Multiple sequence alignment - TraesCS5B01G559800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G559800 chr5B 100.000 3219 0 0 1 3219 706423632 706426850 0.000000e+00 5945
1 TraesCS5B01G559800 chr5B 82.243 535 68 16 1072 1581 706490650 706490118 1.370000e-118 436
2 TraesCS5B01G559800 chr5B 82.405 449 67 7 3 441 314966877 314967323 6.520000e-102 381
3 TraesCS5B01G559800 chr7B 91.297 563 42 7 2661 3218 633246052 633246612 0.000000e+00 761
4 TraesCS5B01G559800 chr4A 90.248 564 49 6 2661 3219 651205642 651206204 0.000000e+00 732
5 TraesCS5B01G559800 chr4A 89.735 565 50 7 2661 3219 651467980 651468542 0.000000e+00 715
6 TraesCS5B01G559800 chr4A 89.576 566 50 8 2661 3219 651462975 651463538 0.000000e+00 710
7 TraesCS5B01G559800 chr4A 84.629 566 77 9 2661 3219 310239338 310238776 3.630000e-154 555
8 TraesCS5B01G559800 chr4A 84.331 568 78 10 2660 3219 337463226 337463790 2.180000e-151 545
9 TraesCS5B01G559800 chr4A 86.667 255 32 2 1064 1317 608260097 608260350 6.800000e-72 281
10 TraesCS5B01G559800 chr4A 78.326 466 68 8 1 435 112842079 112842542 1.470000e-68 270
11 TraesCS5B01G559800 chr4A 78.378 296 51 13 1921 2208 608261019 608261309 2.550000e-41 180
12 TraesCS5B01G559800 chr6B 87.788 565 59 10 2661 3219 185117803 185118363 0.000000e+00 652
13 TraesCS5B01G559800 chr6B 82.212 416 58 4 41 441 662518807 662518393 8.550000e-91 344
14 TraesCS5B01G559800 chr5D 86.042 566 69 10 2660 3219 487590899 487591460 1.650000e-167 599
15 TraesCS5B01G559800 chr6A 85.638 564 72 6 2663 3219 608786511 608785950 4.630000e-163 584
16 TraesCS5B01G559800 chr1D 82.405 449 61 6 1 441 491745009 491744571 3.030000e-100 375
17 TraesCS5B01G559800 chr1D 82.533 229 35 3 216 441 100668555 100668781 2.530000e-46 196
18 TraesCS5B01G559800 chr3A 81.336 434 61 7 16 430 681728253 681727821 5.150000e-88 335
19 TraesCS5B01G559800 chr7D 79.237 472 66 11 1 440 621745273 621744802 1.880000e-77 300
20 TraesCS5B01G559800 chr7D 80.000 380 51 11 85 439 45122862 45122483 1.150000e-64 257
21 TraesCS5B01G559800 chr7D 80.460 174 34 0 53 226 553822719 553822546 2.010000e-27 134
22 TraesCS5B01G559800 chr7D 79.545 176 32 3 53 226 90254892 90255065 4.360000e-24 122
23 TraesCS5B01G559800 chr7D 79.545 176 32 3 53 226 603689737 603689564 4.360000e-24 122
24 TraesCS5B01G559800 chr3B 86.486 259 33 2 1063 1320 8034766 8035023 1.890000e-72 283
25 TraesCS5B01G559800 chr2B 78.436 473 70 9 1 441 757060757 757060285 2.450000e-71 279
26 TraesCS5B01G559800 chr7A 78.112 466 69 8 1 435 619640462 619639999 6.850000e-67 265
27 TraesCS5B01G559800 chr2A 75.738 474 77 20 1 441 765556286 765555818 1.510000e-48 204
28 TraesCS5B01G559800 chr2A 78.736 174 37 0 53 226 767757161 767757334 2.030000e-22 117
29 TraesCS5B01G559800 chr3D 78.161 174 38 0 53 226 143236636 143236463 9.440000e-21 111


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G559800 chr5B 706423632 706426850 3218 False 5945.0 5945 100.0000 1 3219 1 chr5B.!!$F2 3218
1 TraesCS5B01G559800 chr5B 706490118 706490650 532 True 436.0 436 82.2430 1072 1581 1 chr5B.!!$R1 509
2 TraesCS5B01G559800 chr7B 633246052 633246612 560 False 761.0 761 91.2970 2661 3218 1 chr7B.!!$F1 557
3 TraesCS5B01G559800 chr4A 651205642 651206204 562 False 732.0 732 90.2480 2661 3219 1 chr4A.!!$F3 558
4 TraesCS5B01G559800 chr4A 651467980 651468542 562 False 715.0 715 89.7350 2661 3219 1 chr4A.!!$F5 558
5 TraesCS5B01G559800 chr4A 651462975 651463538 563 False 710.0 710 89.5760 2661 3219 1 chr4A.!!$F4 558
6 TraesCS5B01G559800 chr4A 310238776 310239338 562 True 555.0 555 84.6290 2661 3219 1 chr4A.!!$R1 558
7 TraesCS5B01G559800 chr4A 337463226 337463790 564 False 545.0 545 84.3310 2660 3219 1 chr4A.!!$F2 559
8 TraesCS5B01G559800 chr4A 608260097 608261309 1212 False 230.5 281 82.5225 1064 2208 2 chr4A.!!$F6 1144
9 TraesCS5B01G559800 chr6B 185117803 185118363 560 False 652.0 652 87.7880 2661 3219 1 chr6B.!!$F1 558
10 TraesCS5B01G559800 chr5D 487590899 487591460 561 False 599.0 599 86.0420 2660 3219 1 chr5D.!!$F1 559
11 TraesCS5B01G559800 chr6A 608785950 608786511 561 True 584.0 584 85.6380 2663 3219 1 chr6A.!!$R1 556


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
82 83 0.036388 TGGAACATTCGAGAGCACCC 60.036 55.0 0.0 0.0 0.00 4.61 F
83 84 0.036388 GGAACATTCGAGAGCACCCA 60.036 55.0 0.0 0.0 0.00 4.51 F
963 964 0.037046 GCAATGGGGAAAGGTGCAAG 60.037 55.0 0.0 0.0 35.28 4.01 F
1326 1327 0.312102 GCAAAAGGGTGAGTGAGTGC 59.688 55.0 0.0 0.0 0.00 4.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1028 1029 0.037877 TTCCTCGTCTTCCGTCCTCT 59.962 55.0 0.00 0.0 37.94 3.69 R
1789 1947 0.107703 CCTTACTGCTGATTCGGCCA 60.108 55.0 14.77 2.7 34.37 5.36 R
2089 2307 0.179032 CACCTGTGCCTGTGTGGTAA 60.179 55.0 0.00 0.0 38.35 2.85 R
2672 2899 0.179073 CCTCTTCGGTGGCGATGATT 60.179 55.0 0.00 0.0 0.00 2.57 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 4.493747 CGTCCGTCTTCGCCCCTC 62.494 72.222 0.00 0.00 35.54 4.30
22 23 3.069318 GTCCGTCTTCGCCCCTCT 61.069 66.667 0.00 0.00 35.54 3.69
23 24 3.068691 TCCGTCTTCGCCCCTCTG 61.069 66.667 0.00 0.00 35.54 3.35
24 25 4.148825 CCGTCTTCGCCCCTCTGG 62.149 72.222 0.00 0.00 35.54 3.86
35 36 2.169832 CCCCTCTGGCATGTATTACG 57.830 55.000 0.00 0.00 0.00 3.18
36 37 1.512926 CCCTCTGGCATGTATTACGC 58.487 55.000 0.00 0.00 0.00 4.42
37 38 1.139989 CCTCTGGCATGTATTACGCG 58.860 55.000 3.53 3.53 0.00 6.01
38 39 1.139989 CTCTGGCATGTATTACGCGG 58.860 55.000 12.47 0.00 0.00 6.46
39 40 0.462375 TCTGGCATGTATTACGCGGT 59.538 50.000 12.47 0.00 0.00 5.68
40 41 1.134640 TCTGGCATGTATTACGCGGTT 60.135 47.619 12.47 0.00 0.00 4.44
41 42 1.260561 CTGGCATGTATTACGCGGTTC 59.739 52.381 12.47 0.00 0.00 3.62
