATCCTTCCTTAGTACTTCT 60.265 45.833 0.00 0.00 0.00 2.85
2907 5564 5.042827 ACCCCATCCTTCCTTAGTACTTCTA 60.043 44.000 0.00 0.00 0.00 2.10
2908 5565 6.085416 CCCCATCCTTCCTTAGTACTTCTAT 58.915 44.000 0.00 0.00 0.00 1.98
2909 5566 6.014156 CCCCATCCTTCCTTAGTACTTCTATG 60.014 46.154 0.00 0.00 0.00 2.23
2910 5567 6.555360 CCCATCCTTCCTTAGTACTTCTATGT 59.445 42.308 0.00 0.00 0.00 2.29
2911 5568 7.071321 CCCATCCTTCCTTAGTACTTCTATGTT 59.929 40.741 0.00 0.00 0.00 2.71
2912 5569 7.928706 CCATCCTTCCTTAGTACTTCTATGTTG 59.071 40.741 0.00 0.00 0.00 3.33
2913 5570 6.875076 TCCTTCCTTAGTACTTCTATGTTGC 58.125 40.000 0.00 0.00 0.00 4.17
2914 5571 6.439375 TCCTTCCTTAGTACTTCTATGTTGCA 59.561 38.462 0.00 0.00 0.00 4.08
2915 5572 7.038587 TCCTTCCTTAGTACTTCTATGTTGCAA 60.039 37.037 0.00 0.00 0.00 4.08
2916 5573 7.064728 CCTTCCTTAGTACTTCTATGTTGCAAC 59.935 40.741 22.83 22.83 0.00 4.17
2917 5574 6.999950 TCCTTAGTACTTCTATGTTGCAACA 58.000 36.000 32.78 32.78 44.06 3.33
2918 5575 7.446769 TCCTTAGTACTTCTATGTTGCAACAA 58.553 34.615 34.06 21.54 43.03 2.83
2919 5576 7.386848 TCCTTAGTACTTCTATGTTGCAACAAC 59.613 37.037 34.06 24.50 43.03 3.32
2920 5577 7.172532 CCTTAGTACTTCTATGTTGCAACAACA 59.827 37.037 34.06 23.22 43.03 3.33
2921 5578 6.545504 AGTACTTCTATGTTGCAACAACAG 57.454 37.500 34.06 29.80 43.03 3.16
2922 5579 6.288294 AGTACTTCTATGTTGCAACAACAGA 58.712 36.000 34.06 31.27 43.03 3.41
2923 5580 5.679734 ACTTCTATGTTGCAACAACAGAG 57.320 39.130 34.06 27.57 43.03 3.35
2924 5581 4.516698 ACTTCTATGTTGCAACAACAGAGG 59.483 41.667 32.50 32.50 43.03 3.69
2925 5582 4.350368 TCTATGTTGCAACAACAGAGGA 57.650 40.909 34.06 20.98 43.03 3.71
2926 5583 4.318332 TCTATGTTGCAACAACAGAGGAG 58.682 43.478 34.06 20.57 43.03 3.69
2927 5584 1.679139 TGTTGCAACAACAGAGGAGG 58.321 50.000 29.36 0.00 35.67 4.30
2928 5585 1.211703 TGTTGCAACAACAGAGGAGGA 59.788 47.619 29.36 1.52 35.67 3.71
2929 5586 1.876156 GTTGCAACAACAGAGGAGGAG 59.124 52.381 24.52 0.00 0.00 3.69
2930 5587 0.397941 TGCAACAACAGAGGAGGAGG 59.602 55.000 0.00 0.00 0.00 4.30
2931 5588 0.687354 GCAACAACAGAGGAGGAGGA 59.313 55.000 0.00 0.00 0.00 3.71
2932 5589 1.072331 GCAACAACAGAGGAGGAGGAA 59.928 52.381 0.00 0.00 0.00 3.36
2933 5590 2.487265 GCAACAACAGAGGAGGAGGAAA 60.487 50.000 0.00 0.00 0.00 3.13
2934 5591 3.406764 CAACAACAGAGGAGGAGGAAAG 58.593 50.000 0.00 0.00 0.00 2.62
2935 5592 2.695585 ACAACAGAGGAGGAGGAAAGT 58.304 47.619 0.00 0.00 0.00 2.66
2936 5593 2.635427 ACAACAGAGGAGGAGGAAAGTC 59.365 50.000 0.00 0.00 0.00 3.01
2937 5594 2.634940 CAACAGAGGAGGAGGAAAGTCA 59.365 50.000 0.00 0.00 0.00 3.41
2938 5595 2.977808 ACAGAGGAGGAGGAAAGTCAA 58.022 47.619 0.00 0.00 0.00 3.18
2939 5596 3.318313 ACAGAGGAGGAGGAAAGTCAAA 58.682 45.455 0.00 0.00 0.00 2.69
2940 5597 3.326297 ACAGAGGAGGAGGAAAGTCAAAG 59.674 47.826 0.00 0.00 0.00 2.77
2941 5598 2.304470 AGAGGAGGAGGAAAGTCAAAGC 59.696 50.000 0.00 0.00 0.00 3.51
2942 5599 2.039084 GAGGAGGAGGAAAGTCAAAGCA 59.961 50.000 0.00 0.00 0.00 3.91
2943 5600 2.039613 AGGAGGAGGAAAGTCAAAGCAG 59.960 50.000 0.00 0.00 0.00 4.24
2944 5601 2.039084 GGAGGAGGAAAGTCAAAGCAGA 59.961 50.000 0.00 0.00 0.00 4.26
2945 5602 3.496870 GGAGGAGGAAAGTCAAAGCAGAA 60.497 47.826 0.00 0.00 0.00 3.02
2946 5603 3.749226 AGGAGGAAAGTCAAAGCAGAAG 58.251 45.455 0.00 0.00 0.00 2.85
2947 5604 2.227626 GGAGGAAAGTCAAAGCAGAAGC 59.772 50.000 0.00 0.00 42.56 3.86
2961 5618 3.642778 GAAGCTCGCGGCACCACTA 62.643 63.158 19.30 0.00 44.79 2.74
2962 5619 3.934391 AAGCTCGCGGCACCACTAC 62.934 63.158 19.30 0.00 44.79 2.73
2971 5628 4.814294 CACCACTACGGGCGCCTC 62.814 72.222 28.56 15.77 40.22 4.70
2974 5631 3.511595 CACTACGGGCGCCTCGTA 61.512 66.667 33.15 33.15 41.38 3.43
2977 5634 4.802051 TACGGGCGCCTCGTAGGT 62.802 66.667 32.49 20.93 41.38 3.08
2987 5644 4.631773 TCGTAGGTGTCGAGGAGG 57.368 61.111 0.00 0.00 33.38 4.30
2988 5645 1.748122 TCGTAGGTGTCGAGGAGGC 60.748 63.158 0.00 0.00 33.38 4.70
2989 5646 2.799371 GTAGGTGTCGAGGAGGCG 59.201 66.667 0.00 0.00 0.00 5.52
2990 5647 1.748122 GTAGGTGTCGAGGAGGCGA 60.748 63.158 0.00 0.00 38.07 5.54
2991 5648 1.001764 TAGGTGTCGAGGAGGCGAA 60.002 57.895 0.00 0.00 42.55 4.70
2992 5649 1.310933 TAGGTGTCGAGGAGGCGAAC 61.311 60.000 0.00 0.00 42.55 3.95
2993 5650 2.649034 GTGTCGAGGAGGCGAACA 59.351 61.111 0.00 0.00 42.55 3.18
2994 5651 1.215647 GTGTCGAGGAGGCGAACAT 59.784 57.895 0.00 0.00 42.55 2.71
2995 5652 0.802607 GTGTCGAGGAGGCGAACATC 60.803 60.000 0.00 0.00 42.55 3.06
2996 5653 1.227002 GTCGAGGAGGCGAACATCC 60.227 63.158 0.00 0.00 42.55 3.51
2997 5654 2.278857 CGAGGAGGCGAACATCCG 60.279 66.667 0.00 0.00 40.73 4.18
3008 5665 0.582005 GAACATCCGCAACTATCGGC 59.418 55.000 0.00 0.00 46.05 5.54
3009 5666 0.814010 AACATCCGCAACTATCGGCC 60.814 55.000 0.00 0.00 46.05 6.13
3010 5667 2.029073 ATCCGCAACTATCGGCCG 59.971 61.111 22.12 22.12 46.05 6.13
3011 5668 3.515316 ATCCGCAACTATCGGCCGG 62.515 63.158 27.83 12.37 46.05 6.13
3029 5686 3.327404 CGGCCACCTACCCTGGTT 61.327 66.667 2.24 0.00 38.45 3.67
3030 5687 2.675371 GGCCACCTACCCTGGTTC 59.325 66.667 0.00 0.00 38.45 3.62
3031 5688 2.228480 GGCCACCTACCCTGGTTCA 61.228 63.158 0.00 0.00 38.45 3.18
3032 5689 1.299976 GCCACCTACCCTGGTTCAG 59.700 63.158 0.00 0.00 38.45 3.02
3033 5690 1.198759 GCCACCTACCCTGGTTCAGA 61.199 60.000 0.00 0.00 38.45 3.27
3034 5691 0.905357 CCACCTACCCTGGTTCAGAG 59.095 60.000 0.00 0.00 38.45 3.35
3035 5692 1.645710 CACCTACCCTGGTTCAGAGT 58.354 55.000 0.00 0.00 38.45 3.24
3036 5693 1.550976 CACCTACCCTGGTTCAGAGTC 59.449 57.143 0.00 0.00 38.45 3.36
3037 5694 1.149288 ACCTACCCTGGTTCAGAGTCA 59.851 52.381 0.00 0.00 36.89 3.41
3038 5695 2.257207 CCTACCCTGGTTCAGAGTCAA 58.743 52.381 0.00 0.00 32.44 3.18
3039 5696 2.028020 CCTACCCTGGTTCAGAGTCAAC 60.028 54.545 0.00 0.00 32.44 3.18
3040 5697 0.393077 ACCCTGGTTCAGAGTCAACG 59.607 55.000 0.00 0.00 32.44 4.10
3041 5698 0.320771 CCCTGGTTCAGAGTCAACGG 60.321 60.000 0.00 0.00 32.44 4.44
3042 5699 0.320771 CCTGGTTCAGAGTCAACGGG 60.321 60.000 0.00 0.00 32.44 5.28
3043 5700 0.951040 CTGGTTCAGAGTCAACGGGC 60.951 60.000 0.00 0.00 32.44 6.13
3044 5701 2.027625 GGTTCAGAGTCAACGGGCG 61.028 63.158 0.00 0.00 0.00 6.13
3045 5702 1.006571 GTTCAGAGTCAACGGGCGA 60.007 57.895 0.00 0.00 0.00 5.54
3046 5703 0.599204 GTTCAGAGTCAACGGGCGAA 60.599 55.000 0.00 0.00 0.00 4.70
3047 5704 0.599204 TTCAGAGTCAACGGGCGAAC 60.599 55.000 0.00 0.00 0.00 3.95
3048 5705 2.049433 AGAGTCAACGGGCGAACG 60.049 61.111 0.00 0.00 40.31 3.95
3049 5706 3.110178 GAGTCAACGGGCGAACGG 61.110 66.667 4.29 0.00 38.39 4.44
3050 5707 3.853597 GAGTCAACGGGCGAACGGT 62.854 63.158 4.29 0.00 38.39 4.83
3057 5714 3.499737 GGGCGAACGGTGCATCAG 61.500 66.667 0.00 0.00 0.00 2.90
3058 5715 3.499737 GGCGAACGGTGCATCAGG 61.500 66.667 0.00 0.00 0.00 3.86
3059 5716 2.434185 GCGAACGGTGCATCAGGA 60.434 61.111 0.00 0.00 0.00 3.86
3060 5717 1.815421 GCGAACGGTGCATCAGGAT 60.815 57.895 0.00 0.00 0.00 3.24
3061 5718 1.766143 GCGAACGGTGCATCAGGATC 61.766 60.000 0.00 0.00 0.00 3.36
3062 5719 1.154205 CGAACGGTGCATCAGGATCC 61.154 60.000 2.48 2.48 0.00 3.36
3063 5720 1.153369 AACGGTGCATCAGGATCCG 60.153 57.895 5.98 8.00 45.53 4.18
3064 5721 2.969238 CGGTGCATCAGGATCCGC 60.969 66.667 5.98 4.08 35.01 5.54
3065 5722 2.190313 GGTGCATCAGGATCCGCA 59.810 61.111 5.98 7.05 0.00 5.69
3066 5723 1.228063 GGTGCATCAGGATCCGCAT 60.228 57.895 14.13 4.18 36.64 4.73
3067 5724 0.035317 GGTGCATCAGGATCCGCATA 59.965 55.000 14.13 0.00 36.64 3.14
3068 5725 1.436600 GTGCATCAGGATCCGCATAG 58.563 55.000 14.13 3.10 36.64 2.23
3069 5726 1.001293 GTGCATCAGGATCCGCATAGA 59.999 52.381 14.13 5.96 36.64 1.98
3070 5727 1.904537 TGCATCAGGATCCGCATAGAT 59.095 47.619 5.98 3.68 0.00 1.98
3071 5728 2.277969 GCATCAGGATCCGCATAGATG 58.722 52.381 20.23 20.23 36.76 2.90
3072 5729 2.902523 CATCAGGATCCGCATAGATGG 58.097 52.381 18.32 7.29 31.64 3.51
3073 5730 1.269958 TCAGGATCCGCATAGATGGG 58.730 55.000 5.98 0.00 40.08 4.00
3079 5736 4.806936 CGCATAGATGGGGCACAT 57.193 55.556 0.00 0.00 44.18 3.21
3080 5737 2.250646 CGCATAGATGGGGCACATG 58.749 57.895 7.14 0.00 40.72 3.21
3081 5738 1.239296 CGCATAGATGGGGCACATGG 61.239 60.000 7.14 0.00 40.72 3.66
3082 5739 1.530013 GCATAGATGGGGCACATGGC 61.530 60.000 7.14 1.26 40.72 4.40
3083 5740 0.111832 CATAGATGGGGCACATGGCT 59.888 55.000 7.14 0.63 40.72 4.75
3084 5741 0.855598 ATAGATGGGGCACATGGCTT 59.144 50.000 7.14 0.00 40.72 4.35
3085 5742 0.183492 TAGATGGGGCACATGGCTTC 59.817 55.000 7.14 0.00 40.72 3.86
3086 5743 1.380246 GATGGGGCACATGGCTTCA 60.380 57.895 7.14 5.14 40.72 3.02
3087 5744 1.380785 ATGGGGCACATGGCTTCAG 60.381 57.895 0.00 0.00 44.01 3.02
3088 5745 3.455469 GGGGCACATGGCTTCAGC 61.455 66.667 5.33 0.00 44.01 4.26
3089 5746 2.677524 GGGCACATGGCTTCAGCA 60.678 61.111 5.33 0.00 44.36 4.41
3090 5747 2.707849 GGGCACATGGCTTCAGCAG 61.708 63.158 5.33 0.00 44.36 4.24
3102 5759 2.015587 CTTCAGCAGCAGAAAGGATCC 58.984 52.381 2.48 2.48 0.00 3.36
3103 5760 0.254178 TCAGCAGCAGAAAGGATCCC 59.746 55.000 8.55 0.00 0.00 3.85
3104 5761 0.255318 CAGCAGCAGAAAGGATCCCT 59.745 55.000 8.55 0.00 33.87 4.20
3114 5771 0.922626 AAGGATCCCTTTCCTGAGCC 59.077 55.000 8.55 0.00 45.63 4.70
3115 5772 1.147153 GGATCCCTTTCCTGAGCCG 59.853 63.158 0.00 0.00 32.68 5.52
3116 5773 1.524849 GATCCCTTTCCTGAGCCGC 60.525 63.158 0.00 0.00 0.00 6.53
3117 5774 3.391665 ATCCCTTTCCTGAGCCGCG 62.392 63.158 0.00 0.00 0.00 6.46
3118 5775 4.082523 CCCTTTCCTGAGCCGCGA 62.083 66.667 8.23 0.00 0.00 5.87
3119 5776 2.815647 CCTTTCCTGAGCCGCGAC 60.816 66.667 8.23 0.00 0.00 5.19
3120 5777 3.181967 CTTTCCTGAGCCGCGACG 61.182 66.667 8.23 0.00 0.00 5.12
3121 5778 3.626680 CTTTCCTGAGCCGCGACGA 62.627 63.158 8.23 0.00 0.00 4.20
3122 5779 3.626680 TTTCCTGAGCCGCGACGAG 62.627 63.158 8.23 0.00 0.00 4.18
3131 5788 4.116328 CGCGACGAGCCCAAGAGA 62.116 66.667 0.00 0.00 44.76 3.10
3132 5789 2.496817 GCGACGAGCCCAAGAGAT 59.503 61.111 0.00 0.00 40.81 2.75
3133 5790 1.880340 GCGACGAGCCCAAGAGATG 60.880 63.158 0.00 0.00 40.81 2.90
3143 5800 2.503895 CCAAGAGATGGCCTTGTTCT 57.496 50.000 3.32 0.53 43.80 3.01
3144 5801 2.800250 CCAAGAGATGGCCTTGTTCTT 58.200 47.619 3.32 6.73 43.80 2.52
3145 5802 3.160269 CCAAGAGATGGCCTTGTTCTTT 58.840 45.455 3.32 0.00 43.80 2.52
3146 5803 3.057033 CCAAGAGATGGCCTTGTTCTTTG 60.057 47.826 3.32 2.17 43.80 2.77
3147 5804 2.165998 AGAGATGGCCTTGTTCTTTGC 58.834 47.619 3.32 0.00 0.00 3.68
3148 5805 0.883833 AGATGGCCTTGTTCTTTGCG 59.116 50.000 3.32 0.00 0.00 4.85
3149 5806 0.881118 GATGGCCTTGTTCTTTGCGA 59.119 50.000 3.32 0.00 0.00 5.10
3150 5807 0.883833 ATGGCCTTGTTCTTTGCGAG 59.116 50.000 3.32 0.00 0.00 5.03
3151 5808 1.172180 TGGCCTTGTTCTTTGCGAGG 61.172 55.000 3.32 0.00 39.86 4.63
3152 5809 0.889186 GGCCTTGTTCTTTGCGAGGA 60.889 55.000 0.00 0.00 39.36 3.71
3153 5810 0.519077 GCCTTGTTCTTTGCGAGGAG 59.481 55.000 2.96 0.00 39.36 3.69
3167 5824 2.507944 GGAGCCACATCTCCGCAT 59.492 61.111 0.00 0.00 42.74 4.73
3168 5825 1.890979 GGAGCCACATCTCCGCATG 60.891 63.158 0.00 0.00 42.74 4.06
3169 5826 1.153289 GAGCCACATCTCCGCATGT 60.153 57.895 0.00 0.00 37.49 3.21
3170 5827 1.153289 AGCCACATCTCCGCATGTC 60.153 57.895 0.00 0.00 34.60 3.06
3171 5828 2.182842 GCCACATCTCCGCATGTCC 61.183 63.158 0.00 0.00 34.60 4.02
3172 5829 1.524621 CCACATCTCCGCATGTCCC 60.525 63.158 0.00 0.00 34.60 4.46
3173 5830 1.221566 CACATCTCCGCATGTCCCA 59.778 57.895 0.00 0.00 34.60 4.37
3174 5831 1.091771 CACATCTCCGCATGTCCCAC 61.092 60.000 0.00 0.00 34.60 4.61
3175 5832 1.221566 CATCTCCGCATGTCCCACA 59.778 57.895 0.00 0.00 0.00 4.17
3176 5833 0.812811 CATCTCCGCATGTCCCACAG 60.813 60.000 0.00 0.00 0.00 3.66
3177 5834 1.976132 ATCTCCGCATGTCCCACAGG 61.976 60.000 0.00 0.00 32.28 4.00
3178 5835 3.687321 CTCCGCATGTCCCACAGGG 62.687 68.421 0.00 0.00 46.11 4.45
3195 5852 7.733773 CCACAGGGGACATATGTATAGATAA 57.266 40.000 8.71 0.00 40.01 1.75
3196 5853 8.146053 CCACAGGGGACATATGTATAGATAAA 57.854 38.462 8.71 0.00 40.01 1.40
3197 5854 8.260818 CCACAGGGGACATATGTATAGATAAAG 58.739 40.741 8.71 0.00 40.01 1.85
3198 5855 8.260818 CACAGGGGACATATGTATAGATAAAGG 58.739 40.741 8.71 0.00 0.00 3.11
3199 5856 8.184249 ACAGGGGACATATGTATAGATAAAGGA 58.816 37.037 8.71 0.00 0.00 3.36
3200 5857 8.478877 CAGGGGACATATGTATAGATAAAGGAC 58.521 40.741 8.71 0.00 0.00 3.85
3201 5858 7.342284 AGGGGACATATGTATAGATAAAGGACG 59.658 40.741 8.71 0.00 0.00 4.79
3202 5859 6.979238 GGGACATATGTATAGATAAAGGACGC 59.021 42.308 8.71 0.00 0.00 5.19
3203 5860 6.691818 GGACATATGTATAGATAAAGGACGCG 59.308 42.308 8.71 3.53 0.00 6.01
3204 5861 7.387119 ACATATGTATAGATAAAGGACGCGA 57.613 36.000 15.93 0.00 0.00 5.87
3205 5862 7.249147 ACATATGTATAGATAAAGGACGCGAC 58.751 38.462 15.93 6.56 0.00 5.19
3206 5863 5.961396 ATGTATAGATAAAGGACGCGACT 57.039 39.130 15.93 7.85 0.00 4.18
3207 5864 8.610035 CATATGTATAGATAAAGGACGCGACTA 58.390 37.037 15.93 0.00 0.00 2.59
3208 5865 6.866010 TGTATAGATAAAGGACGCGACTAA 57.134 37.500 15.93 3.06 0.00 2.24
3209 5866 6.662616 TGTATAGATAAAGGACGCGACTAAC 58.337 40.000 15.93 0.00 0.00 2.34
3210 5867 3.433513 AGATAAAGGACGCGACTAACC 57.566 47.619 15.93 8.01 0.00 2.85
3211 5868 2.756760 AGATAAAGGACGCGACTAACCA 59.243 45.455 15.93 0.00 0.00 3.67
3212 5869 2.352503 TAAAGGACGCGACTAACCAC 57.647 50.000 15.93 0.00 0.00 4.16
3213 5870 0.320160 AAAGGACGCGACTAACCACC 60.320 55.000 15.93 2.78 0.00 4.61
3214 5871 1.466025 AAGGACGCGACTAACCACCA 61.466 55.000 15.93 0.00 0.00 4.17
3215 5872 1.445582 GGACGCGACTAACCACCAG 60.446 63.158 15.93 0.00 0.00 4.00
3216 5873 2.048503 ACGCGACTAACCACCAGC 60.049 61.111 15.93 0.00 0.00 4.85
3217 5874 2.813908 CGCGACTAACCACCAGCC 60.814 66.667 0.00 0.00 0.00 4.85
3218 5875 2.813908 GCGACTAACCACCAGCCG 60.814 66.667 0.00 0.00 0.00 5.52
3219 5876 2.967397 CGACTAACCACCAGCCGA 59.033 61.111 0.00 0.00 0.00 5.54
3220 5877 1.445582 CGACTAACCACCAGCCGAC 60.446 63.158 0.00 0.00 0.00 4.79
3221 5878 1.874345 CGACTAACCACCAGCCGACT 61.874 60.000 0.00 0.00 0.00 4.18
3222 5879 0.389948 GACTAACCACCAGCCGACTG 60.390 60.000 0.00 0.00 44.05 3.51
3230 5887 4.598257 CAGCCGACTGGTGGTTAG 57.402 61.111 0.00 0.00 40.48 2.34
3231 5888 1.741770 CAGCCGACTGGTGGTTAGC 60.742 63.158 0.00 0.00 40.48 3.09
3232 5889 2.813908 GCCGACTGGTGGTTAGCG 60.814 66.667 0.00 0.00 37.67 4.26
3233 5890 2.967397 CCGACTGGTGGTTAGCGA 59.033 61.111 0.00 0.00 0.00 4.93
3234 5891 1.445582 CCGACTGGTGGTTAGCGAC 60.446 63.158 0.00 0.00 0.00 5.19
3235 5892 1.287815 CGACTGGTGGTTAGCGACA 59.712 57.895 0.00 0.00 0.00 4.35
3236 5893 0.319211 CGACTGGTGGTTAGCGACAA 60.319 55.000 0.00 0.00 0.00 3.18
3237 5894 1.870580 CGACTGGTGGTTAGCGACAAA 60.871 52.381 0.00 0.00 0.00 2.83
3238 5895 2.423577 GACTGGTGGTTAGCGACAAAT 58.576 47.619 0.00 0.00 0.00 2.32
3239 5896 2.415512 GACTGGTGGTTAGCGACAAATC 59.584 50.000 0.00 0.00 0.00 2.17
3240 5897 1.737793 CTGGTGGTTAGCGACAAATCC 59.262 52.381 0.00 0.00 0.00 3.01
3241 5898 0.725117 GGTGGTTAGCGACAAATCCG 59.275 55.000 0.00 0.00 0.00 4.18
3249 5906 1.269810 CGACAAATCCGCACGATCG 59.730 57.895 14.88 14.88 0.00 3.69
3250 5907 1.410737 CGACAAATCCGCACGATCGT 61.411 55.000 16.60 16.60 0.00 3.73
3251 5908 1.552226 GACAAATCCGCACGATCGTA 58.448 50.000 22.26 5.54 0.00 3.43
3252 5909 1.254570 GACAAATCCGCACGATCGTAC 59.745 52.381 22.26 15.07 0.00 3.67
3253 5910 1.273688 CAAATCCGCACGATCGTACA 58.726 50.000 22.26 5.24 0.00 2.90
3254 5911 1.006391 CAAATCCGCACGATCGTACAC 60.006 52.381 22.26 12.42 0.00 2.90
3255 5912 0.526954 AATCCGCACGATCGTACACC 60.527 55.000 22.26 8.71 0.00 4.16
3256 5913 1.381928 ATCCGCACGATCGTACACCT 61.382 55.000 22.26 3.14 0.00 4.00
3257 5914 1.872234 CCGCACGATCGTACACCTG 60.872 63.158 22.26 8.67 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.715624 GAAATCGCATCGCCCCAC 59.284 61.111 0.00 0.00 0.00 4.61
1 2 2.515991 GGAAATCGCATCGCCCCA 60.516 61.111 0.00 0.00 0.00 4.96
51 2708 0.681887 TCCGCTTCACCGTATCCTCA 60.682 55.000 0.00 0.00 0.00 3.86
57 2714 3.446507 GGAATTCCGCTTCACCGTA 57.553 52.632 9.17 0.00 0.00 4.02
93 2750 2.002586 CAGTCCGACATGTTCATGGTC 58.997 52.381 15.71 10.11 0.00 4.02
110 2767 4.101448 GCCTGGGCGGTCATCAGT 62.101 66.667 0.00 0.00 34.25 3.41
116 2773 4.660938 AAGGTTGCCTGGGCGGTC 62.661 66.667 7.14 0.26 45.51 4.79
117 2774 4.974721 CAAGGTTGCCTGGGCGGT 62.975 66.667 7.14 0.00 45.51 5.68
119 2776 4.659172 TCCAAGGTTGCCTGGGCG 62.659 66.667 7.14 0.00 44.38 6.13
120 2777 2.677875 CTCCAAGGTTGCCTGGGC 60.678 66.667 4.43 4.43 44.38 5.36
139 2796 0.394625 TGCCTCATGCTTGCATGCTA 60.395 50.000 25.53 10.88 42.00 3.49
162 2819 1.815421 GCGTGCCGTCATGGAGATT 60.815 57.895 0.00 0.00 42.00 2.40
172 2829 0.040425 GTCAAAATTGAGCGTGCCGT 60.040 50.000 0.00 0.00 37.98 5.68
183 2840 3.555586 GCATCCACCTTGCTGTCAAAATT 60.556 43.478 0.00 0.00 37.14 1.82
185 2842 1.340889 GCATCCACCTTGCTGTCAAAA 59.659 47.619 0.00 0.00 37.14 2.44
190 2847 1.303888 CAGGCATCCACCTTGCTGT 60.304 57.895 0.00 0.00 38.26 4.40
199 2856 1.962807 CCACAAAAACTCAGGCATCCA 59.037 47.619 0.00 0.00 0.00 3.41