42 43 0.584876 GGCATGTATTACGCGGTTCC 59.415 55.000 12.47 0.00 0.00 3.62
43 44 0.231279 GCATGTATTACGCGGTTCCG 59.769 55.000 12.47 6.90 0.00 4.30
44 45 0.856641 CATGTATTACGCGGTTCCGG 59.143 55.000 12.47 0.00 0.00 5.14
45 46 0.746063 ATGTATTACGCGGTTCCGGA 59.254 50.000 12.47 0.00 0.00 5.14
46 47 0.101040 TGTATTACGCGGTTCCGGAG 59.899 55.000 12.47 0.00 0.00 4.63
47 48 0.381801 GTATTACGCGGTTCCGGAGA 59.618 55.000 12.47 0.00 0.00 3.71
48 49 1.000938 GTATTACGCGGTTCCGGAGAT 60.001 52.381 12.47 5.89 0.00 2.75
49 50 1.321474 ATTACGCGGTTCCGGAGATA 58.679 50.000 12.47 0.00 0.00 1.98
50 51 0.381801 TTACGCGGTTCCGGAGATAC 59.618 55.000 12.47 0.00 0.00 2.24
51 52 0.747644 TACGCGGTTCCGGAGATACA 60.748 55.000 12.47 0.00 0.00 2.29
52 53 1.588139 CGCGGTTCCGGAGATACAC 60.588 63.158 3.34 0.00 0.00 2.90
53 54 1.588139 GCGGTTCCGGAGATACACG 60.588 63.158 3.34 7.67 0.00 4.49
54 55 1.588139 CGGTTCCGGAGATACACGC 60.588 63.158 3.34 0.00 0.00 5.34
55 56 1.227176 GGTTCCGGAGATACACGCC 60.227 63.158 3.34 0.00 35.10 5.68
56 57 1.673808 GGTTCCGGAGATACACGCCT 61.674 60.000 3.34 0.00 36.31 5.52
57 58 0.248949 GTTCCGGAGATACACGCCTC 60.249 60.000 3.34 0.00 36.31 4.70
58 59 1.721664 TTCCGGAGATACACGCCTCG 61.722 60.000 3.34 0.00 36.31 4.63
59 60 2.331805 CGGAGATACACGCCTCGG 59.668 66.667 0.00 0.00 36.31 4.63
60 61 2.728817 GGAGATACACGCCTCGGG 59.271 66.667 0.00 0.00 35.57 5.14
61 62 2.027751 GAGATACACGCCTCGGGC 59.972 66.667 4.96 4.96 46.75 6.13
70 71 2.044946 GCCTCGGGCTTGGAACAT 60.045 61.111 7.58 0.00 46.69 2.71
71 72 1.678970 GCCTCGGGCTTGGAACATT 60.679 57.895 7.58 0.00 46.69 2.71
72 73 1.657751 GCCTCGGGCTTGGAACATTC 61.658 60.000 7.58 0.00 46.69 2.67
73 74 1.369091 CCTCGGGCTTGGAACATTCG 61.369 60.000 0.00 0.00 39.30 3.34
74 75 0.391130 CTCGGGCTTGGAACATTCGA 60.391 55.000 0.00 0.00 39.30 3.71
75 76 0.391130 TCGGGCTTGGAACATTCGAG 60.391 55.000 0.00 0.00 39.30 4.04
76 77 0.391130 CGGGCTTGGAACATTCGAGA 60.391 55.000 0.00 0.00 39.30 4.04
77 78 1.373570 GGGCTTGGAACATTCGAGAG 58.626 55.000 0.00 0.00 39.30 3.20
78 79 0.729690 GGCTTGGAACATTCGAGAGC 59.270 55.000 0.00 4.74 39.30 4.09
79 80 1.442769 GCTTGGAACATTCGAGAGCA 58.557 50.000 7.30 0.00 39.30 4.26
80 81 1.129437 GCTTGGAACATTCGAGAGCAC 59.871 52.381 7.30 0.00 39.30 4.40
81 82 1.734465 CTTGGAACATTCGAGAGCACC 59.266 52.381 0.00 0.00 39.30 5.01
82 83 0.036388 TGGAACATTCGAGAGCACCC 60.036 55.000 0.00 0.00 0.00 4.61
83 84 0.036388 GGAACATTCGAGAGCACCCA 60.036 55.000 0.00 0.00 0.00 4.51
84 85 1.079503 GAACATTCGAGAGCACCCAC 58.920 55.000 0.00 0.00 0.00 4.61
85 86 0.670546 AACATTCGAGAGCACCCACG 60.671 55.000 0.00 0.00 0.00 4.94
86 87 1.215382 CATTCGAGAGCACCCACGA 59.785 57.895 0.00 0.00 0.00 4.35
87 88 0.803768 CATTCGAGAGCACCCACGAG 60.804 60.000 0.00 0.00 36.22 4.18
88 89 1.949847 ATTCGAGAGCACCCACGAGG 61.950 60.000 0.00 0.00 43.78 4.63
89 90 4.803426 CGAGAGCACCCACGAGGC 62.803 72.222 0.00 0.00 40.58 4.70
90 91 4.459089 GAGAGCACCCACGAGGCC 62.459 72.222 0.00 0.00 40.58 5.19
137 138 3.917760 CCTCGGGTGGCCTCGATC 61.918 72.222 14.62 0.33 34.77 3.69
138 139 4.271816 CTCGGGTGGCCTCGATCG 62.272 72.222 9.36 9.36 34.77 3.69
141 142 4.899239 GGGTGGCCTCGATCGCAG 62.899 72.222 11.09 8.81 0.00 5.18
142 143 3.838271 GGTGGCCTCGATCGCAGA 61.838 66.667 11.09 0.00 45.75 4.26
143 144 2.419198 GTGGCCTCGATCGCAGAT 59.581 61.111 11.09 0.00 45.12 2.90
144 145 1.953138 GTGGCCTCGATCGCAGATG 60.953 63.158 11.09 0.00 45.12 2.90
145 146 2.127232 TGGCCTCGATCGCAGATGA 61.127 57.895 11.09 0.00 45.12 2.92
146 147 1.068083 GGCCTCGATCGCAGATGAA 59.932 57.895 11.09 0.00 45.12 2.57
147 148 1.218230 GGCCTCGATCGCAGATGAAC 61.218 60.000 11.09 0.00 45.12 3.18
148 149 0.249238 GCCTCGATCGCAGATGAACT 60.249 55.000 11.09 0.00 45.12 3.01
149 150 1.764851 CCTCGATCGCAGATGAACTC 58.235 55.000 11.09 0.00 45.12 3.01
150 151 1.601663 CCTCGATCGCAGATGAACTCC 60.602 57.143 11.09 0.00 45.12 3.85
151 152 1.336440 CTCGATCGCAGATGAACTCCT 59.664 52.381 11.09 0.00 45.12 3.69
152 153 1.335182 TCGATCGCAGATGAACTCCTC 59.665 52.381 11.09 0.00 45.12 3.71
153 154 1.336440 CGATCGCAGATGAACTCCTCT 59.664 52.381 0.26 0.00 45.12 3.69
154 155 2.741612 GATCGCAGATGAACTCCTCTG 58.258 52.381 7.44 7.44 45.12 3.35
155 156 1.839424 TCGCAGATGAACTCCTCTGA 58.161 50.000 14.09 0.00 41.13 3.27
156 157 1.474478 TCGCAGATGAACTCCTCTGAC 59.526 52.381 14.09 6.37 41.13 3.51
157 158 1.203287 CGCAGATGAACTCCTCTGACA 59.797 52.381 14.09 0.00 41.13 3.58
158 159 2.353109 CGCAGATGAACTCCTCTGACAA 60.353 50.000 14.09 0.00 41.13 3.18
159 160 3.260740 GCAGATGAACTCCTCTGACAAG 58.739 50.000 14.09 0.00 41.13 3.16
160 161 3.306641 GCAGATGAACTCCTCTGACAAGT 60.307 47.826 14.09 0.00 41.13 3.16
161 162 4.244066 CAGATGAACTCCTCTGACAAGTG 58.756 47.826 6.22 0.00 41.13 3.16
162 163 3.260380 AGATGAACTCCTCTGACAAGTGG 59.740 47.826 0.00 0.00 38.25 4.00
163 164 2.677914 TGAACTCCTCTGACAAGTGGA 58.322 47.619 0.00 0.00 42.50 4.02
164 165 2.365617 TGAACTCCTCTGACAAGTGGAC 59.634 50.000 0.00 0.00 40.40 4.02
165 166 0.962489 ACTCCTCTGACAAGTGGACG 59.038 55.000 0.00 0.00 40.40 4.79
166 167 0.389166 CTCCTCTGACAAGTGGACGC 60.389 60.000 0.00 0.00 40.40 5.19
167 168 1.734477 CCTCTGACAAGTGGACGCG 60.734 63.158 3.53 3.53 39.08 6.01
168 169 2.355837 TCTGACAAGTGGACGCGC 60.356 61.111 5.73 0.00 0.00 6.86
169 170 3.767230 CTGACAAGTGGACGCGCG 61.767 66.667 30.96 30.96 0.00 6.86
170 171 4.273257 TGACAAGTGGACGCGCGA 62.273 61.111 39.36 12.20 0.00 5.87
171 172 3.470567 GACAAGTGGACGCGCGAG 61.471 66.667 39.36 10.29 0.00 5.03
185 186 3.893763 CGAGCAGACGCGGGATCT 61.894 66.667 12.47 0.32 45.49 2.75
186 187 2.026879 GAGCAGACGCGGGATCTC 59.973 66.667 12.47 8.00 45.49 2.75
187 188 3.815569 GAGCAGACGCGGGATCTCG 62.816 68.421 11.62 11.62 45.49 4.04
206 207 3.547513 GCCTCCCCCGCGACTAAT 61.548 66.667 8.23 0.00 0.00 1.73
207 208 2.735237 CCTCCCCCGCGACTAATC 59.265 66.667 8.23 0.00 0.00 1.75
208 209 2.131709 CCTCCCCCGCGACTAATCA 61.132 63.158 8.23 0.00 0.00 2.57
209 210 1.682451 CCTCCCCCGCGACTAATCAA 61.682 60.000 8.23 0.00 0.00 2.57
210 211 0.529992 CTCCCCCGCGACTAATCAAC 60.530 60.000 8.23 0.00 0.00 3.18
211 212 1.881252 CCCCCGCGACTAATCAACG 60.881 63.158 8.23 0.00 0.00 4.10
212 213 1.140161 CCCCGCGACTAATCAACGA 59.860 57.895 8.23 0.00 0.00 3.85
213 214 1.143969 CCCCGCGACTAATCAACGAC 61.144 60.000 8.23 0.00 0.00 4.34
214 215 1.469126 CCCGCGACTAATCAACGACG 61.469 60.000 8.23 0.00 0.00 5.12
215 216 0.521867 CCGCGACTAATCAACGACGA 60.522 55.000 8.23 0.00 0.00 4.20
216 217 0.832030 CGCGACTAATCAACGACGAG 59.168 55.000 0.00 0.00 0.00 4.18
217 218 1.189403 GCGACTAATCAACGACGAGG 58.811 55.000 0.00 0.00 0.00 4.63
218 219 1.202110 GCGACTAATCAACGACGAGGA 60.202 52.381 0.00 0.00 0.00 3.71
219 220 2.541178 GCGACTAATCAACGACGAGGAT 60.541 50.000 0.00 0.62 0.00 3.24
220 221 3.289911 CGACTAATCAACGACGAGGATC 58.710 50.000 0.00 0.00 0.00 3.36
232 233 4.841617 AGGATCGCCGCCTCCTCA 62.842 66.667 2.64 0.00 37.30 3.86
233 234 3.620785 GGATCGCCGCCTCCTCAT 61.621 66.667 0.00 0.00 0.00 2.90
234 235 2.276116 GGATCGCCGCCTCCTCATA 61.276 63.158 0.00 0.00 0.00 2.15
235 236 1.214062 GATCGCCGCCTCCTCATAG 59.786 63.158 0.00 0.00 0.00 2.23
236 237 2.827383 GATCGCCGCCTCCTCATAGC 62.827 65.000 0.00 0.00 0.00 2.97
240 241 2.647875 CGCCTCCTCATAGCGGAG 59.352 66.667 0.00 0.00 45.88 4.63
246 247 2.336809 CTCATAGCGGAGGCGGAC 59.663 66.667 0.00 0.00 46.35 4.79
247 248 3.544167 CTCATAGCGGAGGCGGACG 62.544 68.421 0.00 0.00 46.35 4.79
248 249 3.592814 CATAGCGGAGGCGGACGA 61.593 66.667 0.00 0.00 46.35 4.20
249 250 3.288290 ATAGCGGAGGCGGACGAG 61.288 66.667 0.00 0.00 46.35 4.18
254 255 4.803426 GGAGGCGGACGAGCACAG 62.803 72.222 0.00 0.00 39.27 3.66
255 256 3.749064 GAGGCGGACGAGCACAGA 61.749 66.667 0.00 0.00 39.27 3.41
256 257 3.691744 GAGGCGGACGAGCACAGAG 62.692 68.421 0.00 0.00 39.27 3.35
257 258 4.803426 GGCGGACGAGCACAGAGG 62.803 72.222 0.00 0.00 39.27 3.69
258 259 4.803426 GCGGACGAGCACAGAGGG 62.803 72.222 0.00 0.00 37.05 4.30
259 260 4.803426 CGGACGAGCACAGAGGGC 62.803 72.222 0.00 0.00 0.00 5.19
260 261 4.803426 GGACGAGCACAGAGGGCG 62.803 72.222 0.00 0.00 36.08 6.13
261 262 4.803426 GACGAGCACAGAGGGCGG 62.803 72.222 0.00 0.00 36.08 6.13
284 285 3.957260 CGTGAGCACTTCCCACAG 58.043 61.111 0.00 0.00 0.00 3.66
285 286 1.669115 CGTGAGCACTTCCCACAGG 60.669 63.158 0.00 0.00 0.00 4.00
286 287 1.754745 GTGAGCACTTCCCACAGGA 59.245 57.895 0.00 0.00 41.88 3.86
287 288 0.326264 GTGAGCACTTCCCACAGGAT 59.674 55.000 0.00 0.00 43.54 3.24
288 289 0.325933 TGAGCACTTCCCACAGGATG 59.674 55.000 0.00 0.00 43.54 3.51
299 300 2.202797 CAGGATGTCACCGCCGAG 60.203 66.667 0.00 0.00 34.73 4.63
300 301 2.362503 AGGATGTCACCGCCGAGA 60.363 61.111 0.00 0.00 34.73 4.04
301 302 1.982395 AGGATGTCACCGCCGAGAA 60.982 57.895 0.00 0.00 34.73 2.87
302 303 1.810030 GGATGTCACCGCCGAGAAC 60.810 63.158 0.00 0.00 0.00 3.01
303 304 2.126071 ATGTCACCGCCGAGAACG 60.126 61.111 0.00 0.00 39.43 3.95
304 305 2.537792 GATGTCACCGCCGAGAACGA 62.538 60.000 0.00 0.00 42.66 3.85
305 306 2.504244 GTCACCGCCGAGAACGAG 60.504 66.667 0.00 0.00 42.66 4.18
306 307 2.981909 TCACCGCCGAGAACGAGT 60.982 61.111 0.00 0.00 42.66 4.18
307 308 2.049433 CACCGCCGAGAACGAGTT 60.049 61.111 0.00 0.00 42.66 3.01
308 309 2.087009 CACCGCCGAGAACGAGTTC 61.087 63.158 7.83 7.83 42.66 3.01
319 320 3.461946 GAACGAGTTCTGGATGCAAAG 57.538 47.619 8.58 0.00 36.69 2.77
320 321 1.813513 ACGAGTTCTGGATGCAAAGG 58.186 50.000 0.00 0.00 0.00 3.11
321 322 1.347707 ACGAGTTCTGGATGCAAAGGA 59.652 47.619 0.00 0.00 0.00 3.36
322 323 2.005451 CGAGTTCTGGATGCAAAGGAG 58.995 52.381 0.00 0.00 0.00 3.69
323 324 2.363683 GAGTTCTGGATGCAAAGGAGG 58.636 52.381 0.00 0.00 0.00 4.30
324 325 1.005215 AGTTCTGGATGCAAAGGAGGG 59.995 52.381 0.00 0.00 0.00 4.30
325 326 0.323725 TTCTGGATGCAAAGGAGGGC 60.324 55.000 0.00 0.00 0.00 5.19
326 327 2.045045 TGGATGCAAAGGAGGGCG 60.045 61.111 0.00 0.00 0.00 6.13
327 328 2.830370 GGATGCAAAGGAGGGCGG 60.830 66.667 0.00 0.00 0.00 6.13
328 329 2.272146 GATGCAAAGGAGGGCGGA 59.728 61.111 0.00 0.00 0.00 5.54
329 330 1.821332 GATGCAAAGGAGGGCGGAG 60.821 63.158 0.00 0.00 0.00 4.63
344 345 4.854784 GAGCGAGCCGTGCATCGA 62.855 66.667 11.43 0.00 41.40 3.59
345 346 4.435436 AGCGAGCCGTGCATCGAA 62.435 61.111 11.43 0.00 41.40 3.71
346 347 4.210304 GCGAGCCGTGCATCGAAC 62.210 66.667 11.43 3.30 41.40 3.95
347 348 3.902063 CGAGCCGTGCATCGAACG 61.902 66.667 1.16 1.16 41.40 3.95
352 353 3.544728 CGTGCATCGAACGGACAA 58.455 55.556 9.85 0.00 42.86 3.18
353 354 1.416049 CGTGCATCGAACGGACAAG 59.584 57.895 9.85 0.00 42.86 3.16
354 355 1.132640 GTGCATCGAACGGACAAGC 59.867 57.895 5.19 0.00 0.00 4.01
355 356 1.301322 TGCATCGAACGGACAAGCA 60.301 52.632 0.00 0.00 0.00 3.91
356 357 0.673333 TGCATCGAACGGACAAGCAT 60.673 50.000 0.00 0.00 0.00 3.79
357 358 0.247814 GCATCGAACGGACAAGCATG 60.248 55.000 0.00 0.00 0.00 4.06
358 359 1.078709 CATCGAACGGACAAGCATGT 58.921 50.000 0.00 0.00 44.25 3.21
359 360 1.078709 ATCGAACGGACAAGCATGTG 58.921 50.000 0.00 0.00 40.74 3.21
360 361 1.154413 CGAACGGACAAGCATGTGC 60.154 57.895 0.00 0.12 43.77 4.57
371 372 1.503542 GCATGTGCGGAAGGAACTG 59.496 57.895 0.00 0.00 40.86 3.16
372 373 1.926511 GCATGTGCGGAAGGAACTGG 61.927 60.000 0.00 0.00 40.86 4.00
373 374 1.675641 ATGTGCGGAAGGAACTGGC 60.676 57.895 0.00 0.00 40.86 4.85
374 375 3.423154 GTGCGGAAGGAACTGGCG 61.423 66.667 0.00 0.00 40.86 5.69
375 376 4.697756 TGCGGAAGGAACTGGCGG 62.698 66.667 0.00 0.00 40.86 6.13
376 377 4.388499 GCGGAAGGAACTGGCGGA 62.388 66.667 0.00 0.00 40.86 5.54