226 2883 0.917533 ATCTTGCAGCCCATCACTCT 59.082 50.000 0.00 0.00 0.00 3.24
266 2923 2.566010 CCACGGGTGCGGATTTTG 59.434 61.111 0.00 0.00 0.00 2.44
316 2973 1.271102 GGATGACTCTACGATCCAGGC 59.729 57.143 0.00 0.00 36.43 4.85
325 2982 2.697751 ACATCTGGCTGGATGACTCTAC 59.302 50.000 21.23 0.00 44.01 2.59
326 2983 2.961741 GACATCTGGCTGGATGACTCTA 59.038 50.000 21.23 0.00 44.01 2.43
361 3018 2.656069 TAGCCACCTTCACCTCGCC 61.656 63.158 0.00 0.00 0.00 5.54
393 3050 1.203300 TCACCTCTGATCCCAACTCCA 60.203 52.381 0.00 0.00 0.00 3.86
404 3061 1.185618 CCAACTCCGGTCACCTCTGA 61.186 60.000 0.00 0.00 0.00 3.27
478 3135 2.420890 CAGGATGGCTCTCGCTCC 59.579 66.667 0.00 0.00 36.09 4.70
492 3149 1.209019 CCTCACAATCCTCAGTCCAGG 59.791 57.143 0.00 0.00 34.40 4.45
493 3150 1.406614 GCCTCACAATCCTCAGTCCAG 60.407 57.143 0.00 0.00 0.00 3.86
494 3151 0.615331 GCCTCACAATCCTCAGTCCA 59.385 55.000 0.00 0.00 0.00 4.02
495 3152 0.107459 GGCCTCACAATCCTCAGTCC 60.107 60.000 0.00 0.00 0.00 3.85
496 3153 0.908198 AGGCCTCACAATCCTCAGTC 59.092 55.000 0.00 0.00 0.00 3.51
497 3154 0.908198 GAGGCCTCACAATCCTCAGT 59.092 55.000 28.43 0.00 44.38 3.41
498 3155 0.179936 GGAGGCCTCACAATCCTCAG 59.820 60.000 33.29 0.00 46.24 3.35
499 3156 0.547471 TGGAGGCCTCACAATCCTCA 60.547 55.000 33.29 16.75 46.24 3.86
500 3157 0.620556 TTGGAGGCCTCACAATCCTC 59.379 55.000 33.29 14.26 44.28 3.71
501 3158 0.622665 CTTGGAGGCCTCACAATCCT 59.377 55.000 33.29 0.00 32.79 3.24
502 3159 1.034292 GCTTGGAGGCCTCACAATCC 61.034 60.000 33.29 21.10 0.00 3.01
503 3160 2.486796 GCTTGGAGGCCTCACAATC 58.513 57.895 33.29 23.57 0.00 2.67
504 3161 4.751431 GCTTGGAGGCCTCACAAT 57.249 55.556 33.29 0.00 0.00 2.71
512 3169 2.391389 CGAAAGTCGGCTTGGAGGC 61.391 63.158 1.40 0.00 36.00 4.70
513 3170 0.737715 CTCGAAAGTCGGCTTGGAGG 60.738 60.000 18.48 3.86 40.88 4.30
514 3171 0.737715 CCTCGAAAGTCGGCTTGGAG 60.738 60.000 19.03 19.03 40.88 3.86
515 3172 1.292223 CCTCGAAAGTCGGCTTGGA 59.708 57.895 1.40 3.07 40.88 3.53
516 3173 1.741770 CCCTCGAAAGTCGGCTTGG 60.742 63.158 1.40 0.00 40.88 3.61
517 3174 1.741770 CCCCTCGAAAGTCGGCTTG 60.742 63.158 1.40 0.00 40.88 4.01
518 3175 2.663196 CCCCTCGAAAGTCGGCTT 59.337 61.111 0.00 0.00 40.88 4.35
519 3176 4.083862 GCCCCTCGAAAGTCGGCT 62.084 66.667 0.00 0.00 40.88 5.52
520 3177 4.083862 AGCCCCTCGAAAGTCGGC 62.084 66.667 0.00 0.00 40.88 5.54
521 3178 2.125512 CAGCCCCTCGAAAGTCGG 60.126 66.667 0.00 0.00 40.88 4.79
522 3179 2.815647 GCAGCCCCTCGAAAGTCG 60.816 66.667 0.00 0.00 42.10 4.18
523 3180 2.579684 ATCGCAGCCCCTCGAAAGTC 62.580 60.000 0.00 0.00 38.28 3.01
524 3181 2.185310 AATCGCAGCCCCTCGAAAGT 62.185 55.000 0.00 0.00 38.28 2.66
525 3182 1.026718 AAATCGCAGCCCCTCGAAAG 61.027 55.000 0.00 0.00 38.28 2.62
526 3183 1.002624 AAATCGCAGCCCCTCGAAA 60.003 52.632 0.00 0.00 38.28 3.46
527 3184 1.745115 CAAATCGCAGCCCCTCGAA 60.745 57.895 0.00 0.00 38.28 3.71
528 3185 2.125147 CAAATCGCAGCCCCTCGA 60.125 61.111 0.00 0.00 39.17 4.04
529 3186 3.204827 CCAAATCGCAGCCCCTCG 61.205 66.667 0.00 0.00 0.00 4.63
530 3187 2.044946 ACCAAATCGCAGCCCCTC 60.045 61.111 0.00 0.00 0.00 4.30
531 3188 2.361610 CACCAAATCGCAGCCCCT 60.362 61.111 0.00 0.00 0.00 4.79
532 3189 0.963355 TAACACCAAATCGCAGCCCC 60.963 55.000 0.00 0.00 0.00 5.80
533 3190 0.451783 CTAACACCAAATCGCAGCCC 59.548 55.000 0.00 0.00 0.00 5.19
534 3191 0.451783 CCTAACACCAAATCGCAGCC 59.548 55.000 0.00 0.00 0.00 4.85
535 3192 0.179163 GCCTAACACCAAATCGCAGC 60.179 55.000 0.00 0.00 0.00 5.25
536 3193 1.164411 TGCCTAACACCAAATCGCAG 58.836 50.000 0.00 0.00 0.00 5.18
537 3194 1.610363 TTGCCTAACACCAAATCGCA 58.390 45.000 0.00 0.00 0.00 5.10
538 3195 2.595386 CTTTGCCTAACACCAAATCGC 58.405 47.619 0.00 0.00 31.29 4.58
539 3196 2.030363 TGCTTTGCCTAACACCAAATCG 60.030 45.455 0.00 0.00 31.29 3.34
540 3197 3.658757 TGCTTTGCCTAACACCAAATC 57.341 42.857 0.00 0.00 31.29 2.17
541 3198 4.526262 TGTATGCTTTGCCTAACACCAAAT 59.474 37.500 0.00 0.00 31.29 2.32
542 3199 3.891977 TGTATGCTTTGCCTAACACCAAA 59.108 39.130 0.00 0.00 0.00 3.28
543 3200 3.491342 TGTATGCTTTGCCTAACACCAA 58.509 40.909 0.00 0.00 0.00 3.67
544 3201 3.147553 TGTATGCTTTGCCTAACACCA 57.852 42.857 0.00 0.00 0.00 4.17
545 3202 3.066760 GGATGTATGCTTTGCCTAACACC 59.933 47.826 0.00 0.00 0.00 4.16
546 3203 3.066760 GGGATGTATGCTTTGCCTAACAC 59.933 47.826 0.00 0.00 0.00 3.32
547 3204 3.287222 GGGATGTATGCTTTGCCTAACA 58.713 45.455 0.00 0.00 0.00 2.41
548 3205 2.623416 GGGGATGTATGCTTTGCCTAAC 59.377 50.000 0.00 0.00 0.00 2.34
549 3206 2.513738 AGGGGATGTATGCTTTGCCTAA 59.486 45.455 0.00 0.00 0.00 2.69
550 3207 2.135189 AGGGGATGTATGCTTTGCCTA 58.865 47.619 0.00 0.00 0.00 3.93
551 3208 0.929244 AGGGGATGTATGCTTTGCCT 59.071 50.000 0.00 0.00 0.00 4.75
552 3209 1.035139 CAGGGGATGTATGCTTTGCC 58.965 55.000 0.00 0.00 0.00 4.52
553 3210 1.035139 CCAGGGGATGTATGCTTTGC 58.965 55.000 0.00 0.00 0.00 3.68
554 3211 2.734755 TCCAGGGGATGTATGCTTTG 57.265 50.000 0.00 0.00 0.00 2.77
555 3212 3.464833 AGATTCCAGGGGATGTATGCTTT 59.535 43.478 0.00 0.00 0.00 3.51
556 3213 3.059097 AGATTCCAGGGGATGTATGCTT 58.941 45.455 0.00 0.00 0.00 3.91
557 3214 2.711174 AGATTCCAGGGGATGTATGCT 58.289 47.619 0.00 0.00 0.00 3.79
558 3215 3.515602 AAGATTCCAGGGGATGTATGC 57.484 47.619 0.00 0.00 0.00 3.14
559 3216 6.439636 TTCTAAGATTCCAGGGGATGTATG 57.560 41.667 0.00 0.00 0.00 2.39
560 3217 6.794493 TCATTCTAAGATTCCAGGGGATGTAT 59.206 38.462 0.00 0.00 0.00 2.29
561 3218 6.150332 TCATTCTAAGATTCCAGGGGATGTA 58.850 40.000 0.00 0.00 0.00 2.29
562 3219 4.977739 TCATTCTAAGATTCCAGGGGATGT 59.022 41.667 0.00 0.00 0.00 3.06
563 3220 5.573380 TCATTCTAAGATTCCAGGGGATG 57.427 43.478 0.00 0.00 0.00 3.51
564 3221 6.596869 TTTCATTCTAAGATTCCAGGGGAT 57.403 37.500 0.00 0.00 0.00 3.85
565 3222 6.410853 GGATTTCATTCTAAGATTCCAGGGGA 60.411 42.308 0.00 0.00 0.00 4.81
566 3223 5.772169 GGATTTCATTCTAAGATTCCAGGGG 59.228 44.000 0.00 0.00 0.00 4.79
567 3224 6.367983 TGGATTTCATTCTAAGATTCCAGGG 58.632 40.000 0.00 0.00 0.00 4.45
568 3225 7.094890 CGATGGATTTCATTCTAAGATTCCAGG 60.095 40.741 0.00 0.00 35.97 4.45
569 3226 7.443575 ACGATGGATTTCATTCTAAGATTCCAG 59.556 37.037 0.00 0.00 35.97 3.86
570 3227 7.282585 ACGATGGATTTCATTCTAAGATTCCA 58.717 34.615 0.00 0.00 35.97 3.53
571 3228 7.359598 CGACGATGGATTTCATTCTAAGATTCC 60.360 40.741 0.00 0.00 35.97 3.01
572 3229 7.382488 TCGACGATGGATTTCATTCTAAGATTC 59.618 37.037 0.00 0.00 35.97 2.52
573 3230 7.210174 TCGACGATGGATTTCATTCTAAGATT 58.790 34.615 0.00 0.00 35.97 2.40
574 3231 6.749139 TCGACGATGGATTTCATTCTAAGAT 58.251 36.000 0.00 0.00 35.97 2.40
575 3232 6.144078 TCGACGATGGATTTCATTCTAAGA 57.856 37.500 0.00 0.00 35.97 2.10
576 3233 7.413475 AATCGACGATGGATTTCATTCTAAG 57.587 36.000 11.83 0.00 35.97 2.18
577 3234 6.143919 CGAATCGACGATGGATTTCATTCTAA 59.856 38.462 11.83 0.00 35.97 2.10
578 3235 5.629435 CGAATCGACGATGGATTTCATTCTA 59.371 40.000 11.83 0.00 35.97 2.10
579 3236 4.445718 CGAATCGACGATGGATTTCATTCT 59.554 41.667 11.83 0.00 35.97 2.40
580 3237 4.692135 CGAATCGACGATGGATTTCATTC 58.308 43.478 11.83 1.65 35.97 2.67
581 3238 3.059597 GCGAATCGACGATGGATTTCATT 60.060 43.478 11.83 0.00 35.97 2.57
582 3239 2.476619 GCGAATCGACGATGGATTTCAT 59.523 45.455 11.83 0.00 39.13 2.57
583 3240 1.858458 GCGAATCGACGATGGATTTCA 59.142 47.619 11.83 0.00 34.41 2.69
584 3241 1.136884 CGCGAATCGACGATGGATTTC 60.137 52.381 11.83 4.61 41.67 2.17
585 3242 0.852777 CGCGAATCGACGATGGATTT 59.147 50.000 11.83 0.00 41.67 2.17
586 3243 0.939577 CCGCGAATCGACGATGGATT 60.940 55.000 11.83 0.00 41.67 3.01
587 3244 1.371758 CCGCGAATCGACGATGGAT 60.372 57.895 11.83 0.00 41.67 3.41
588 3245 2.025584 CCGCGAATCGACGATGGA 59.974 61.111 11.83 0.00 41.67 3.41
589 3246 3.030308 CCCGCGAATCGACGATGG 61.030 66.667 11.83 8.00 41.67 3.51
590 3247 3.692367 GCCCGCGAATCGACGATG 61.692 66.667 11.83 0.60 41.67 3.84
591 3248 4.201679 TGCCCGCGAATCGACGAT 62.202 61.111 8.23 4.05 41.67 3.73
592 3249 4.847516 CTGCCCGCGAATCGACGA 62.848 66.667 8.23 0.00 41.67 4.20
597 3254 3.439540 TTTGGCTGCCCGCGAATC 61.440 61.111 17.53 0.00 40.44 2.52
598 3255 3.747976 GTTTGGCTGCCCGCGAAT 61.748 61.111 17.53 0.00 40.44 3.34
603 3260 2.047655 TACTCGTTTGGCTGCCCG 60.048 61.111 17.53 12.85 0.00 6.13
604 3261 0.107654 ATCTACTCGTTTGGCTGCCC 60.108 55.000 17.53 0.00 0.00 5.36
605 3262 2.596904 TATCTACTCGTTTGGCTGCC 57.403 50.000 12.87 12.87 0.00 4.85
606 3263 3.248602 CCAATATCTACTCGTTTGGCTGC 59.751 47.826 0.00 0.00 31.29 5.25
607 3264 4.693283 TCCAATATCTACTCGTTTGGCTG 58.307 43.478 0.00 0.00 37.37 4.85
608 3265 5.552870 ATCCAATATCTACTCGTTTGGCT 57.447 39.130 0.00 0.00 37.37 4.75
609 3266 6.564125 CGAAATCCAATATCTACTCGTTTGGC 60.564 42.308 0.00 0.00 37.37 4.52
610 3267 6.564125 GCGAAATCCAATATCTACTCGTTTGG 60.564 42.308 0.00 0.00 38.52 3.28
611 3268 6.019075 TGCGAAATCCAATATCTACTCGTTTG 60.019 38.462 0.00 0.00 0.00 2.93
612 3269 6.046593 TGCGAAATCCAATATCTACTCGTTT 58.953 36.000 0.00 0.00 0.00 3.60
613 3270 5.597806 TGCGAAATCCAATATCTACTCGTT 58.402 37.500 0.00 0.00 0.00 3.85
614 3271 5.196341 TGCGAAATCCAATATCTACTCGT 57.804 39.130 0.00 0.00 0.00 4.18
615 3272 6.525121 TTTGCGAAATCCAATATCTACTCG 57.475 37.500 0.00 0.00 0.00 4.18
616 3273 8.087982 TCATTTGCGAAATCCAATATCTACTC 57.912 34.615 0.00 0.00 0.00 2.59
617 3274 8.450578 TTCATTTGCGAAATCCAATATCTACT 57.549 30.769 0.00 0.00 0.00 2.57
618 3275 9.683069 ATTTCATTTGCGAAATCCAATATCTAC 57.317 29.630 0.00 0.00 40.75 2.59
629 3286 5.247507 TCGATGGATTTCATTTGCGAAAT 57.752 34.783 0.00 0.00 45.91 2.17
630 3287 4.693538 TCGATGGATTTCATTTGCGAAA 57.306 36.364 0.00 0.00 39.13 3.46
631 3288 4.898829 ATCGATGGATTTCATTTGCGAA 57.101 36.364 0.00 0.00 34.70 4.70
632 3289 4.600032 CAATCGATGGATTTCATTTGCGA 58.400 39.130 0.00 0.00 40.90 5.10
633 3290 3.180980 GCAATCGATGGATTTCATTTGCG 59.819 43.478 3.24 0.00 40.90 4.85
634 3291 4.114073 TGCAATCGATGGATTTCATTTGC 58.886 39.130 3.24 5.04 42.76 3.68
635 3292 5.005971 GGTTGCAATCGATGGATTTCATTTG 59.994 40.000 3.24 0.00 40.90 2.32
636 3293 5.111293 GGTTGCAATCGATGGATTTCATTT 58.889 37.500 3.24 0.00 40.90 2.32
637 3294 4.441913 GGGTTGCAATCGATGGATTTCATT 60.442 41.667 3.24 0.00 40.90 2.57
638 3295 3.068590 GGGTTGCAATCGATGGATTTCAT 59.931 43.478 3.24 0.00 40.90 2.57
639 3296 2.426738 GGGTTGCAATCGATGGATTTCA 59.573 45.455 3.24 0.00 40.90 2.69
640 3297 2.426738 TGGGTTGCAATCGATGGATTTC 59.573 45.455 3.24 0.00 40.90 2.17
641 3298 2.455557 TGGGTTGCAATCGATGGATTT 58.544 42.857 3.24 0.00 40.90 2.17
642 3299 2.142356 TGGGTTGCAATCGATGGATT 57.858 45.000 3.24 0.00 43.62 3.01
643 3300 2.142356 TTGGGTTGCAATCGATGGAT 57.858 45.000 3.24 0.00 0.00 3.41
644 3301 1.916506 TTTGGGTTGCAATCGATGGA 58.083 45.000 3.24 0.00 0.00 3.41
645 3302 2.166050 TCATTTGGGTTGCAATCGATGG 59.834 45.455 0.59 0.00 0.00 3.51
646 3303 3.507103 TCATTTGGGTTGCAATCGATG 57.493 42.857 0.59 7.65 0.00 3.84
647 3304 3.181473 CCATCATTTGGGTTGCAATCGAT 60.181 43.478 0.59 0.00 42.33 3.59
648 3305 2.166050 CCATCATTTGGGTTGCAATCGA 59.834 45.455 0.59 0.00 42.33 3.59
649 3306 2.542597 CCATCATTTGGGTTGCAATCG 58.457 47.619 0.59 0.00 42.33 3.34
659 3316 3.195396 CCTGTTTGGTACCCATCATTTGG 59.805 47.826 10.07 0.00 46.00 3.28
660 3317 3.368323 GCCTGTTTGGTACCCATCATTTG 60.368 47.826 10.07 0.00 38.35 2.32
661 3318 2.831526 GCCTGTTTGGTACCCATCATTT 59.168 45.455 10.07 0.00 38.35 2.32
662 3319 2.042979 AGCCTGTTTGGTACCCATCATT 59.957 45.455 10.07 0.00 38.35 2.57
663 3320 1.640670 AGCCTGTTTGGTACCCATCAT 59.359 47.619 10.07 0.00 38.35 2.45
664 3321 1.072266 AGCCTGTTTGGTACCCATCA 58.928 50.000 10.07 2.85 38.35 3.07
665 3322 1.463674 CAGCCTGTTTGGTACCCATC 58.536 55.000 10.07 0.00 38.35 3.51
666 3323 0.611896 GCAGCCTGTTTGGTACCCAT 60.612 55.000 10.07 0.00 38.35 4.00
667 3324 1.228429 GCAGCCTGTTTGGTACCCA 60.228 57.895 10.07 0.00 38.35 4.51
668 3325 0.825840 TTGCAGCCTGTTTGGTACCC 60.826 55.000 10.07 0.00 38.35 3.69
669 3326 0.598065 CTTGCAGCCTGTTTGGTACC 59.402 55.000 4.43 4.43 38.35 3.34
670 3327 0.598065 CCTTGCAGCCTGTTTGGTAC 59.402 55.000 0.00 0.00 38.35 3.34
671 3328 0.539438 CCCTTGCAGCCTGTTTGGTA 60.539 55.000 0.00 0.00 38.35 3.25
672 3329 1.833934 CCCTTGCAGCCTGTTTGGT 60.834 57.895 0.00 0.00 38.35 3.67
673 3330 1.402107 AACCCTTGCAGCCTGTTTGG 61.402 55.000 0.00 0.00 39.35 3.28
674 3331 0.465287 AAACCCTTGCAGCCTGTTTG 59.535 50.000 0.00 0.00 0.00 2.93
675 3332 0.752658 GAAACCCTTGCAGCCTGTTT 59.247 50.000 0.00 5.70 32.23 2.83
676 3333 1.115326 GGAAACCCTTGCAGCCTGTT 61.115 55.000 0.00 0.00 0.00 3.16
677 3334 1.531602 GGAAACCCTTGCAGCCTGT 60.532 57.895 0.00 0.00 0.00 4.00
678 3335 3.369921 GGAAACCCTTGCAGCCTG 58.630 61.111 0.00 0.00 0.00 4.85
690 3347 6.479006 AGTTAACTACCACCAATAGGGAAAC 58.521 40.000 6.26 0.00 41.15 2.78
691 3348 6.707273 AGTTAACTACCACCAATAGGGAAA 57.293 37.500 6.26 0.00 41.15 3.13
692 3349 7.186570 GTAGTTAACTACCACCAATAGGGAA 57.813 40.000 28.28 0.00 42.19 3.97
693 3350 6.796785 GTAGTTAACTACCACCAATAGGGA 57.203 41.667 28.28 0.00 42.19 4.20
705 3362 4.702131 TGGACGGAAGGAGTAGTTAACTAC 59.298 45.833 30.33 30.33 46.93 2.73
706 3363 4.922206 TGGACGGAAGGAGTAGTTAACTA 58.078 43.478 11.38 11.38 39.07 2.24
707 3364 3.771216 TGGACGGAAGGAGTAGTTAACT 58.229 45.455 13.68 13.68 42.80 2.24
708 3365 4.430908 CATGGACGGAAGGAGTAGTTAAC 58.569 47.826 0.00 0.00 0.00 2.01
709 3366 3.118884 GCATGGACGGAAGGAGTAGTTAA 60.119 47.826 0.00 0.00 0.00 2.01
710 3367 2.429610 GCATGGACGGAAGGAGTAGTTA 59.570 50.000 0.00 0.00 0.00 2.24
711 3368 1.207329 GCATGGACGGAAGGAGTAGTT 59.793 52.381 0.00 0.00 0.00 2.24
712 3369 0.824759 GCATGGACGGAAGGAGTAGT 59.175 55.000 0.00 0.00 0.00 2.73
713 3370 0.824109 TGCATGGACGGAAGGAGTAG 59.176 55.000 0.00 0.00 0.00 2.57
714 3371 1.412710 GATGCATGGACGGAAGGAGTA 59.587 52.381 2.46 0.00 0.00 2.59
715 3372 0.179000 GATGCATGGACGGAAGGAGT 59.821 55.000 2.46 0.00 0.00 3.85
716 3373 0.533755 GGATGCATGGACGGAAGGAG 60.534 60.000 2.46 0.00 0.00 3.69
717 3374 1.271127 TGGATGCATGGACGGAAGGA 61.271 55.000 2.46 0.00 0.00 3.36
718 3375 0.179009 ATGGATGCATGGACGGAAGG 60.179 55.000 2.46 0.00 0.00 3.46
719 3376 1.683943 AATGGATGCATGGACGGAAG 58.316 50.000 2.46 0.00 0.00 3.46
720 3377 2.142356 AAATGGATGCATGGACGGAA 57.858 45.000 2.46 0.00 0.00 4.30
721 3378 1.750206 CAAAATGGATGCATGGACGGA 59.250 47.619 2.46 0.00 0.00 4.69
722 3379 1.750206 TCAAAATGGATGCATGGACGG 59.250 47.619 2.46 0.00 0.00 4.79
723 3380 3.067040 TCATCAAAATGGATGCATGGACG 59.933 43.478 2.46 0.00 43.44 4.79
724 3381 4.142116 TGTCATCAAAATGGATGCATGGAC 60.142 41.667 2.46 3.44 43.44 4.02
725 3382 4.024670 TGTCATCAAAATGGATGCATGGA 58.975 39.130 2.46 0.00 43.44 3.41
726 3383 4.394439 TGTCATCAAAATGGATGCATGG 57.606 40.909 2.46 0.00 43.44 3.66
727 3384 5.416083 ACTTGTCATCAAAATGGATGCATG 58.584 37.500 2.46 0.00 43.44 4.06
728 3385 5.670792 ACTTGTCATCAAAATGGATGCAT 57.329 34.783 0.00 0.00 43.44 3.96
729 3386 6.778834 ATACTTGTCATCAAAATGGATGCA 57.221 33.333 0.00 0.00 43.44 3.96
730 3387 7.223387 GGAAATACTTGTCATCAAAATGGATGC 59.777 37.037 0.00 0.00 43.44 3.91
731 3388 7.433131 CGGAAATACTTGTCATCAAAATGGATG 59.567 37.037 0.00 0.00 44.78 3.51
732 3389 7.416664 CCGGAAATACTTGTCATCAAAATGGAT 60.417 37.037 0.00 0.00 33.42 3.41
733 3390 6.127758 CCGGAAATACTTGTCATCAAAATGGA 60.128 38.462 0.00 0.00 33.42 3.41
734 3391 6.035843 CCGGAAATACTTGTCATCAAAATGG 58.964 40.000 0.00 0.00 33.42 3.16
735 3392 6.747280 GTCCGGAAATACTTGTCATCAAAATG 59.253 38.462 5.23 0.00 32.87 2.32
736 3393 6.403200 CGTCCGGAAATACTTGTCATCAAAAT 60.403 38.462 5.23 0.00 32.87 1.82
737 3394 5.106869 CGTCCGGAAATACTTGTCATCAAAA 60.107 40.000 5.23 0.00 32.87 2.44
738 3395 4.390603 CGTCCGGAAATACTTGTCATCAAA 59.609 41.667 5.23 0.00 32.87 2.69
739 3396 3.930229 CGTCCGGAAATACTTGTCATCAA 59.070 43.478 5.23 0.00 0.00 2.57
740 3397 3.517602 CGTCCGGAAATACTTGTCATCA 58.482 45.455 5.23 0.00 0.00 3.07
741 3398 2.864343 CCGTCCGGAAATACTTGTCATC 59.136 50.000 5.23 0.00 37.50 2.92
742 3399 2.498481 TCCGTCCGGAAATACTTGTCAT 59.502 45.455 5.23 0.00 42.05 3.06
743 3400 1.894466 TCCGTCCGGAAATACTTGTCA 59.106 47.619 5.23 0.00 42.05 3.58
744 3401 2.537401 CTCCGTCCGGAAATACTTGTC 58.463 52.381 5.23 0.00 44.66 3.18
745 3402 1.206371 CCTCCGTCCGGAAATACTTGT 59.794 52.381 5.23 0.00 44.66 3.16
746 3403 1.472728 CCCTCCGTCCGGAAATACTTG 60.473 57.143 5.23 0.00 44.66 3.16
747 3404 0.828677 CCCTCCGTCCGGAAATACTT 59.171 55.000 5.23 0.00 44.66 2.24
748 3405 0.032813 TCCCTCCGTCCGGAAATACT 60.033 55.000 5.23 0.00 44.66 2.12
749 3406 0.388294 CTCCCTCCGTCCGGAAATAC 59.612 60.000 5.23 0.00 44.66 1.89
750 3407 0.032813 ACTCCCTCCGTCCGGAAATA 60.033 55.000 5.23 0.00 44.66 1.40
751 3408 0.032813 TACTCCCTCCGTCCGGAAAT 60.033 55.000 5.23 0.00 44.66 2.17
752 3409 0.032813 ATACTCCCTCCGTCCGGAAA 60.033 55.000 5.23 0.00 44.66 3.13
753 3410 0.754217 CATACTCCCTCCGTCCGGAA 60.754 60.000 5.23 0.00 44.66 4.30
754 3411 1.152819 CATACTCCCTCCGTCCGGA 60.153 63.158 0.00 0.00 42.90 5.14
755 3412 0.179009 TACATACTCCCTCCGTCCGG 60.179 60.000 0.00 0.00 0.00 5.14