377 378 2.345991 CGGAAGGAACTGGCGGAA 59.654 61.111 0.00 0.00 40.86 4.30
378 379 1.741770 CGGAAGGAACTGGCGGAAG 60.742 63.158 0.00 0.00 40.86 3.46
390 391 4.955089 CGGAAGCCTAGATCGAGC 57.045 61.111 0.00 0.00 0.00 5.03
391 392 2.336341 CGGAAGCCTAGATCGAGCT 58.664 57.895 8.83 8.83 38.88 4.09
392 393 0.039617 CGGAAGCCTAGATCGAGCTG 60.040 60.000 14.67 3.24 36.84 4.24
393 394 0.316841 GGAAGCCTAGATCGAGCTGG 59.683 60.000 14.67 10.78 36.84 4.85
394 395 0.316841 GAAGCCTAGATCGAGCTGGG 59.683 60.000 26.95 26.95 39.35 4.45
395 396 0.105964 AAGCCTAGATCGAGCTGGGA 60.106 55.000 33.98 4.18 38.70 4.37
396 397 0.825840 AGCCTAGATCGAGCTGGGAC 60.826 60.000 33.98 24.02 38.70 4.46
397 398 1.811645 GCCTAGATCGAGCTGGGACC 61.812 65.000 33.98 15.35 38.70 4.46
398 399 0.178975 CCTAGATCGAGCTGGGACCT 60.179 60.000 27.21 0.00 38.70 3.85
399 400 1.074084 CCTAGATCGAGCTGGGACCTA 59.926 57.143 27.21 0.00 38.70 3.08
400 401 2.156098 CTAGATCGAGCTGGGACCTAC 58.844 57.143 14.67 0.00 0.00 3.18
401 402 0.820074 AGATCGAGCTGGGACCTACG 60.820 60.000 0.39 0.00 0.00 3.51
402 403 1.076923 ATCGAGCTGGGACCTACGT 60.077 57.895 0.00 0.00 0.00 3.57
403 404 1.102222 ATCGAGCTGGGACCTACGTC 61.102 60.000 0.00 0.00 38.38 4.34
404 405 2.799371 GAGCTGGGACCTACGTCG 59.201 66.667 0.00 0.00 40.17 5.12
405 406 1.748122 GAGCTGGGACCTACGTCGA 60.748 63.158 0.00 0.00 40.17 4.20
406 407 1.991099 GAGCTGGGACCTACGTCGAC 61.991 65.000 5.18 5.18 40.17 4.20
407 408 3.061260 GCTGGGACCTACGTCGACC 62.061 68.421 10.58 0.00 40.17 4.79
408 409 1.378250 CTGGGACCTACGTCGACCT 60.378 63.158 10.58 0.34 40.17 3.85
409 410 1.654954 CTGGGACCTACGTCGACCTG 61.655 65.000 10.58 0.00 40.17 4.00
410 411 2.413142 GGGACCTACGTCGACCTGG 61.413 68.421 10.58 11.86 40.17 4.45
411 412 2.413142 GGACCTACGTCGACCTGGG 61.413 68.421 13.97 13.97 40.17 4.45
412 413 1.377725 GACCTACGTCGACCTGGGA 60.378 63.158 20.73 0.00 0.00 4.37
413 414 1.652167 GACCTACGTCGACCTGGGAC 61.652 65.000 20.73 12.49 0.00 4.46
418 419 3.599584 GTCGACCTGGGACGATGA 58.400 61.111 15.78 0.00 42.96 2.92
419 420 1.888018 GTCGACCTGGGACGATGAA 59.112 57.895 15.78 0.00 42.96 2.57
420 421 0.179134 GTCGACCTGGGACGATGAAG 60.179 60.000 15.78 0.00 42.96 3.02
421 422 0.323087 TCGACCTGGGACGATGAAGA 60.323 55.000 9.77 0.00 37.38 2.87
422 423 0.747255 CGACCTGGGACGATGAAGAT 59.253 55.000 5.66 0.00 35.52 2.40
423 424 1.269309 CGACCTGGGACGATGAAGATC 60.269 57.143 5.66 0.00 35.52 2.75
424 425 1.069358 GACCTGGGACGATGAAGATCC 59.931 57.143 0.00 0.00 0.00 3.36
425 426 1.343478 ACCTGGGACGATGAAGATCCT 60.343 52.381 0.00 0.00 32.70 3.24
426 427 1.342819 CCTGGGACGATGAAGATCCTC 59.657 57.143 0.00 0.00 32.70 3.71
427 428 1.000827 CTGGGACGATGAAGATCCTCG 60.001 57.143 0.00 3.95 39.77 4.63
428 429 0.315568 GGGACGATGAAGATCCTCGG 59.684 60.000 9.28 0.00 38.54 4.63
429 430 1.033574 GGACGATGAAGATCCTCGGT 58.966 55.000 9.28 0.00 38.54 4.69
430 431 1.001158 GGACGATGAAGATCCTCGGTC 60.001 57.143 9.28 5.80 38.54 4.79
431 432 0.663688 ACGATGAAGATCCTCGGTCG 59.336 55.000 14.00 14.00 38.54 4.79
432 433 0.661780 CGATGAAGATCCTCGGTCGC 60.662 60.000 6.14 0.00 32.19 5.19
433 434 0.671251 GATGAAGATCCTCGGTCGCT 59.329 55.000 0.00 0.00 0.00 4.93
434 435 0.671251 ATGAAGATCCTCGGTCGCTC 59.329 55.000 0.00 0.00 0.00 5.03
435 436 1.009449 GAAGATCCTCGGTCGCTCG 60.009 63.158 0.00 0.00 0.00 5.03
436 437 1.437772 GAAGATCCTCGGTCGCTCGA 61.438 60.000 0.00 0.54 37.60 4.04
437 438 1.716826 AAGATCCTCGGTCGCTCGAC 61.717 60.000 13.45 13.45 43.87 4.20
438 439 3.509296 GATCCTCGGTCGCTCGACG 62.509 68.421 15.07 10.93 45.41 5.12
452 453 4.887763 GCTCGACGCGATCTATTTTTAT 57.112 40.909 15.93 0.00 34.61 1.40
453 454 5.251999 GCTCGACGCGATCTATTTTTATT 57.748 39.130 15.93 0.00 34.61 1.40
454 455 5.667175 GCTCGACGCGATCTATTTTTATTT 58.333 37.500 15.93 0.00 34.61 1.40
455 456 6.804232 GCTCGACGCGATCTATTTTTATTTA 58.196 36.000 15.93 0.00 34.61 1.40
456 457 6.943311 GCTCGACGCGATCTATTTTTATTTAG 59.057 38.462 15.93 0.00 34.61 1.85
457 458 6.804232 TCGACGCGATCTATTTTTATTTAGC 58.196 36.000 15.93 0.00 0.00 3.09
461 462 6.007677 CGCGATCTATTTTTATTTAGCGTCC 58.992 40.000 0.00 0.00 39.19 4.79
462 463 6.128902 CGCGATCTATTTTTATTTAGCGTCCT 60.129 38.462 0.00 0.00 39.19 3.85
463 464 7.568861 CGCGATCTATTTTTATTTAGCGTCCTT 60.569 37.037 0.00 0.00 39.19 3.36
464 465 8.068380 GCGATCTATTTTTATTTAGCGTCCTTT 58.932 33.333 0.00 0.00 0.00 3.11
465 466 9.931210 CGATCTATTTTTATTTAGCGTCCTTTT 57.069 29.630 0.00 0.00 0.00 2.27
501 502 7.921786 TTTAGCATAGTATGAACTTGCTTGT 57.078 32.000 14.52 0.00 42.37 3.16
502 503 5.808042 AGCATAGTATGAACTTGCTTGTG 57.192 39.130 14.52 0.00 42.37 3.33
503 504 4.637534 AGCATAGTATGAACTTGCTTGTGG 59.362 41.667 14.52 0.00 42.37 4.17
504 505 4.396166 GCATAGTATGAACTTGCTTGTGGT 59.604 41.667 14.52 0.00 37.07 4.16
505 506 5.584649 GCATAGTATGAACTTGCTTGTGGTA 59.415 40.000 14.52 0.00 37.07 3.25
506 507 6.260936 GCATAGTATGAACTTGCTTGTGGTAT 59.739 38.462 14.52 0.00 37.07 2.73
507 508 7.633621 CATAGTATGAACTTGCTTGTGGTATG 58.366 38.462 3.91 0.00 37.15 2.39
508 509 4.943705 AGTATGAACTTGCTTGTGGTATGG 59.056 41.667 0.00 0.00 29.00 2.74
509 510 3.500448 TGAACTTGCTTGTGGTATGGA 57.500 42.857 0.00 0.00 0.00 3.41
510 511 3.411446 TGAACTTGCTTGTGGTATGGAG 58.589 45.455 0.00 0.00 0.00 3.86
511 512 1.826385 ACTTGCTTGTGGTATGGAGC 58.174 50.000 0.00 0.00 35.74 4.70
512 513 1.352352 ACTTGCTTGTGGTATGGAGCT 59.648 47.619 0.00 0.00 36.16 4.09
513 514 2.224867 ACTTGCTTGTGGTATGGAGCTT 60.225 45.455 0.00 0.00 36.16 3.74
514 515 1.825090 TGCTTGTGGTATGGAGCTTG 58.175 50.000 0.00 0.00 36.16 4.01
515 516 1.350684 TGCTTGTGGTATGGAGCTTGA 59.649 47.619 0.00 0.00 36.16 3.02
516 517 2.224744 TGCTTGTGGTATGGAGCTTGAA 60.225 45.455 0.00 0.00 36.16 2.69
517 518 2.162408 GCTTGTGGTATGGAGCTTGAAC 59.838 50.000 0.00 0.00 32.54 3.18
518 519 3.679389 CTTGTGGTATGGAGCTTGAACT 58.321 45.455 0.00 0.00 0.00 3.01
519 520 3.057969 TGTGGTATGGAGCTTGAACTG 57.942 47.619 0.00 0.00 0.00 3.16
520 521 2.371841 TGTGGTATGGAGCTTGAACTGT 59.628 45.455 0.00 0.00 0.00 3.55
521 522 2.744202 GTGGTATGGAGCTTGAACTGTG 59.256 50.000 0.00 0.00 0.00 3.66
522 523 1.740025 GGTATGGAGCTTGAACTGTGC 59.260 52.381 0.00 0.00 0.00 4.57
523 524 2.616510 GGTATGGAGCTTGAACTGTGCT 60.617 50.000 0.00 0.00 40.02 4.40
524 525 3.369471 GGTATGGAGCTTGAACTGTGCTA 60.369 47.826 0.00 0.00 37.16 3.49
525 526 3.641434 ATGGAGCTTGAACTGTGCTAT 57.359 42.857 0.00 0.00 37.16 2.97
526 527 2.703416 TGGAGCTTGAACTGTGCTATG 58.297 47.619 0.00 0.00 37.16 2.23
527 528 2.302733 TGGAGCTTGAACTGTGCTATGA 59.697 45.455 0.00 0.00 37.16 2.15
528 529 3.244526 TGGAGCTTGAACTGTGCTATGAA 60.245 43.478 0.00 0.00 37.16 2.57
529 530 3.944015 GGAGCTTGAACTGTGCTATGAAT 59.056 43.478 0.00 0.00 37.16 2.57
530 531 4.397417 GGAGCTTGAACTGTGCTATGAATT 59.603 41.667 0.00 0.00 37.16 2.17
531 532 5.586243 GGAGCTTGAACTGTGCTATGAATTA 59.414 40.000 0.00 0.00 37.16 1.40
532 533 6.261826 GGAGCTTGAACTGTGCTATGAATTAT 59.738 38.462 0.00 0.00 37.16 1.28
533 534 7.442364 GGAGCTTGAACTGTGCTATGAATTATA 59.558 37.037 0.00 0.00 37.16 0.98
534 535 8.915057 AGCTTGAACTGTGCTATGAATTATAT 57.085 30.769 0.00 0.00 35.05 0.86
535 536 8.781196 AGCTTGAACTGTGCTATGAATTATATG 58.219 33.333 0.00 0.00 35.05 1.78
536 537 8.562892 GCTTGAACTGTGCTATGAATTATATGT 58.437 33.333 0.00 0.00 0.00 2.29
539 540 9.394767 TGAACTGTGCTATGAATTATATGTTGT 57.605 29.630 0.00 0.00 0.00 3.32
559 560 8.329066 TGTTGTTTCATATTTGTTTGTACGTG 57.671 30.769 0.00 0.00 0.00 4.49
560 561 8.182227 TGTTGTTTCATATTTGTTTGTACGTGA 58.818 29.630 0.00 0.00 0.00 4.35
561 562 9.176181 GTTGTTTCATATTTGTTTGTACGTGAT 57.824 29.630 0.00 0.00 0.00 3.06
562 563 9.737427 TTGTTTCATATTTGTTTGTACGTGATT 57.263 25.926 0.00 0.00 0.00 2.57
563 564 9.737427 TGTTTCATATTTGTTTGTACGTGATTT 57.263 25.926 0.00 0.00 0.00 2.17
570 571 8.918961 ATTTGTTTGTACGTGATTTTTCTCAA 57.081 26.923 0.00 0.00 0.00 3.02
571 572 7.962934 TTGTTTGTACGTGATTTTTCTCAAG 57.037 32.000 0.00 0.00 0.00 3.02
572 573 5.968848 TGTTTGTACGTGATTTTTCTCAAGC 59.031 36.000 0.00 0.00 0.00 4.01
573 574 5.743026 TTGTACGTGATTTTTCTCAAGCA 57.257 34.783 0.00 0.00 0.00 3.91
574 575 5.940192 TGTACGTGATTTTTCTCAAGCAT 57.060 34.783 0.00 0.00 0.00 3.79
575 576 5.927030 TGTACGTGATTTTTCTCAAGCATC 58.073 37.500 0.00 0.00 0.00 3.91
576 577 5.468409 TGTACGTGATTTTTCTCAAGCATCA 59.532 36.000 0.00 0.00 0.00 3.07
577 578 5.039480 ACGTGATTTTTCTCAAGCATCAG 57.961 39.130 0.00 0.00 0.00 2.90
578 579 3.850273 CGTGATTTTTCTCAAGCATCAGC 59.150 43.478 0.00 0.00 42.56 4.26
588 589 3.260483 GCATCAGCTGGTCGCGAG 61.260 66.667 10.24 0.00 45.59 5.03
589 590 3.260483 CATCAGCTGGTCGCGAGC 61.260 66.667 30.17 30.17 45.59 5.03
590 591 4.862092 ATCAGCTGGTCGCGAGCG 62.862 66.667 30.51 24.90 45.59 5.03
598 599 3.712881 GTCGCGAGCGCTGGTTTT 61.713 61.111 18.48 0.00 39.59 2.43
599 600 2.970324 TCGCGAGCGCTGGTTTTT 60.970 55.556 18.48 0.00 39.59 1.94
600 601 1.665282 TCGCGAGCGCTGGTTTTTA 60.665 52.632 18.48 0.00 39.59 1.52
601 602 1.509162 CGCGAGCGCTGGTTTTTAC 60.509 57.895 18.48 0.00 39.32 2.01
602 603 1.154282 GCGAGCGCTGGTTTTTACC 60.154 57.895 18.48 0.00 38.26 2.85
603 604 1.847890 GCGAGCGCTGGTTTTTACCA 61.848 55.000 18.48 0.00 38.26 3.25
604 605 0.110373 CGAGCGCTGGTTTTTACCAC 60.110 55.000 18.48 0.00 35.63 4.16
605 606 0.110373 GAGCGCTGGTTTTTACCACG 60.110 55.000 18.48 11.99 37.36 4.94
606 607 0.816421 AGCGCTGGTTTTTACCACGT 60.816 50.000 10.39 0.00 36.97 4.49
607 608 0.385098 GCGCTGGTTTTTACCACGTC 60.385 55.000 0.00 8.35 36.97 4.34
608 609 1.223187 CGCTGGTTTTTACCACGTCT 58.777 50.000 0.00 0.00 35.63 4.18
609 610 1.600485 CGCTGGTTTTTACCACGTCTT 59.400 47.619 0.00 0.00 35.63 3.01
610 611 2.801679 CGCTGGTTTTTACCACGTCTTA 59.198 45.455 0.00 0.00 35.63 2.10
611 612 3.248125 CGCTGGTTTTTACCACGTCTTAA 59.752 43.478 0.00 0.00 35.63 1.85
612 613 4.530388 GCTGGTTTTTACCACGTCTTAAC 58.470 43.478 0.00 0.00 35.63 2.01
637 638 4.963276 ATAGAGCACGCTAAATTTTGCA 57.037 36.364 21.55 3.70 37.44 4.08
638 639 3.207474 AGAGCACGCTAAATTTTGCAG 57.793 42.857 21.55 16.40 37.44 4.41
639 640 1.650645 GAGCACGCTAAATTTTGCAGC 59.349 47.619 21.55 21.92 37.44 5.25
645 646 2.253603 GCTAAATTTTGCAGCGTCAGG 58.746 47.619 17.94 0.00 0.00 3.86
646 647 2.351738 GCTAAATTTTGCAGCGTCAGGT 60.352 45.455 17.94 0.00 0.00 4.00
647 648 3.119990 GCTAAATTTTGCAGCGTCAGGTA 60.120 43.478 17.94 0.00 0.00 3.08
648 649 4.614993 GCTAAATTTTGCAGCGTCAGGTAA 60.615 41.667 17.94 0.00 0.00 2.85
649 650 4.314740 AAATTTTGCAGCGTCAGGTAAA 57.685 36.364 0.00 0.00 0.00 2.01
650 651 3.559238 ATTTTGCAGCGTCAGGTAAAG 57.441 42.857 0.00 0.00 0.00 1.85
651 652 0.591170 TTTGCAGCGTCAGGTAAAGC 59.409 50.000 0.00 0.00 0.00 3.51
652 653 0.533978 TTGCAGCGTCAGGTAAAGCA 60.534 50.000 0.00 0.00 0.00 3.91
653 654 0.533978 TGCAGCGTCAGGTAAAGCAA 60.534 50.000 0.00 0.00 0.00 3.91
654 655 0.110192 GCAGCGTCAGGTAAAGCAAC 60.110 55.000 0.00 0.00 0.00 4.17
655 656 0.517316 CAGCGTCAGGTAAAGCAACC 59.483 55.000 0.00 0.00 40.06 3.77
656 657 0.107831 AGCGTCAGGTAAAGCAACCA 59.892 50.000 5.79 0.00 42.40 3.67
657 658 0.237498 GCGTCAGGTAAAGCAACCAC 59.763 55.000 5.79 0.00 42.40 4.16
658 659 0.872388 CGTCAGGTAAAGCAACCACC 59.128 55.000 5.79 0.00 42.40 4.61
659 660 1.244816 GTCAGGTAAAGCAACCACCC 58.755 55.000 5.79 0.00 42.40 4.61
660 661 1.145571 TCAGGTAAAGCAACCACCCT 58.854 50.000 5.79 0.00 42.40 4.34
661 662 1.073284 TCAGGTAAAGCAACCACCCTC 59.927 52.381 5.79 0.00 42.40 4.30
662 663 1.073923 CAGGTAAAGCAACCACCCTCT 59.926 52.381 5.79 0.00 42.40 3.69
663 664 1.351350 AGGTAAAGCAACCACCCTCTC 59.649 52.381 5.79 0.00 42.40 3.20