756 3413 1.236628 CTACATACTCCCTCCGTCCG 58.763 60.000 0.00 0.00 0.00 4.79
757 3414 2.361643 ACTACATACTCCCTCCGTCC 57.638 55.000 0.00 0.00 0.00 4.79
758 3415 4.826183 ACATAACTACATACTCCCTCCGTC 59.174 45.833 0.00 0.00 0.00 4.79
759 3416 4.801164 ACATAACTACATACTCCCTCCGT 58.199 43.478 0.00 0.00 0.00 4.69
760 3417 6.236409 TCTACATAACTACATACTCCCTCCG 58.764 44.000 0.00 0.00 0.00 4.63
761 3418 8.474710 TTTCTACATAACTACATACTCCCTCC 57.525 38.462 0.00 0.00 0.00 4.30
762 3419 9.747293 GTTTTCTACATAACTACATACTCCCTC 57.253 37.037 0.00 0.00 0.00 4.30
763 3420 8.411683 CGTTTTCTACATAACTACATACTCCCT 58.588 37.037 0.00 0.00 0.00 4.20
764 3421 8.408601 TCGTTTTCTACATAACTACATACTCCC 58.591 37.037 0.00 0.00 0.00 4.30
765 3422 9.230932 GTCGTTTTCTACATAACTACATACTCC 57.769 37.037 0.00 0.00 0.00 3.85
766 3423 8.941923 CGTCGTTTTCTACATAACTACATACTC 58.058 37.037 0.00 0.00 0.00 2.59
767 3424 8.668353 TCGTCGTTTTCTACATAACTACATACT 58.332 33.333 0.00 0.00 0.00 2.12
768 3425 8.728630 GTCGTCGTTTTCTACATAACTACATAC 58.271 37.037 0.00 0.00 0.00 2.39
769 3426 7.635973 CGTCGTCGTTTTCTACATAACTACATA 59.364 37.037 0.00 0.00 0.00 2.29
770 3427 6.467047 CGTCGTCGTTTTCTACATAACTACAT 59.533 38.462 0.00 0.00 0.00 2.29
771 3428 5.790003 CGTCGTCGTTTTCTACATAACTACA 59.210 40.000 0.00 0.00 0.00 2.74
772 3429 6.222937 CGTCGTCGTTTTCTACATAACTAC 57.777 41.667 0.00 0.00 0.00 2.73
788 3445 3.767230 CAAGGCAGCACGTCGTCG 61.767 66.667 0.00 0.00 43.34 5.12
789 3446 1.291877 ATTCAAGGCAGCACGTCGTC 61.292 55.000 0.00 0.00 0.00 4.20
790 3447 0.884704 AATTCAAGGCAGCACGTCGT 60.885 50.000 0.00 0.00 0.00 4.34
791 3448 0.238289 AAATTCAAGGCAGCACGTCG 59.762 50.000 0.00 0.00 0.00 5.12
792 3449 1.266718 TCAAATTCAAGGCAGCACGTC 59.733 47.619 0.00 0.00 0.00 4.34
793 3450 1.317613 TCAAATTCAAGGCAGCACGT 58.682 45.000 0.00 0.00 0.00 4.49
794 3451 2.420628 TTCAAATTCAAGGCAGCACG 57.579 45.000 0.00 0.00 0.00 5.34
795 3452 5.473039 AGTATTTCAAATTCAAGGCAGCAC 58.527 37.500 0.00 0.00 0.00 4.40
796 3453 5.726980 AGTATTTCAAATTCAAGGCAGCA 57.273 34.783 0.00 0.00 0.00 4.41
797 3454 5.739161 CGTAGTATTTCAAATTCAAGGCAGC 59.261 40.000 0.00 0.00 0.00 5.25
798 3455 6.842163 ACGTAGTATTTCAAATTCAAGGCAG 58.158 36.000 0.00 0.00 41.94 4.85
799 3456 6.811253 ACGTAGTATTTCAAATTCAAGGCA 57.189 33.333 0.00 0.00 41.94 4.75
800 3457 8.515473 AAAACGTAGTATTTCAAATTCAAGGC 57.485 30.769 0.00 0.00 45.00 4.35
839 3496 9.929180 CTGATTGAATCGTATATAAAGAGGGAA 57.071 33.333 0.18 0.00 0.00 3.97
840 3497 8.035394 GCTGATTGAATCGTATATAAAGAGGGA 58.965 37.037 0.18 0.00 0.00 4.20
841 3498 7.009631 CGCTGATTGAATCGTATATAAAGAGGG 59.990 40.741 0.18 0.00 0.00 4.30
842 3499 7.542477 ACGCTGATTGAATCGTATATAAAGAGG 59.458 37.037 0.18 0.00 33.02 3.69
843 3500 8.454293 ACGCTGATTGAATCGTATATAAAGAG 57.546 34.615 0.18 0.00 33.02 2.85
844 3501 8.079809 TGACGCTGATTGAATCGTATATAAAGA 58.920 33.333 0.18 0.00 35.12 2.52
845 3502 8.156553 GTGACGCTGATTGAATCGTATATAAAG 58.843 37.037 0.18 0.00 35.12 1.85
846 3503 7.650104 TGTGACGCTGATTGAATCGTATATAAA 59.350 33.333 0.18 0.00 35.12 1.40
847 3504 7.142680 TGTGACGCTGATTGAATCGTATATAA 58.857 34.615 0.18 0.00 35.12 0.98
848 3505 6.674066 TGTGACGCTGATTGAATCGTATATA 58.326 36.000 0.18 0.00 35.12 0.86
849 3506 5.528870 TGTGACGCTGATTGAATCGTATAT 58.471 37.500 0.18 0.00 35.12 0.86
850 3507 4.927422 TGTGACGCTGATTGAATCGTATA 58.073 39.130 0.18 0.00 35.12 1.47
851 3508 3.780902 TGTGACGCTGATTGAATCGTAT 58.219 40.909 0.18 0.00 35.12 3.06
852 3509 3.224884 TGTGACGCTGATTGAATCGTA 57.775 42.857 0.18 0.00 35.12 3.43
853 3510 2.078849 TGTGACGCTGATTGAATCGT 57.921 45.000 0.18 0.00 37.92 3.73
854 3511 2.604462 TGATGTGACGCTGATTGAATCG 59.396 45.455 0.18 0.00 0.00 3.34
855 3512 3.620374 AGTGATGTGACGCTGATTGAATC 59.380 43.478 0.00 0.00 0.00 2.52
856 3513 3.603532 AGTGATGTGACGCTGATTGAAT 58.396 40.909 0.00 0.00 0.00 2.57
857 3514 3.044235 AGTGATGTGACGCTGATTGAA 57.956 42.857 0.00 0.00 0.00 2.69
858 3515 2.738314 CAAGTGATGTGACGCTGATTGA 59.262 45.455 0.00 0.00 0.00 2.57
859 3516 2.738314 TCAAGTGATGTGACGCTGATTG 59.262 45.455 0.00 0.00 0.00 2.67
860 3517 3.044235 TCAAGTGATGTGACGCTGATT 57.956 42.857 0.00 0.00 0.00 2.57
861 3518 2.749280 TCAAGTGATGTGACGCTGAT 57.251 45.000 0.00 0.00 0.00 2.90
862 3519 2.524569 TTCAAGTGATGTGACGCTGA 57.475 45.000 0.00 0.00 0.00 4.26
863 3520 3.248363 TCTTTTCAAGTGATGTGACGCTG 59.752 43.478 0.00 0.00 0.00 5.18
864 3521 3.466836 TCTTTTCAAGTGATGTGACGCT 58.533 40.909 0.00 0.00 0.00 5.07
865 3522 3.494626 TCTCTTTTCAAGTGATGTGACGC 59.505 43.478 0.00 0.00 0.00 5.19
866 3523 4.151335 CCTCTCTTTTCAAGTGATGTGACG 59.849 45.833 0.00 0.00 31.36 4.35
867 3524 4.453819 CCCTCTCTTTTCAAGTGATGTGAC 59.546 45.833 0.00 0.00 31.36 3.67
868 3525 4.347876 TCCCTCTCTTTTCAAGTGATGTGA 59.652 41.667 0.00 0.00 31.36 3.58
869 3526 4.645535 TCCCTCTCTTTTCAAGTGATGTG 58.354 43.478 0.00 0.00 31.36 3.21
870 3527 4.982241 TCCCTCTCTTTTCAAGTGATGT 57.018 40.909 0.00 0.00 31.36 3.06
871 3528 5.494724 TCATCCCTCTCTTTTCAAGTGATG 58.505 41.667 0.00 0.00 31.36 3.07
872 3529 5.743117 CTCATCCCTCTCTTTTCAAGTGAT 58.257 41.667 0.00 0.00 31.36 3.06
873 3530 4.564406 GCTCATCCCTCTCTTTTCAAGTGA 60.564 45.833 0.00 0.00 0.00 3.41
874 3531 3.688673 GCTCATCCCTCTCTTTTCAAGTG 59.311 47.826 0.00 0.00 0.00 3.16
875 3532 3.586618 AGCTCATCCCTCTCTTTTCAAGT 59.413 43.478 0.00 0.00 0.00 3.16
876 3533 4.190772 GAGCTCATCCCTCTCTTTTCAAG 58.809 47.826 9.40 0.00 0.00 3.02
877 3534 3.368843 CGAGCTCATCCCTCTCTTTTCAA 60.369 47.826 15.40 0.00 0.00 2.69
878 3535 2.167281 CGAGCTCATCCCTCTCTTTTCA 59.833 50.000 15.40 0.00 0.00 2.69
879 3536 2.820330 CGAGCTCATCCCTCTCTTTTC 58.180 52.381 15.40 0.00 0.00 2.29
880 3537 1.134551 GCGAGCTCATCCCTCTCTTTT 60.135 52.381 15.40 0.00 0.00 2.27
881 3538 0.463620 GCGAGCTCATCCCTCTCTTT 59.536 55.000 15.40 0.00 0.00 2.52
882 3539 1.398958 GGCGAGCTCATCCCTCTCTT 61.399 60.000 15.40 0.00 0.00 2.85
883 3540 1.832167 GGCGAGCTCATCCCTCTCT 60.832 63.158 15.40 0.00 0.00 3.10
884 3541 2.733945 GGCGAGCTCATCCCTCTC 59.266 66.667 15.40 0.00 0.00 3.20
885 3542 3.222855 CGGCGAGCTCATCCCTCT 61.223 66.667 15.40 0.00 0.00 3.69
886 3543 4.292178 CCGGCGAGCTCATCCCTC 62.292 72.222 15.40 0.00 0.00 4.30
887 3544 4.841617 TCCGGCGAGCTCATCCCT 62.842 66.667 15.40 0.00 0.00 4.20
888 3545 4.292178 CTCCGGCGAGCTCATCCC 62.292 72.222 15.40 9.61 0.00 3.85
896 3553 3.589654 TTGTTGAGGCTCCGGCGAG 62.590 63.158 9.30 5.11 39.81 5.03
897 3554 2.668185 TTTTGTTGAGGCTCCGGCGA 62.668 55.000 9.30 0.00 39.81 5.54
898 3555 1.791103 TTTTTGTTGAGGCTCCGGCG 61.791 55.000 12.86 0.00 39.81 6.46
899 3556 2.037871 TTTTTGTTGAGGCTCCGGC 58.962 52.632 12.86 2.59 37.82 6.13
918 3575 6.097270 GGCCCCCGTTCTTATTAATAGTTTTT 59.903 38.462 0.00 0.00 0.00 1.94
919 3576 5.595542 GGCCCCCGTTCTTATTAATAGTTTT 59.404 40.000 0.00 0.00 0.00 2.43
920 3577 5.135383 GGCCCCCGTTCTTATTAATAGTTT 58.865 41.667 0.00 0.00 0.00 2.66
921 3578 4.722220 GGCCCCCGTTCTTATTAATAGTT 58.278 43.478 0.00 0.00 0.00 2.24
922 3579 3.244318 CGGCCCCCGTTCTTATTAATAGT 60.244 47.826 0.00 0.00 42.73 2.12
923 3580 3.332034 CGGCCCCCGTTCTTATTAATAG 58.668 50.000 0.00 0.00 42.73 1.73
924 3581 2.038820 CCGGCCCCCGTTCTTATTAATA 59.961 50.000 0.00 0.00 46.80 0.98
925 3582 1.202842 CCGGCCCCCGTTCTTATTAAT 60.203 52.381 0.00 0.00 46.80 1.40
926 3583 0.180878 CCGGCCCCCGTTCTTATTAA 59.819 55.000 0.00 0.00 46.80 1.40
927 3584 0.982326 ACCGGCCCCCGTTCTTATTA 60.982 55.000 0.00 0.00 46.80 0.98
928 3585 0.982326 TACCGGCCCCCGTTCTTATT 60.982 55.000 0.00 0.00 46.80 1.40
929 3586 1.382971 TACCGGCCCCCGTTCTTAT 60.383 57.895 0.00 0.00 46.80 1.73
930 3587 2.038651 TACCGGCCCCCGTTCTTA 59.961 61.111 0.00 0.00 46.80 2.10
931 3588 3.396570 CTACCGGCCCCCGTTCTT 61.397 66.667 0.00 0.00 46.80 2.52
932 3589 4.709604 ACTACCGGCCCCCGTTCT 62.710 66.667 0.00 0.00 46.80 3.01
933 3590 3.670637 GAACTACCGGCCCCCGTTC 62.671 68.421 0.00 3.73 46.80 3.95
934 3591 3.709633 GAACTACCGGCCCCCGTT 61.710 66.667 0.00 0.00 46.80 4.44
937 3594 3.094498 ATGGAACTACCGGCCCCC 61.094 66.667 0.00 0.00 42.61 5.40
938 3595 2.192175 CATGGAACTACCGGCCCC 59.808 66.667 0.00 0.00 42.61 5.80
939 3596 1.153229 GTCATGGAACTACCGGCCC 60.153 63.158 0.00 0.00 42.61 5.80
940 3597 0.252197 AAGTCATGGAACTACCGGCC 59.748 55.000 0.00 0.00 42.61 6.13
941 3598 1.369625 CAAGTCATGGAACTACCGGC 58.630 55.000 0.00 0.00 42.61 6.13
951 3608 3.359033 CCATATATGGGCCAAGTCATGG 58.641 50.000 22.31 16.87 45.07 3.66