664 665 1.439679 GTAAAGCAACCACCCTCTCG 58.560 55.000 0.00 0.00 0.00 4.04
665 666 0.321298 TAAAGCAACCACCCTCTCGC 60.321 55.000 0.00 0.00 0.00 5.03
666 667 2.056906 AAAGCAACCACCCTCTCGCT 62.057 55.000 0.00 0.00 0.00 4.93
667 668 2.738213 AAGCAACCACCCTCTCGCTG 62.738 60.000 0.00 0.00 0.00 5.18
668 669 2.743928 CAACCACCCTCTCGCTGC 60.744 66.667 0.00 0.00 0.00 5.25
669 670 3.241530 AACCACCCTCTCGCTGCA 61.242 61.111 0.00 0.00 0.00 4.41
670 671 3.537206 AACCACCCTCTCGCTGCAC 62.537 63.158 0.00 0.00 0.00 4.57
681 682 2.865151 GCTGCACGCGCTAAAACG 60.865 61.111 5.73 0.00 39.64 3.60
693 694 4.098532 CGCTAAAACGCTAGTATTTCGG 57.901 45.455 0.00 0.00 0.00 4.30
694 695 3.792956 CGCTAAAACGCTAGTATTTCGGA 59.207 43.478 0.00 0.00 0.00 4.55
695 696 4.085721 CGCTAAAACGCTAGTATTTCGGAG 60.086 45.833 0.00 0.00 0.00 4.63
696 697 4.317909 GCTAAAACGCTAGTATTTCGGAGC 60.318 45.833 0.00 0.39 0.00 4.70
697 698 2.953466 AACGCTAGTATTTCGGAGCA 57.047 45.000 0.00 0.00 34.49 4.26
698 699 2.953466 ACGCTAGTATTTCGGAGCAA 57.047 45.000 0.00 0.00 34.49 3.91
699 700 2.537401 ACGCTAGTATTTCGGAGCAAC 58.463 47.619 0.00 0.00 34.49 4.17
700 701 2.094390 ACGCTAGTATTTCGGAGCAACA 60.094 45.455 0.00 0.00 34.49 3.33
701 702 2.927477 CGCTAGTATTTCGGAGCAACAA 59.073 45.455 0.00 0.00 34.49 2.83
702 703 3.369756 CGCTAGTATTTCGGAGCAACAAA 59.630 43.478 0.00 0.00 34.49 2.83
703 704 4.034048 CGCTAGTATTTCGGAGCAACAAAT 59.966 41.667 0.00 0.00 34.49 2.32
704 705 5.447279 CGCTAGTATTTCGGAGCAACAAATT 60.447 40.000 0.00 0.00 34.49 1.82
705 706 6.322491 GCTAGTATTTCGGAGCAACAAATTT 58.678 36.000 0.00 0.00 34.96 1.82
706 707 6.251376 GCTAGTATTTCGGAGCAACAAATTTG 59.749 38.462 16.67 16.67 34.96 2.32
707 708 6.084326 AGTATTTCGGAGCAACAAATTTGT 57.916 33.333 18.13 18.13 44.72 2.83
721 722 6.991485 ACAAATTTGTTTTAGTGCGAGATG 57.009 33.333 18.13 0.00 38.47 2.90
722 723 5.402270 ACAAATTTGTTTTAGTGCGAGATGC 59.598 36.000 18.13 0.00 40.86 3.91
723 724 5.376854 AATTTGTTTTAGTGCGAGATGCT 57.623 34.783 0.00 0.00 46.63 3.79
724 725 4.404507 TTTGTTTTAGTGCGAGATGCTC 57.595 40.909 0.00 0.00 46.63 4.26
726 727 3.664107 TGTTTTAGTGCGAGATGCTCTT 58.336 40.909 0.00 0.00 44.69 2.85
727 728 4.816392 TGTTTTAGTGCGAGATGCTCTTA 58.184 39.130 0.00 0.00 44.69 2.10
728 729 5.419542 TGTTTTAGTGCGAGATGCTCTTAT 58.580 37.500 0.00 0.00 44.69 1.73
729 730 5.520288 TGTTTTAGTGCGAGATGCTCTTATC 59.480 40.000 0.00 0.00 44.69 1.75
730 731 2.810439 AGTGCGAGATGCTCTTATCC 57.190 50.000 0.00 0.00 44.69 2.59
731 732 2.315176 AGTGCGAGATGCTCTTATCCT 58.685 47.619 0.00 0.00 44.69 3.24
732 733 2.295909 AGTGCGAGATGCTCTTATCCTC 59.704 50.000 0.00 0.00 44.69 3.71
733 734 2.295909 GTGCGAGATGCTCTTATCCTCT 59.704 50.000 0.00 0.00 46.63 3.69
734 735 2.961741 TGCGAGATGCTCTTATCCTCTT 59.038 45.455 0.00 0.00 46.63 2.85
735 736 3.005261 TGCGAGATGCTCTTATCCTCTTC 59.995 47.826 0.00 0.00 46.63 2.87
736 737 3.005261 GCGAGATGCTCTTATCCTCTTCA 59.995 47.826 0.00 0.00 41.73 3.02
737 738 4.545610 CGAGATGCTCTTATCCTCTTCAC 58.454 47.826 0.00 0.00 0.00 3.18
738 739 4.558496 CGAGATGCTCTTATCCTCTTCACC 60.558 50.000 0.00 0.00 0.00 4.02
739 740 3.320541 AGATGCTCTTATCCTCTTCACCG 59.679 47.826 0.00 0.00 0.00 4.94
740 741 1.137086 TGCTCTTATCCTCTTCACCGC 59.863 52.381 0.00 0.00 0.00 5.68
741 742 1.866063 GCTCTTATCCTCTTCACCGCG 60.866 57.143 0.00 0.00 0.00 6.46
742 743 1.676529 CTCTTATCCTCTTCACCGCGA 59.323 52.381 8.23 0.00 0.00 5.87
743 744 1.404391 TCTTATCCTCTTCACCGCGAC 59.596 52.381 8.23 0.00 0.00 5.19
744 745 1.405821 CTTATCCTCTTCACCGCGACT 59.594 52.381 8.23 0.00 0.00 4.18
745 746 0.738975 TATCCTCTTCACCGCGACTG 59.261 55.000 8.23 1.81 0.00 3.51
746 747 2.564553 ATCCTCTTCACCGCGACTGC 62.565 60.000 8.23 0.00 37.91 4.40
747 748 2.259818 CTCTTCACCGCGACTGCT 59.740 61.111 8.23 0.00 39.65 4.24
748 749 2.049156 TCTTCACCGCGACTGCTG 60.049 61.111 8.23 0.00 39.65 4.41
749 750 3.114616 CTTCACCGCGACTGCTGG 61.115 66.667 8.23 0.00 39.65 4.85
750 751 4.680237 TTCACCGCGACTGCTGGG 62.680 66.667 8.23 0.00 38.54 4.45
778 779 2.753043 CTGGCCCCACAGCACATC 60.753 66.667 0.00 0.00 0.00 3.06
779 780 4.365111 TGGCCCCACAGCACATCC 62.365 66.667 0.00 0.00 0.00 3.51
782 783 4.033776 CCCCACAGCACATCCCGT 62.034 66.667 0.00 0.00 0.00 5.28
783 784 2.436646 CCCACAGCACATCCCGTC 60.437 66.667 0.00 0.00 0.00 4.79
784 785 2.436646 CCACAGCACATCCCGTCC 60.437 66.667 0.00 0.00 0.00 4.79
785 786 2.436646 CACAGCACATCCCGTCCC 60.437 66.667 0.00 0.00 0.00 4.46
786 787 2.607750 ACAGCACATCCCGTCCCT 60.608 61.111 0.00 0.00 0.00 4.20
787 788 2.224159 ACAGCACATCCCGTCCCTT 61.224 57.895 0.00 0.00 0.00 3.95
788 789 1.002134 CAGCACATCCCGTCCCTTT 60.002 57.895 0.00 0.00 0.00 3.11
789 790 0.609131 CAGCACATCCCGTCCCTTTT 60.609 55.000 0.00 0.00 0.00 2.27
790 791 0.322546 AGCACATCCCGTCCCTTTTC 60.323 55.000 0.00 0.00 0.00 2.29
791 792 0.322546 GCACATCCCGTCCCTTTTCT 60.323 55.000 0.00 0.00 0.00 2.52
792 793 1.886655 GCACATCCCGTCCCTTTTCTT 60.887 52.381 0.00 0.00 0.00 2.52
793 794 2.084546 CACATCCCGTCCCTTTTCTTC 58.915 52.381 0.00 0.00 0.00 2.87
794 795 1.004394 ACATCCCGTCCCTTTTCTTCC 59.996 52.381 0.00 0.00 0.00 3.46
795 796 1.282157 CATCCCGTCCCTTTTCTTCCT 59.718 52.381 0.00 0.00 0.00 3.36
796 797 0.690762 TCCCGTCCCTTTTCTTCCTG 59.309 55.000 0.00 0.00 0.00 3.86
797 798 0.960861 CCCGTCCCTTTTCTTCCTGC 60.961 60.000 0.00 0.00 0.00 4.85
798 799 0.960861 CCGTCCCTTTTCTTCCTGCC 60.961 60.000 0.00 0.00 0.00 4.85
799 800 1.298859 CGTCCCTTTTCTTCCTGCCG 61.299 60.000 0.00 0.00 0.00 5.69
800 801 0.250770 GTCCCTTTTCTTCCTGCCGT 60.251 55.000 0.00 0.00 0.00 5.68
801 802 0.250727 TCCCTTTTCTTCCTGCCGTG 60.251 55.000 0.00 0.00 0.00 4.94
802 803 1.581447 CCTTTTCTTCCTGCCGTGC 59.419 57.895 0.00 0.00 0.00 5.34
803 804 1.581447 CTTTTCTTCCTGCCGTGCC 59.419 57.895 0.00 0.00 0.00 5.01