962 3619 3.930024 TGCAGCCGCACCATATATGGG 62.930 57.143 30.82 21.47 45.36 4.00
963 3620 0.606130 TGCAGCCGCACCATATATGG 60.606 55.000 27.16 27.16 45.36 2.74
964 3621 2.931246 TGCAGCCGCACCATATATG 58.069 52.632 5.68 5.68 45.36 1.78
974 3631 2.202349 GTCAACGAATGCAGCCGC 60.202 61.111 9.98 0.00 39.24 6.53
975 3632 2.480555 GGTCAACGAATGCAGCCG 59.519 61.111 8.70 8.70 0.00 5.52
976 3633 2.877691 GGGTCAACGAATGCAGCC 59.122 61.111 0.00 0.00 0.00 4.85
977 3634 2.480555 CGGGTCAACGAATGCAGC 59.519 61.111 0.00 0.00 35.47 5.25
978 3635 0.953471 TTCCGGGTCAACGAATGCAG 60.953 55.000 0.00 0.00 35.47 4.41
979 3636 0.953471 CTTCCGGGTCAACGAATGCA 60.953 55.000 0.00 0.00 35.47 3.96
980 3637 1.794222 CTTCCGGGTCAACGAATGC 59.206 57.895 0.00 0.00 35.47 3.56
981 3638 0.953471 TGCTTCCGGGTCAACGAATG 60.953 55.000 0.00 0.00 35.47 2.67
982 3639 0.250553 TTGCTTCCGGGTCAACGAAT 60.251 50.000 0.00 0.00 35.47 3.34
983 3640 0.464013 TTTGCTTCCGGGTCAACGAA 60.464 50.000 0.00 0.00 35.47 3.85
984 3641 1.146485 TTTGCTTCCGGGTCAACGA 59.854 52.632 0.00 0.00 35.47 3.85
985 3642 1.281656 GTTTGCTTCCGGGTCAACG 59.718 57.895 0.00 0.00 0.00 4.10
986 3643 0.958822 ATGTTTGCTTCCGGGTCAAC 59.041 50.000 0.00 0.00 0.00 3.18
987 3644 1.243902 GATGTTTGCTTCCGGGTCAA 58.756 50.000 0.00 0.19 0.00 3.18
988 3645 0.109532 TGATGTTTGCTTCCGGGTCA 59.890 50.000 0.00 0.00 0.00 4.02
989 3646 1.133025 CATGATGTTTGCTTCCGGGTC 59.867 52.381 0.00 0.00 0.00 4.46
990 3647 1.176527 CATGATGTTTGCTTCCGGGT 58.823 50.000 0.00 0.00 0.00 5.28
991 3648 1.462616 TCATGATGTTTGCTTCCGGG 58.537 50.000 0.00 0.00 0.00 5.73
992 3649 2.733227 GCTTCATGATGTTTGCTTCCGG 60.733 50.000 10.05 0.00 0.00 5.14
993 3650 2.095110 TGCTTCATGATGTTTGCTTCCG 60.095 45.455 10.05 0.00 0.00 4.30
994 3651 3.057033 ACTGCTTCATGATGTTTGCTTCC 60.057 43.478 10.05 0.00 0.00 3.46
995 3652 4.164294 GACTGCTTCATGATGTTTGCTTC 58.836 43.478 10.05 2.62 0.00 3.86
996 3653 3.570975 TGACTGCTTCATGATGTTTGCTT 59.429 39.130 10.05 0.00 0.00 3.91
997 3654 3.151554 TGACTGCTTCATGATGTTTGCT 58.848 40.909 10.05 0.00 0.00 3.91
998 3655 3.564235 TGACTGCTTCATGATGTTTGC 57.436 42.857 10.05 4.76 0.00 3.68
999 3656 4.216902 TCCTTGACTGCTTCATGATGTTTG 59.783 41.667 10.05 4.00 32.84 2.93
1000 3657 4.401022 TCCTTGACTGCTTCATGATGTTT 58.599 39.130 10.05 0.00 32.84 2.83
1001 3658 4.025040 TCCTTGACTGCTTCATGATGTT 57.975 40.909 10.05 0.00 32.84 2.71
1002 3659 3.708403 TCCTTGACTGCTTCATGATGT 57.292 42.857 10.05 1.37 32.84 3.06
1003 3660 3.377485 CCTTCCTTGACTGCTTCATGATG 59.623 47.826 0.00 0.00 32.84 3.07
1004 3661 3.265221 TCCTTCCTTGACTGCTTCATGAT 59.735 43.478 0.00 0.00 32.84 2.45
1005 3662 2.639347 TCCTTCCTTGACTGCTTCATGA 59.361 45.455 0.00 0.00 32.84 3.07
1006 3663 3.063510 TCCTTCCTTGACTGCTTCATG 57.936 47.619 0.00 0.00 32.84 3.07
1007 3664 3.795688 TTCCTTCCTTGACTGCTTCAT 57.204 42.857 0.00 0.00 32.84 2.57
1008 3665 3.480470 CTTTCCTTCCTTGACTGCTTCA 58.520 45.455 0.00 0.00 0.00 3.02
1009 3666 2.227626 GCTTTCCTTCCTTGACTGCTTC 59.772 50.000 0.00 0.00 0.00 3.86
1010 3667 2.234143 GCTTTCCTTCCTTGACTGCTT 58.766 47.619 0.00 0.00 0.00 3.91
1011 3668 1.879796 CGCTTTCCTTCCTTGACTGCT 60.880 52.381 0.00 0.00 0.00 4.24
1012 3669 0.519077 CGCTTTCCTTCCTTGACTGC 59.481 55.000 0.00 0.00 0.00 4.40
1013 3670 1.160137 CCGCTTTCCTTCCTTGACTG 58.840 55.000 0.00 0.00 0.00 3.51
1014 3671 0.765510 ACCGCTTTCCTTCCTTGACT 59.234 50.000 0.00 0.00 0.00 3.41
1015 3672 1.157585 GACCGCTTTCCTTCCTTGAC 58.842 55.000 0.00 0.00 0.00 3.18
1016 3673 0.762418 TGACCGCTTTCCTTCCTTGA 59.238 50.000 0.00 0.00 0.00 3.02
1017 3674 1.160137 CTGACCGCTTTCCTTCCTTG 58.840 55.000 0.00 0.00 0.00 3.61
1018 3675 0.036875 CCTGACCGCTTTCCTTCCTT 59.963 55.000 0.00 0.00 0.00 3.36
1019 3676 0.836400 TCCTGACCGCTTTCCTTCCT 60.836 55.000 0.00 0.00 0.00 3.36
1020 3677 0.036306 TTCCTGACCGCTTTCCTTCC 59.964 55.000 0.00 0.00 0.00 3.46
1021 3678 1.270893 ACTTCCTGACCGCTTTCCTTC 60.271 52.381 0.00 0.00 0.00 3.46
1022 3679 0.765510 ACTTCCTGACCGCTTTCCTT 59.234 50.000 0.00 0.00 0.00 3.36
1023 3680 0.321996 GACTTCCTGACCGCTTTCCT 59.678 55.000 0.00 0.00 0.00 3.36
1024 3681 0.673956 GGACTTCCTGACCGCTTTCC 60.674 60.000 0.00 0.00 0.00 3.13
1025 3682 0.673956 GGGACTTCCTGACCGCTTTC 60.674 60.000 0.00 0.00 35.95 2.62
1026 3683 1.375326 GGGACTTCCTGACCGCTTT 59.625 57.895 0.00 0.00 35.95 3.51
1027 3684 2.943978 CGGGACTTCCTGACCGCTT 61.944 63.158 0.00 0.00 45.36 4.68
1028 3685 3.382832 CGGGACTTCCTGACCGCT 61.383 66.667 0.00 0.00 45.36 5.52
1029 3686 4.452733 CCGGGACTTCCTGACCGC 62.453 72.222 5.59 0.00 45.36 5.68
1030 3687 2.678934 TCCGGGACTTCCTGACCG 60.679 66.667 0.00 0.00 45.36 4.79
1031 3688 2.359967 CCTCCGGGACTTCCTGACC 61.360 68.421 0.00 0.00 45.36 4.02
1032 3689 1.305046 TCCTCCGGGACTTCCTGAC 60.305 63.158 0.00 0.00 45.36 3.51
1033 3690 1.000486 CTCCTCCGGGACTTCCTGA 60.000 63.158 0.00 0.00 45.36 3.86
1034 3691 1.305381 ACTCCTCCGGGACTTCCTG 60.305 63.158 0.00 0.00 42.13 3.86
1035 3692 1.305381 CACTCCTCCGGGACTTCCT 60.305 63.158 0.00 0.00 36.57 3.36
1036 3693 3.020237 GCACTCCTCCGGGACTTCC 62.020 68.421 0.00 0.00 36.57 3.46
1037 3694 2.579738 GCACTCCTCCGGGACTTC 59.420 66.667 0.00 0.00 36.57 3.01
1038 3695 3.003763 GGCACTCCTCCGGGACTT 61.004 66.667 0.00 0.00 36.57 3.01
1057 3714 3.390521 AGGCCGATGACCTTCGCA 61.391 61.111 0.00 0.00 37.80 5.10
1065 3722 3.838271 GCGAGGTCAGGCCGATGA 61.838 66.667 0.00 0.00 43.70 2.92
1111 3768 4.162690 GACTGGAAGGCCGCGGAT 62.163 66.667 33.48 14.48 33.95 4.18
1123 3780 4.803426 GAGTCTGCCGCCGACTGG 62.803 72.222 20.67 0.00 41.53 4.00
1125 3782 3.753434 CAGAGTCTGCCGCCGACT 61.753 66.667 16.40 16.40 43.97 4.18
1135 3792 2.645567 CACACGGCGTCAGAGTCT 59.354 61.111 10.85 0.00 0.00 3.24
1141 3798 3.680786 CTCTCCCACACGGCGTCA 61.681 66.667 10.85 0.00 0.00 4.35
1157 3814 4.021925 GTCCAGCGGCAGGAACCT 62.022 66.667 16.21 0.00 36.80 3.50
1210 3867 2.482494 TCCTTCTTGGAGGAGGAATCC 58.518 52.381 2.39 0.00 40.87 3.01
1249 3906 1.433879 GAGGAGGACATGGTCGTCG 59.566 63.158 11.51 0.00 44.99 5.12
1255 3912 2.808315 CCGTCGAGGAGGACATGG 59.192 66.667 6.70 0.00 45.00 3.66
1272 3929 2.743928 CACTCACCCTCTTGCCGC 60.744 66.667 0.00 0.00 0.00 6.53
1273 3930 2.743928 GCACTCACCCTCTTGCCG 60.744 66.667 0.00 0.00 0.00 5.69
1279 3936 1.546029 GGAAATTTGGCACTCACCCTC 59.454 52.381 0.00 0.00 0.00 4.30
1290 3947 4.717233 TCATGAATGACCGGAAATTTGG 57.283 40.909 9.46 0.00 0.00 3.28
1330 3987 9.967245 CGAAGAAACAAATTAGACAAATCGATA 57.033 29.630 0.00 0.00 0.00 2.92
1346 4003 6.934645 ACTGATCCACTTTATCGAAGAAACAA 59.065 34.615 0.00 0.00 43.58 2.83
1354 4011 6.961360 ATCAGTACTGATCCACTTTATCGA 57.039 37.500 28.95 3.22 46.57 3.59
1367 4024 9.907229 ATAGTATATCCGATCAATCAGTACTGA 57.093 33.333 27.07 27.07 44.59 3.41
1368 4025 9.943163 CATAGTATATCCGATCAATCAGTACTG 57.057 37.037 17.17 17.17 0.00 2.74
1374 4031 5.736207 GCGGCATAGTATATCCGATCAATCA 60.736 44.000 20.78 0.00 44.23 2.57
1378 4035 3.020984 TGCGGCATAGTATATCCGATCA 58.979 45.455 20.78 11.04 44.23 2.92
1395 4052 4.836125 ATGTTAATTAGAAGCCATGCGG 57.164 40.909 0.00 0.00 0.00 5.69
1396 4053 5.911280 CAGAATGTTAATTAGAAGCCATGCG 59.089 40.000 0.00 0.00 0.00 4.73
1412 4069 5.488341 AGACGTATTAACCAGCAGAATGTT 58.512 37.500 0.00 0.00 39.31 2.71
1414 4071 7.534085 TTAAGACGTATTAACCAGCAGAATG 57.466 36.000 11.17 0.00 40.87 2.67
1415 4072 8.732746 AATTAAGACGTATTAACCAGCAGAAT 57.267 30.769 16.93 0.00 0.00 2.40
1416 4073 9.309516 CTAATTAAGACGTATTAACCAGCAGAA 57.690 33.333 16.93 0.00 0.00 3.02
1417 4074 8.689061 TCTAATTAAGACGTATTAACCAGCAGA 58.311 33.333 16.93 11.70 0.00 4.26
1418 4075 8.867112 TCTAATTAAGACGTATTAACCAGCAG 57.133 34.615 16.93 9.92 0.00 4.24
1419 4076 8.472413 ACTCTAATTAAGACGTATTAACCAGCA 58.528 33.333 16.93 7.18 0.00 4.41
1420 4077 8.868635 ACTCTAATTAAGACGTATTAACCAGC 57.131 34.615 16.93 0.00 0.00 4.85
1430 4087 5.557866 AGCCCAAAACTCTAATTAAGACGT 58.442 37.500 0.00 0.00 0.00 4.34
1431 4088 5.064834 GGAGCCCAAAACTCTAATTAAGACG 59.935 44.000 0.00 0.00 34.46 4.18
1432 4089 5.944007 TGGAGCCCAAAACTCTAATTAAGAC 59.056 40.000 0.00 0.00 34.46 3.01
1433 4090 5.944007 GTGGAGCCCAAAACTCTAATTAAGA 59.056 40.000 0.00 0.00 34.18 2.10
1434 4091 5.125578 GGTGGAGCCCAAAACTCTAATTAAG 59.874 44.000 0.00 0.00 34.18 1.85
1435 4092 5.014202 GGTGGAGCCCAAAACTCTAATTAA 58.986 41.667 0.00 0.00 34.18 1.40
1436 4093 4.595986 GGTGGAGCCCAAAACTCTAATTA 58.404 43.478 0.00 0.00 34.18 1.40
1437 4094 3.431415 GGTGGAGCCCAAAACTCTAATT 58.569 45.455 0.00 0.00 34.18 1.40
1438 4095 2.618045 CGGTGGAGCCCAAAACTCTAAT 60.618 50.000 0.00 0.00 34.18 1.73
1496 4153 0.181114 CCCAAGCGATTCCCATCTCA 59.819 55.000 0.00 0.00 0.00 3.27
1499 4156 1.947456 GTAACCCAAGCGATTCCCATC 59.053 52.381 0.00 0.00 0.00 3.51
1520 4177 5.304101 CCTCTTTATCCAGTACAGATCTGCT 59.696 44.000 22.83 9.77 0.00 4.24
1521 4178 5.069781 ACCTCTTTATCCAGTACAGATCTGC 59.930 44.000 22.83 7.43 0.00 4.26
1529 4186 3.067883 GGTCCGACCTCTTTATCCAGTAC 59.932 52.174 10.59 0.00 34.73 2.73
1537 4194 2.544844 ATCTGGGTCCGACCTCTTTA 57.455 50.000 17.27 0.00 38.64 1.85
1539 4196 1.196012 GAATCTGGGTCCGACCTCTT 58.804 55.000 17.27 5.95 38.64 2.85
1542 4199 0.905357 CTTGAATCTGGGTCCGACCT 59.095 55.000 17.27 0.00 38.64 3.85
1543 4200 0.107654 CCTTGAATCTGGGTCCGACC 60.108 60.000 9.30 9.30 37.60 4.79
1572 4229 8.902881 AGAGGTACAGTAGTATATATGGGAGTT 58.097 37.037 0.00 0.00 31.84 3.01
1573 4230 8.465798 AGAGGTACAGTAGTATATATGGGAGT 57.534 38.462 0.00 0.00 31.84 3.85
1574 4231 8.549731 TGAGAGGTACAGTAGTATATATGGGAG 58.450 40.741 0.00 0.00 31.84 4.30
1575 4232 8.458951 TGAGAGGTACAGTAGTATATATGGGA 57.541 38.462 0.00 0.00 31.84 4.37
1576 4233 9.702253 ATTGAGAGGTACAGTAGTATATATGGG 57.298 37.037 0.00 0.00 31.84 4.00
1583 4240 9.509956 GTATGAGATTGAGAGGTACAGTAGTAT 57.490 37.037 0.00 0.00 31.84 2.12
1584 4241 8.715842 AGTATGAGATTGAGAGGTACAGTAGTA 58.284 37.037 0.00 0.00 0.00 1.82
1585 4242 7.579105 AGTATGAGATTGAGAGGTACAGTAGT 58.421 38.462 0.00 0.00 0.00 2.73
1586 4243 9.733556 ATAGTATGAGATTGAGAGGTACAGTAG 57.266 37.037 0.00 0.00 0.00 2.57
1587 4244 9.727859 GATAGTATGAGATTGAGAGGTACAGTA 57.272 37.037 0.00 0.00 0.00 2.74
1588 4245 8.444783 AGATAGTATGAGATTGAGAGGTACAGT 58.555 37.037 0.00 0.00 0.00 3.55
1589 4246 8.862325 AGATAGTATGAGATTGAGAGGTACAG 57.138 38.462 0.00 0.00 0.00 2.74
1590 4247 8.440771 TGAGATAGTATGAGATTGAGAGGTACA 58.559 37.037 0.00 0.00 0.00 2.90
1591 4248 8.856153 TGAGATAGTATGAGATTGAGAGGTAC 57.144 38.462 0.00 0.00 0.00 3.34
1592 4249 8.885346 TCTGAGATAGTATGAGATTGAGAGGTA 58.115 37.037 0.00 0.00 0.00 3.08
1593 4250 7.754624 TCTGAGATAGTATGAGATTGAGAGGT 58.245 38.462 0.00 0.00 0.00 3.85
1594 4251 8.634335 TTCTGAGATAGTATGAGATTGAGAGG 57.366 38.462 0.00 0.00 0.00 3.69
1598 4255 9.486497 GCAATTTCTGAGATAGTATGAGATTGA 57.514 33.333 12.19 0.00 33.74 2.57
1599 4256 9.491675 AGCAATTTCTGAGATAGTATGAGATTG 57.508 33.333 0.00 0.00 34.48 2.67
1601 4258 9.491675 CAAGCAATTTCTGAGATAGTATGAGAT 57.508 33.333 0.00 0.00 0.00 2.75
1602 4259 8.699130 TCAAGCAATTTCTGAGATAGTATGAGA 58.301 33.333 0.00 0.00 0.00 3.27
1603 4260 8.883954 TCAAGCAATTTCTGAGATAGTATGAG 57.116 34.615 0.00 0.00 0.00 2.90
1604 4261 9.842775 AATCAAGCAATTTCTGAGATAGTATGA 57.157 29.630 0.00 0.00 0.00 2.15
1610 4267 9.857656 AGGATAAATCAAGCAATTTCTGAGATA 57.142 29.630 0.00 0.00 31.50 1.98
1611 4268 8.763984 AGGATAAATCAAGCAATTTCTGAGAT 57.236 30.769 0.00 0.00 31.50 2.75
1612 4269 8.464404 CAAGGATAAATCAAGCAATTTCTGAGA 58.536 33.333 0.00 0.00 31.50 3.27
1613 4270 7.222224 GCAAGGATAAATCAAGCAATTTCTGAG 59.778 37.037 0.00 0.00 31.50 3.35
1614 4271 7.037438 GCAAGGATAAATCAAGCAATTTCTGA 58.963 34.615 0.00 0.00 31.50 3.27
1615 4272 7.039882 AGCAAGGATAAATCAAGCAATTTCTG 58.960 34.615 0.00 0.00 31.50 3.02
1616 4273 7.179076 AGCAAGGATAAATCAAGCAATTTCT 57.821 32.000 0.00 0.00 31.50 2.52
1617 4274 7.546667 TCAAGCAAGGATAAATCAAGCAATTTC 59.453 33.333 0.00 0.00 31.50 2.17
1618 4275 7.332678 GTCAAGCAAGGATAAATCAAGCAATTT 59.667 33.333 0.00 0.00 33.54 1.82
1619 4276 6.815142 GTCAAGCAAGGATAAATCAAGCAATT 59.185 34.615 0.00 0.00 0.00 2.32
1620 4277 6.071221 TGTCAAGCAAGGATAAATCAAGCAAT 60.071 34.615 0.00 0.00 0.00 3.56
1621 4278 5.243507 TGTCAAGCAAGGATAAATCAAGCAA 59.756 36.000 0.00 0.00 0.00 3.91
1622 4279 4.766373 TGTCAAGCAAGGATAAATCAAGCA 59.234 37.500 0.00 0.00 0.00 3.91
1623 4280 5.314923 TGTCAAGCAAGGATAAATCAAGC 57.685 39.130 0.00 0.00 0.00 4.01
1624 4281 9.859427 TTAATTGTCAAGCAAGGATAAATCAAG 57.141 29.630 0.00 0.00 40.86 3.02
1625 4282 9.859427 CTTAATTGTCAAGCAAGGATAAATCAA 57.141 29.630 0.00 0.00 40.86 2.57
1626 4283 7.975616 GCTTAATTGTCAAGCAAGGATAAATCA 59.024 33.333 6.57 0.00 46.17 2.57
1627 4284 8.345224 GCTTAATTGTCAAGCAAGGATAAATC 57.655 34.615 6.57 0.00 46.17 2.17
1638 4295 8.703605 TGGAGAACCTAAGCTTAATTGTCAAGC 61.704 40.741 20.23 3.65 41.62 4.01
1639 4296 6.655003 TGGAGAACCTAAGCTTAATTGTCAAG 59.345 38.462 20.23 5.86 37.04 3.02
1640 4297 6.539173 TGGAGAACCTAAGCTTAATTGTCAA 58.461 36.000 20.23 12.07 37.04 3.18
1641 4298 6.121776 TGGAGAACCTAAGCTTAATTGTCA 57.878 37.500 20.23 10.06 37.04 3.58
1642 4299 6.094186 CCTTGGAGAACCTAAGCTTAATTGTC 59.906 42.308 7.74 11.96 37.04 3.18
1643 4300 5.946377 CCTTGGAGAACCTAAGCTTAATTGT 59.054 40.000 7.74 3.75 37.04 2.71
1644 4301 5.946377 ACCTTGGAGAACCTAAGCTTAATTG 59.054 40.000 7.74 1.99 37.04 2.32
1645 4302 5.946377 CACCTTGGAGAACCTAAGCTTAATT 59.054 40.000 7.74 5.05 37.04 1.40
1646 4303 5.501156 CACCTTGGAGAACCTAAGCTTAAT 58.499 41.667 7.74 0.00 37.04 1.40
1647 4304 4.263331 CCACCTTGGAGAACCTAAGCTTAA 60.263 45.833 7.74 0.00 40.96 1.85
1648 4305 3.263425 CCACCTTGGAGAACCTAAGCTTA 59.737 47.826 5.94 5.94 40.96 3.09
1649 4306 2.040412 CCACCTTGGAGAACCTAAGCTT 59.960 50.000 3.48 3.48 40.96 3.74
1650 4307 1.630878 CCACCTTGGAGAACCTAAGCT 59.369 52.381 0.00 0.00 40.96 3.74
1651 4308 1.950954 GCCACCTTGGAGAACCTAAGC 60.951 57.143 0.00 0.00 40.96 3.09
1652 4309 1.351017 TGCCACCTTGGAGAACCTAAG 59.649 52.381 0.00 0.00 40.96 2.18
1653 4310 1.351017 CTGCCACCTTGGAGAACCTAA 59.649 52.381 0.00 0.00 40.96 2.69
1654 4311 0.984230 CTGCCACCTTGGAGAACCTA 59.016 55.000 0.00 0.00 40.96 3.08
1655 4312 0.768221 TCTGCCACCTTGGAGAACCT 60.768 55.000 0.00 0.00 40.96 3.50
1656 4313 0.322008 CTCTGCCACCTTGGAGAACC 60.322 60.000 0.00 0.00 40.96 3.62
1657 4314 0.957888 GCTCTGCCACCTTGGAGAAC 60.958 60.000 0.00 0.00 40.96 3.01
1658 4315 1.130054 AGCTCTGCCACCTTGGAGAA 61.130 55.000 0.00 0.00 40.96 2.87
1659 4316 1.537397 AGCTCTGCCACCTTGGAGA 60.537 57.895 0.00 0.00 40.96 3.71
1660 4317 1.078567 GAGCTCTGCCACCTTGGAG 60.079 63.158 6.43 0.00 40.96 3.86
1661 4318 1.203441 ATGAGCTCTGCCACCTTGGA 61.203 55.000 16.19 0.00 40.96 3.53
1662 4319 1.030488 CATGAGCTCTGCCACCTTGG 61.030 60.000 16.19 0.00 41.55 3.61
1663 4320 0.322277 ACATGAGCTCTGCCACCTTG 60.322 55.000 16.19 0.00 0.00 3.61
1664 4321 0.035630 GACATGAGCTCTGCCACCTT 60.036 55.000 16.19 0.00 0.00 3.50
1665 4322 1.196766 TGACATGAGCTCTGCCACCT 61.197 55.000 16.19 0.00 0.00 4.00
1666 4323 0.743701 CTGACATGAGCTCTGCCACC 60.744 60.000 16.19 0.19 0.00 4.61
1667 4324 0.036577 ACTGACATGAGCTCTGCCAC 60.037 55.000 16.19 3.66 0.00 5.01
1668 4325 0.036671 CACTGACATGAGCTCTGCCA 60.037 55.000 16.19 8.43 0.00 4.92
1669 4326 0.036577 ACACTGACATGAGCTCTGCC 60.037 55.000 16.19 4.02 0.00 4.85
1670 4327 1.077123 CACACTGACATGAGCTCTGC 58.923 55.000 16.19 7.70 0.00 4.26
1671 4328 1.077123 GCACACTGACATGAGCTCTG 58.923 55.000 16.19 12.83 33.85 3.35
1672 4329 0.975135 AGCACACTGACATGAGCTCT 59.025 50.000 16.19 0.00 41.97 4.09
1673 4330 3.529252 AGCACACTGACATGAGCTC 57.471 52.632 6.82 6.82 41.97 4.09
1690 4347 0.460987 GGTCGGAGATGCTGAACCAG 60.461 60.000 0.00 0.00 40.67 4.00
1691 4348 1.596934 GGTCGGAGATGCTGAACCA 59.403 57.895 0.00 0.00 40.67 3.67
1692 4349 1.519455 CGGTCGGAGATGCTGAACC 60.519 63.158 0.00 0.00 40.67 3.62
1693 4350 2.167861 GCGGTCGGAGATGCTGAAC 61.168 63.158 0.00 0.00 40.67 3.18
1694 4351 1.960040 ATGCGGTCGGAGATGCTGAA 61.960 55.000 0.00 0.00 40.60 3.02
1695 4352 2.355445 GATGCGGTCGGAGATGCTGA 62.355 60.000 0.00 0.00 40.60 4.26
1696 4353 1.953138 GATGCGGTCGGAGATGCTG 60.953 63.158 0.00 0.00 40.60 4.41
1697 4354 2.360949 CTGATGCGGTCGGAGATGCT 62.361 60.000 0.00 0.00 40.60 3.79
1698 4355 1.953138 CTGATGCGGTCGGAGATGC 60.953 63.158 0.00 0.00 40.67 3.91
1699 4356 1.953138 GCTGATGCGGTCGGAGATG 60.953 63.158 2.19 0.00 40.67 2.90
1700 4357 2.360949 CTGCTGATGCGGTCGGAGAT 62.361 60.000 2.19 0.00 43.34 2.75
1701 4358 3.068064 TGCTGATGCGGTCGGAGA 61.068 61.111 2.19 0.00 43.34 3.71
1702 4359 2.584418 CTGCTGATGCGGTCGGAG 60.584 66.667 2.19 0.00 43.34 4.63
1703 4360 4.819761 GCTGCTGATGCGGTCGGA 62.820 66.667 2.19 0.00 46.77 4.55
1705 4362 3.092192 CTTGCTGCTGATGCGGTCG 62.092 63.158 0.00 0.00 46.77 4.79
1706 4363 2.758089 CCTTGCTGCTGATGCGGTC 61.758 63.158 0.00 0.00 46.77 4.79
1707 4364 2.749044 CCTTGCTGCTGATGCGGT 60.749 61.111 0.00 0.00 46.77 5.68
1709 4366 3.099438 CTCCTTGCTGCTGATGCG 58.901 61.111 0.00 0.00 43.34 4.73