804 805 1.866853 CTTTTCTTCCTGCCGTGCCC 61.867 60.000 0.00 0.00 0.00 5.36
805 806 2.632602 TTTTCTTCCTGCCGTGCCCA 62.633 55.000 0.00 0.00 0.00 5.36
806 807 3.842925 TTCTTCCTGCCGTGCCCAC 62.843 63.158 0.00 0.00 0.00 4.61
823 824 3.826754 CGACGCTGCTCCTGCCTA 61.827 66.667 0.00 0.00 38.71 3.93
824 825 2.818132 GACGCTGCTCCTGCCTAT 59.182 61.111 0.00 0.00 38.71 2.57
825 826 1.300542 GACGCTGCTCCTGCCTATC 60.301 63.158 0.00 0.00 38.71 2.08
826 827 1.743321 GACGCTGCTCCTGCCTATCT 61.743 60.000 0.00 0.00 38.71 1.98
827 828 0.468214 ACGCTGCTCCTGCCTATCTA 60.468 55.000 0.00 0.00 38.71 1.98
828 829 0.038709 CGCTGCTCCTGCCTATCTAC 60.039 60.000 0.00 0.00 38.71 2.59
829 830 1.337118 GCTGCTCCTGCCTATCTACT 58.663 55.000 0.00 0.00 38.71 2.57
830 831 1.691434 GCTGCTCCTGCCTATCTACTT 59.309 52.381 0.00 0.00 38.71 2.24
831 832 2.103941 GCTGCTCCTGCCTATCTACTTT 59.896 50.000 0.00 0.00 38.71 2.66
832 833 3.432890 GCTGCTCCTGCCTATCTACTTTT 60.433 47.826 0.00 0.00 38.71 2.27
833 834 4.202264 GCTGCTCCTGCCTATCTACTTTTA 60.202 45.833 0.00 0.00 38.71 1.52
834 835 5.512232 GCTGCTCCTGCCTATCTACTTTTAT 60.512 44.000 0.00 0.00 38.71 1.40
835 836 6.102897 TGCTCCTGCCTATCTACTTTTATC 57.897 41.667 0.00 0.00 38.71 1.75
836 837 5.602561 TGCTCCTGCCTATCTACTTTTATCA 59.397 40.000 0.00 0.00 38.71 2.15
837 838 6.162777 GCTCCTGCCTATCTACTTTTATCAG 58.837 44.000 0.00 0.00 0.00 2.90
838 839 6.015010 GCTCCTGCCTATCTACTTTTATCAGA 60.015 42.308 0.00 0.00 0.00 3.27
839 840 7.291411 TCCTGCCTATCTACTTTTATCAGAC 57.709 40.000 0.00 0.00 0.00 3.51
840 841 6.016192 TCCTGCCTATCTACTTTTATCAGACG 60.016 42.308 0.00 0.00 0.00 4.18
841 842 5.529791 TGCCTATCTACTTTTATCAGACGC 58.470 41.667 0.00 0.00 0.00 5.19
842 843 4.924462 GCCTATCTACTTTTATCAGACGCC 59.076 45.833 0.00 0.00 0.00 5.68
843 844 5.509163 GCCTATCTACTTTTATCAGACGCCA 60.509 44.000 0.00 0.00 0.00 5.69
844 845 6.692486 CCTATCTACTTTTATCAGACGCCAT 58.308 40.000 0.00 0.00 0.00 4.40
845 846 7.155328 CCTATCTACTTTTATCAGACGCCATT 58.845 38.462 0.00 0.00 0.00 3.16
846 847 6.851222 ATCTACTTTTATCAGACGCCATTG 57.149 37.500 0.00 0.00 0.00 2.82
847 848 3.764885 ACTTTTATCAGACGCCATTGC 57.235 42.857 0.00 0.00 0.00 3.56
848 849 3.347216 ACTTTTATCAGACGCCATTGCT 58.653 40.909 0.00 0.00 34.43 3.91
849 850 3.127548 ACTTTTATCAGACGCCATTGCTG 59.872 43.478 0.00 0.00 34.43 4.41
850 851 1.016627 TTATCAGACGCCATTGCTGC 58.983 50.000 0.00 0.00 34.43 5.25
851 852 0.107752 TATCAGACGCCATTGCTGCA 60.108 50.000 0.00 0.00 34.43 4.41
852 853 1.374343 ATCAGACGCCATTGCTGCAG 61.374 55.000 10.11 10.11 34.43 4.41
853 854 3.437795 AGACGCCATTGCTGCAGC 61.438 61.111 31.89 31.89 42.50 5.25
886 887 3.702048 CGCCTTCCTCCCCACGAA 61.702 66.667 0.00 0.00 0.00 3.85
887 888 2.269241 GCCTTCCTCCCCACGAAG 59.731 66.667 0.00 0.00 36.13 3.79
888 889 2.269241 CCTTCCTCCCCACGAAGC 59.731 66.667 0.00 0.00 35.23 3.86
889 890 2.269241 CTTCCTCCCCACGAAGCC 59.731 66.667 0.00 0.00 29.89 4.35
890 891 3.665675 CTTCCTCCCCACGAAGCCG 62.666 68.421 0.00 0.00 42.50 5.52
897 898 3.645975 CCACGAAGCCGCGTTGTT 61.646 61.111 4.92 0.00 43.59 2.83
898 899 2.425124 CACGAAGCCGCGTTGTTG 60.425 61.111 4.92 0.00 43.59 3.33
899 900 2.893404 ACGAAGCCGCGTTGTTGT 60.893 55.556 4.92 0.00 42.71 3.32
900 901 2.425124 CGAAGCCGCGTTGTTGTG 60.425 61.111 4.92 0.00 0.00 3.33
901 902 2.051345 GAAGCCGCGTTGTTGTGG 60.051 61.111 4.92 0.00 42.55 4.17
902 903 2.515057 AAGCCGCGTTGTTGTGGA 60.515 55.556 4.92 0.00 42.25 4.02
903 904 2.443957 GAAGCCGCGTTGTTGTGGAG 62.444 60.000 4.92 0.00 42.25 3.86
904 905 4.683334 GCCGCGTTGTTGTGGAGC 62.683 66.667 4.92 0.00 42.25 4.70
905 906 2.972505 CCGCGTTGTTGTGGAGCT 60.973 61.111 4.92 0.00 42.25 4.09
906 907 2.249309 CGCGTTGTTGTGGAGCTG 59.751 61.111 0.00 0.00 0.00 4.24
907 908 2.050985 GCGTTGTTGTGGAGCTGC 60.051 61.111 0.00 0.00 0.00 5.25
908 909 2.546494 GCGTTGTTGTGGAGCTGCT 61.546 57.895 6.82 0.00 0.00 4.24
909 910 1.280746 CGTTGTTGTGGAGCTGCTG 59.719 57.895 7.01 0.00 0.00 4.41
910 911 1.008079 GTTGTTGTGGAGCTGCTGC 60.008 57.895 14.73 14.73 40.05 5.25
921 922 2.643272 CTGCTGCTGTTGCACAGG 59.357 61.111 15.16 4.21 46.01 4.00
922 923 1.895231 CTGCTGCTGTTGCACAGGA 60.895 57.895 15.16 12.34 46.01 3.86
923 924 1.228337 TGCTGCTGTTGCACAGGAT 60.228 52.632 15.16 0.00 45.46 3.24
924 925 1.211969 GCTGCTGTTGCACAGGATG 59.788 57.895 15.16 9.25 45.46 3.51
934 935 3.620061 CACAGGATGCCATCGCTAT 57.380 52.632 0.00 0.00 42.53 2.97
935 936 1.154197 CACAGGATGCCATCGCTATG 58.846 55.000 0.00 0.00 42.53 2.23
947 948 4.230603 GCTATGGAGCTGCTGCAA 57.769 55.556 27.28 15.17 45.98 4.08
948 949 2.716814 GCTATGGAGCTGCTGCAAT 58.283 52.632 27.28 17.25 45.98 3.56
949 950 0.311165 GCTATGGAGCTGCTGCAATG 59.689 55.000 27.28 21.57 45.98 2.82
950 951 0.952280 CTATGGAGCTGCTGCAATGG 59.048 55.000 27.28 15.67 42.74 3.16
951 952 0.466739 TATGGAGCTGCTGCAATGGG 60.467 55.000 27.28 0.00 42.74 4.00
952 953 3.145551 GGAGCTGCTGCAATGGGG 61.146 66.667 16.70 0.00 42.74 4.96
953 954 2.044650 GAGCTGCTGCAATGGGGA 60.045 61.111 18.42 0.00 42.74 4.81
954 955 1.679977 GAGCTGCTGCAATGGGGAA 60.680 57.895 18.42 0.00 42.74 3.97
955 956 1.228956 AGCTGCTGCAATGGGGAAA 60.229 52.632 18.42 0.00 42.74 3.13
956 957 1.217244 GCTGCTGCAATGGGGAAAG 59.783 57.895 11.11 0.00 39.41 2.62
957 958 1.895238 CTGCTGCAATGGGGAAAGG 59.105 57.895 3.02 0.00 0.00 3.11
958 959 0.901580 CTGCTGCAATGGGGAAAGGT 60.902 55.000 3.02 0.00 0.00 3.50
959 960 1.186917 TGCTGCAATGGGGAAAGGTG 61.187 55.000 0.00 0.00 0.00 4.00
960 961 1.593265 CTGCAATGGGGAAAGGTGC 59.407 57.895 0.00 0.00 35.75 5.01
961 962 1.152376 TGCAATGGGGAAAGGTGCA 60.152 52.632 0.00 0.00 42.62 4.57
962 963 0.762082 TGCAATGGGGAAAGGTGCAA 60.762 50.000 0.00 0.00 41.95 4.08