1710 4367 2.799371 GCTCCTTGCTGCTGATGC 59.201 61.111 0.00 0.00 38.95 3.91
1719 4376 2.125350 CCGGTGAGAGCTCCTTGC 60.125 66.667 10.93 0.00 43.29 4.01
1720 4377 2.581354 CCCGGTGAGAGCTCCTTG 59.419 66.667 10.93 0.00 0.00 3.61
1721 4378 3.394836 GCCCGGTGAGAGCTCCTT 61.395 66.667 10.93 0.00 0.00 3.36
1722 4379 4.704103 TGCCCGGTGAGAGCTCCT 62.704 66.667 10.93 0.00 0.00 3.69
1723 4380 4.459089 GTGCCCGGTGAGAGCTCC 62.459 72.222 10.93 2.40 0.00 4.70
1724 4381 4.459089 GGTGCCCGGTGAGAGCTC 62.459 72.222 5.27 5.27 0.00 4.09
1727 4384 1.622607 TATTGGGTGCCCGGTGAGAG 61.623 60.000 0.00 0.00 39.42 3.20
1728 4385 1.613928 TATTGGGTGCCCGGTGAGA 60.614 57.895 0.00 0.00 39.42 3.27
1729 4386 1.451387 GTATTGGGTGCCCGGTGAG 60.451 63.158 0.00 0.00 39.42 3.51
1730 4387 2.672295 GTATTGGGTGCCCGGTGA 59.328 61.111 0.00 0.00 39.42 4.02
1731 4388 2.822255 CGTATTGGGTGCCCGGTG 60.822 66.667 0.00 0.00 39.42 4.94
1732 4389 4.789123 GCGTATTGGGTGCCCGGT 62.789 66.667 0.00 0.00 39.42 5.28
1737 4394 3.743534 TAGGCCGCGTATTGGGTGC 62.744 63.158 4.92 0.00 0.00 5.01
1738 4395 1.885850 GTAGGCCGCGTATTGGGTG 60.886 63.158 4.92 0.00 0.00 4.61
1739 4396 2.502577 GTAGGCCGCGTATTGGGT 59.497 61.111 4.92 0.00 0.00 4.51
1740 4397 2.280592 GGTAGGCCGCGTATTGGG 60.281 66.667 4.92 0.00 0.00 4.12
1741 4398 1.145377 AAGGTAGGCCGCGTATTGG 59.855 57.895 4.92 0.00 40.50 3.16
1742 4399 0.461339 ACAAGGTAGGCCGCGTATTG 60.461 55.000 4.92 3.07 40.50 1.90
1743 4400 0.461339 CACAAGGTAGGCCGCGTATT 60.461 55.000 4.92 0.00 40.50 1.89
1744 4401 1.143183 CACAAGGTAGGCCGCGTAT 59.857 57.895 4.92 0.00 40.50 3.06
1745 4402 0.964860 TACACAAGGTAGGCCGCGTA 60.965 55.000 4.92 0.00 40.50 4.42
1746 4403 2.277591 TACACAAGGTAGGCCGCGT 61.278 57.895 4.92 0.00 40.50 6.01
1747 4404 1.808390 GTACACAAGGTAGGCCGCG 60.808 63.158 0.00 0.00 40.50 6.46
1748 4405 0.320946 TTGTACACAAGGTAGGCCGC 60.321 55.000 0.00 0.00 40.50 6.53
1749 4406 3.919163 TTGTACACAAGGTAGGCCG 57.081 52.632 0.00 0.00 40.50 6.13
1758 4415 2.698274 TCCTGAGTGAGCTTGTACACAA 59.302 45.455 0.00 0.00 39.18 3.33
1759 4416 2.035961 GTCCTGAGTGAGCTTGTACACA 59.964 50.000 0.00 2.32 39.18 3.72
1760 4417 2.678324 GTCCTGAGTGAGCTTGTACAC 58.322 52.381 0.00 0.00 37.30 2.90
1761 4418 1.269723 CGTCCTGAGTGAGCTTGTACA 59.730 52.381 0.00 0.00 0.00 2.90
1762 4419 1.983972 CGTCCTGAGTGAGCTTGTAC 58.016 55.000 0.00 0.00 0.00 2.90
1763 4420 0.243907 GCGTCCTGAGTGAGCTTGTA 59.756 55.000 0.00 0.00 0.00 2.41
1764 4421 1.005630 GCGTCCTGAGTGAGCTTGT 60.006 57.895 0.00 0.00 0.00 3.16
1765 4422 0.390866 ATGCGTCCTGAGTGAGCTTG 60.391 55.000 0.00 0.00 0.00 4.01
1766 4423 0.108424 GATGCGTCCTGAGTGAGCTT 60.108 55.000 0.00 0.00 0.00 3.74
1767 4424 1.515020 GATGCGTCCTGAGTGAGCT 59.485 57.895 0.00 0.00 0.00 4.09
1768 4425 1.520342 GGATGCGTCCTGAGTGAGC 60.520 63.158 18.25 0.00 41.60 4.26
1769 4426 1.226802 CGGATGCGTCCTGAGTGAG 60.227 63.158 22.53 1.35 42.73 3.51
1770 4427 2.710902 CCGGATGCGTCCTGAGTGA 61.711 63.158 22.53 0.00 42.73 3.41
1771 4428 2.202797 CCGGATGCGTCCTGAGTG 60.203 66.667 22.53 6.61 42.73 3.51
1772 4429 2.680352 ACCGGATGCGTCCTGAGT 60.680 61.111 21.86 13.71 42.73 3.41
1773 4430 2.105128 GACCGGATGCGTCCTGAG 59.895 66.667 21.86 13.10 42.73 3.35
1774 4431 2.362503 AGACCGGATGCGTCCTGA 60.363 61.111 21.86 0.00 42.73 3.86
1775 4432 2.105128 GAGACCGGATGCGTCCTG 59.895 66.667 22.53 18.40 42.73 3.86
1776 4433 2.362503 TGAGACCGGATGCGTCCT 60.363 61.111 22.53 4.78 42.73 3.85
1777 4434 2.105128 CTGAGACCGGATGCGTCC 59.895 66.667 15.54 15.54 41.40 4.79
1778 4435 2.583593 GCTGAGACCGGATGCGTC 60.584 66.667 9.46 0.00 0.00 5.19
1779 4436 3.069980 GAGCTGAGACCGGATGCGT 62.070 63.158 9.46 0.00 0.00 5.24
1780 4437 2.279120 GAGCTGAGACCGGATGCG 60.279 66.667 9.46 0.00 0.00 4.73
1781 4438 2.107953 GGAGCTGAGACCGGATGC 59.892 66.667 9.46 4.53 0.00 3.91
1782 4439 2.801631 GGGGAGCTGAGACCGGATG 61.802 68.421 9.46 0.00 0.00 3.51
1783 4440 2.444895 GGGGAGCTGAGACCGGAT 60.445 66.667 9.46 0.00 0.00 4.18
1784 4441 3.992641 TGGGGAGCTGAGACCGGA 61.993 66.667 9.46 0.00 0.00 5.14
1785 4442 3.775654 GTGGGGAGCTGAGACCGG 61.776 72.222 0.00 0.00 0.00 5.28
1786 4443 4.135153 CGTGGGGAGCTGAGACCG 62.135 72.222 0.00 0.00 0.00 4.79
1787 4444 3.775654 CCGTGGGGAGCTGAGACC 61.776 72.222 0.00 0.00 34.06 3.85
1788 4445 4.459089 GCCGTGGGGAGCTGAGAC 62.459 72.222 0.00 0.00 34.06 3.36
1790 4447 4.463879 CTGCCGTGGGGAGCTGAG 62.464 72.222 0.00 0.00 33.72 3.35
1791 4448 2.871795 TATCTGCCGTGGGGAGCTGA 62.872 60.000 0.00 0.00 41.08 4.26
1792 4449 1.762522 ATATCTGCCGTGGGGAGCTG 61.763 60.000 0.00 0.00 41.08 4.24
1793 4450 1.460305 ATATCTGCCGTGGGGAGCT 60.460 57.895 0.00 0.00 41.08 4.09
1794 4451 1.004440 GATATCTGCCGTGGGGAGC 60.004 63.158 0.00 0.00 41.08 4.70
1795 4452 1.290324 CGATATCTGCCGTGGGGAG 59.710 63.158 0.34 0.00 42.73 4.30
1796 4453 1.046472 AACGATATCTGCCGTGGGGA 61.046 55.000 0.34 0.00 39.14 4.81
1797 4454 0.600255 GAACGATATCTGCCGTGGGG 60.600 60.000 0.34 0.00 39.14 4.96
1798 4455 0.104120 TGAACGATATCTGCCGTGGG 59.896 55.000 0.34 0.00 39.14 4.61
1799 4456 2.154854 ATGAACGATATCTGCCGTGG 57.845 50.000 0.34 0.00 39.14 4.94
1800 4457 3.123050 TCAATGAACGATATCTGCCGTG 58.877 45.455 0.34 0.00 39.14 4.94
1801 4458 3.384668 CTCAATGAACGATATCTGCCGT 58.615 45.455 0.34 0.00 41.14 5.68
1802 4459 2.733552 CCTCAATGAACGATATCTGCCG 59.266 50.000 0.34 0.00 0.00 5.69
1803 4460 3.733337 ACCTCAATGAACGATATCTGCC 58.267 45.455 0.34 0.00 0.00 4.85
1804 4461 4.926238 CCTACCTCAATGAACGATATCTGC 59.074 45.833 0.34 0.00 0.00 4.26
1805 4462 5.923114 CACCTACCTCAATGAACGATATCTG 59.077 44.000 0.34 0.00 0.00 2.90
1806 4463 5.011125 CCACCTACCTCAATGAACGATATCT 59.989 44.000 0.34 0.00 0.00 1.98
1807 4464 5.230942 CCACCTACCTCAATGAACGATATC 58.769 45.833 0.00 0.00 0.00 1.63
1808 4465 4.040461 CCCACCTACCTCAATGAACGATAT 59.960 45.833 0.00 0.00 0.00 1.63
1809 4466 3.386726 CCCACCTACCTCAATGAACGATA 59.613 47.826 0.00 0.00 0.00 2.92
1810 4467 2.170607 CCCACCTACCTCAATGAACGAT 59.829 50.000 0.00 0.00 0.00 3.73
1811 4468 1.553248 CCCACCTACCTCAATGAACGA 59.447 52.381 0.00 0.00 0.00 3.85
1812 4469 2.012051 GCCCACCTACCTCAATGAACG 61.012 57.143 0.00 0.00 0.00 3.95
1813 4470 1.004277 TGCCCACCTACCTCAATGAAC 59.996 52.381 0.00 0.00 0.00 3.18
1814 4471 1.281867 CTGCCCACCTACCTCAATGAA 59.718 52.381 0.00 0.00 0.00 2.57
1815 4472 0.911769 CTGCCCACCTACCTCAATGA 59.088 55.000 0.00 0.00 0.00 2.57
1816 4473 0.749454 GCTGCCCACCTACCTCAATG 60.749 60.000 0.00 0.00 0.00 2.82
1817 4474 0.916358 AGCTGCCCACCTACCTCAAT 60.916 55.000 0.00 0.00 0.00 2.57
1818 4475 0.252513 TAGCTGCCCACCTACCTCAA 60.253 55.000 0.00 0.00 0.00 3.02
1819 4476 0.687757 CTAGCTGCCCACCTACCTCA 60.688 60.000 0.00 0.00 0.00 3.86
1820 4477 0.688087 ACTAGCTGCCCACCTACCTC 60.688 60.000 0.00 0.00 0.00 3.85
1821 4478 0.252742 AACTAGCTGCCCACCTACCT 60.253 55.000 0.00 0.00 0.00 3.08
1822 4479 0.107654 CAACTAGCTGCCCACCTACC 60.108 60.000 0.00 0.00 0.00 3.18
1823 4480 0.107654 CCAACTAGCTGCCCACCTAC 60.108 60.000 0.00 0.00 0.00 3.18
1824 4481 1.271840 CCCAACTAGCTGCCCACCTA 61.272 60.000 0.00 0.00 0.00 3.08
1825 4482 2.606587 CCCAACTAGCTGCCCACCT 61.607 63.158 0.00 0.00 0.00 4.00
1826 4483 2.044946 CCCAACTAGCTGCCCACC 60.045 66.667 0.00 0.00 0.00 4.61
1827 4484 1.078143 CTCCCAACTAGCTGCCCAC 60.078 63.158 0.00 0.00 0.00 4.61
1828 4485 2.971598 GCTCCCAACTAGCTGCCCA 61.972 63.158 0.00 0.00 37.01 5.36
1829 4486 2.124529 GCTCCCAACTAGCTGCCC 60.125 66.667 0.00 0.00 37.01 5.36
1830 4487 0.817229 GATGCTCCCAACTAGCTGCC 60.817 60.000 0.00 0.00 40.73 4.85
1831 4488 0.817229 GGATGCTCCCAACTAGCTGC 60.817 60.000 0.00 0.00 40.73 5.25
1832 4489 0.543277 TGGATGCTCCCAACTAGCTG 59.457 55.000 0.00 0.00 40.73 4.24
1833 4490 0.543749 GTGGATGCTCCCAACTAGCT 59.456 55.000 0.00 0.00 40.73 3.32
1834 4491 0.464554 GGTGGATGCTCCCAACTAGC 60.465 60.000 5.85 0.00 40.72 3.42
1835 4492 0.181350 GGGTGGATGCTCCCAACTAG 59.819 60.000 18.59 0.00 43.39 2.57
1836 4493 1.622607 CGGGTGGATGCTCCCAACTA 61.623 60.000 22.40 0.00 43.39 2.24
1837 4494 2.971598 CGGGTGGATGCTCCCAACT 61.972 63.158 22.40 0.00 43.39 3.16
1838 4495 2.438434 CGGGTGGATGCTCCCAAC 60.438 66.667 22.40 1.25 43.57 3.77
1839 4496 3.727258 CCGGGTGGATGCTCCCAA 61.727 66.667 22.40 0.00 43.57 4.12
1846 4503 3.432051 GAGAGACGCCGGGTGGATG 62.432 68.421 12.97 0.00 37.49 3.51
1847 4504 3.148279 GAGAGACGCCGGGTGGAT 61.148 66.667 12.97 0.00 37.49 3.41
1850 4507 3.432051 GATGGAGAGACGCCGGGTG 62.432 68.421 2.18 5.93 0.00 4.61
1851 4508