963 964 0.037046 GCAATGGGGAAAGGTGCAAG 60.037 55.000 0.00 0.00 35.28 4.01
964 965 0.037046 CAATGGGGAAAGGTGCAAGC 60.037 55.000 0.00 0.00 0.00 4.01
965 966 1.194121 AATGGGGAAAGGTGCAAGCC 61.194 55.000 0.00 0.00 32.25 4.35
966 967 2.203625 GGGGAAAGGTGCAAGCCA 60.204 61.111 0.00 0.00 32.25 4.75
967 968 1.610379 GGGGAAAGGTGCAAGCCAT 60.610 57.895 0.00 0.00 32.25 4.40
968 969 1.593265 GGGAAAGGTGCAAGCCATG 59.407 57.895 0.00 0.00 32.25 3.66
969 970 0.899717 GGGAAAGGTGCAAGCCATGA 60.900 55.000 0.00 0.00 32.25 3.07
970 971 0.968405 GGAAAGGTGCAAGCCATGAA 59.032 50.000 0.00 0.00 32.25 2.57
971 972 1.337167 GGAAAGGTGCAAGCCATGAAC 60.337 52.381 0.00 0.00 36.78 3.18
972 973 1.615392 GAAAGGTGCAAGCCATGAACT 59.385 47.619 0.00 0.00 37.76 3.01
973 974 2.584835 AAGGTGCAAGCCATGAACTA 57.415 45.000 0.00 0.00 37.76 2.24
974 975 2.584835 AGGTGCAAGCCATGAACTAA 57.415 45.000 0.00 0.00 37.76 2.24
975 976 2.162681 AGGTGCAAGCCATGAACTAAC 58.837 47.619 0.00 0.00 37.76 2.34
976 977 2.162681 GGTGCAAGCCATGAACTAACT 58.837 47.619 0.00 0.00 37.76 2.24
977 978 2.095059 GGTGCAAGCCATGAACTAACTG 60.095 50.000 0.00 0.00 37.76 3.16
978 979 1.541147 TGCAAGCCATGAACTAACTGC 59.459 47.619 0.00 0.00 0.00 4.40
979 980 1.541147 GCAAGCCATGAACTAACTGCA 59.459 47.619 0.00 0.00 0.00 4.41
980 981 2.030007 GCAAGCCATGAACTAACTGCAA 60.030 45.455 0.00 0.00 0.00 4.08
981 982 3.568538 CAAGCCATGAACTAACTGCAAC 58.431 45.455 0.00 0.00 0.00 4.17
982 983 3.146104 AGCCATGAACTAACTGCAACT 57.854 42.857 0.00 0.00 0.00 3.16
983 984 3.077359 AGCCATGAACTAACTGCAACTC 58.923 45.455 0.00 0.00 0.00 3.01
984 985 3.077359 GCCATGAACTAACTGCAACTCT 58.923 45.455 0.00 0.00 0.00 3.24
985 986 3.503748 GCCATGAACTAACTGCAACTCTT 59.496 43.478 0.00 0.00 0.00 2.85
986 987 4.614535 GCCATGAACTAACTGCAACTCTTG 60.615 45.833 0.00 0.00 0.00 3.02
987 988 4.756642 CCATGAACTAACTGCAACTCTTGA 59.243 41.667 0.00 0.00 0.00 3.02
988 989 5.239306 CCATGAACTAACTGCAACTCTTGAA 59.761 40.000 0.00 0.00 0.00 2.69
989 990 5.734855 TGAACTAACTGCAACTCTTGAAC 57.265 39.130 0.00 0.00 0.00 3.18
990 991 4.270084 TGAACTAACTGCAACTCTTGAACG 59.730 41.667 0.00 0.00 0.00 3.95
991 992 4.054780 ACTAACTGCAACTCTTGAACGA 57.945 40.909 0.00 0.00 0.00 3.85
992 993 4.439057 ACTAACTGCAACTCTTGAACGAA 58.561 39.130 0.00 0.00 0.00 3.85
993 994 3.951979 AACTGCAACTCTTGAACGAAG 57.048 42.857 0.00 0.00 0.00 3.79
994 995 3.179443 ACTGCAACTCTTGAACGAAGA 57.821 42.857 0.00 0.00 38.45 2.87
995 996 2.866762 ACTGCAACTCTTGAACGAAGAC 59.133 45.455 0.00 0.00 35.64 3.01
996 997 2.210116 TGCAACTCTTGAACGAAGACC 58.790 47.619 0.00 0.00 35.64 3.85
997 998 2.210116 GCAACTCTTGAACGAAGACCA 58.790 47.619 0.00 0.00 35.64 4.02
998 999 2.032808 GCAACTCTTGAACGAAGACCAC 60.033 50.000 0.00 0.00 35.64 4.16
999 1000 2.528041 ACTCTTGAACGAAGACCACC 57.472 50.000 0.00 0.00 35.64 4.61
1000 1001 1.760613 ACTCTTGAACGAAGACCACCA 59.239 47.619 0.00 0.00 35.64 4.17
1001 1002 2.368875 ACTCTTGAACGAAGACCACCAT 59.631 45.455 0.00 0.00 35.64 3.55
1002 1003 2.738846 CTCTTGAACGAAGACCACCATG 59.261 50.000 0.00 0.00 35.64 3.66
1003 1004 1.806542 CTTGAACGAAGACCACCATGG 59.193 52.381 11.19 11.19 45.02 3.66
1004 1005 1.052617 TGAACGAAGACCACCATGGA 58.947 50.000 21.47 0.00 40.96 3.41
1005 1006 1.001974 TGAACGAAGACCACCATGGAG 59.998 52.381 21.47 11.19 40.96 3.86
1006 1007 0.321653 AACGAAGACCACCATGGAGC 60.322 55.000 21.47 4.23 40.96 4.70
1007 1008 1.296392 CGAAGACCACCATGGAGCA 59.704 57.895 21.47 0.00 40.96 4.26
1008 1009 0.742281 CGAAGACCACCATGGAGCAG 60.742 60.000 21.47 6.13 40.96 4.24
1009 1010 0.393537 GAAGACCACCATGGAGCAGG 60.394 60.000 21.47 16.30 40.96 4.85
1010 1011 2.439156 GACCACCATGGAGCAGGC 60.439 66.667 21.47 1.51 40.96 4.85
1011 1012 4.415150 ACCACCATGGAGCAGGCG 62.415 66.667 21.47 0.00 40.96 5.52
1012 1013 4.100084 CCACCATGGAGCAGGCGA 62.100 66.667 21.47 0.00 40.96 5.54
1013 1014 2.513204 CACCATGGAGCAGGCGAG 60.513 66.667 21.47 0.00 0.00 5.03
1014 1015 3.790437 ACCATGGAGCAGGCGAGG 61.790 66.667 21.47 0.00 0.00 4.63
1015 1016 3.473647 CCATGGAGCAGGCGAGGA 61.474 66.667 5.56 0.00 0.00 3.71
1016 1017 2.202987 CATGGAGCAGGCGAGGAC 60.203 66.667 0.00 0.00 0.00 3.85
1017 1018 3.842923 ATGGAGCAGGCGAGGACG 61.843 66.667 0.00 0.00 42.93 4.79
1025 1026 2.126031 GGCGAGGACGACCAAGAC 60.126 66.667 6.71 0.00 42.35 3.01
1026 1027 2.504244 GCGAGGACGACCAAGACG 60.504 66.667 6.71 7.46 42.66 4.18
1027 1028 2.504244 CGAGGACGACCAAGACGC 60.504 66.667 6.71 0.00 42.66 5.19
1028 1029 2.649034 GAGGACGACCAAGACGCA 59.351 61.111 6.71 0.00 38.94 5.24
1029 1030 1.444553 GAGGACGACCAAGACGCAG 60.445 63.158 6.71 0.00 38.94 5.18
1030 1031 1.863662 GAGGACGACCAAGACGCAGA 61.864 60.000 6.71 0.00 38.94 4.26
1031 1032 1.444553 GGACGACCAAGACGCAGAG 60.445 63.158 0.00 0.00 35.97 3.35
1032 1033 1.444553 GACGACCAAGACGCAGAGG 60.445 63.158 0.00 0.00 0.00 3.69
1033 1034 1.863662 GACGACCAAGACGCAGAGGA 61.864 60.000 0.00 0.00 0.00 3.71
1034 1035 1.444553 CGACCAAGACGCAGAGGAC 60.445 63.158 0.00 0.00 0.00 3.85
1035 1036 1.444553 GACCAAGACGCAGAGGACG 60.445 63.158 0.00 0.00 0.00 4.79
1036 1037 2.125912 CCAAGACGCAGAGGACGG 60.126 66.667 0.00 0.00 34.00 4.79
1037 1038 2.636412 CCAAGACGCAGAGGACGGA 61.636 63.158 0.00 0.00 34.00 4.69
1038 1039 1.289066 CAAGACGCAGAGGACGGAA 59.711 57.895 0.00 0.00 34.00 4.30
1039 1040 0.734253 CAAGACGCAGAGGACGGAAG 60.734 60.000 0.00 0.00 34.00 3.46
1040 1041 0.894184 AAGACGCAGAGGACGGAAGA 60.894 55.000 0.00 0.00 34.00 2.87
1041 1042 1.153997 GACGCAGAGGACGGAAGAC 60.154 63.158 0.00 0.00 34.00 3.01
1065 1066 4.838152 CACGAGGGTGGCGGGATG 62.838 72.222 0.00 0.00 40.58 3.51
1113 1114 2.356278 GCCATTGGCCTGACCTCA 59.644 61.111 17.28 0.00 44.06 3.86
1116 1117 1.746615 CATTGGCCTGACCTCACCG 60.747 63.158 3.32 0.00 40.22 4.94
1245 1246 2.488820 GCCGTCCACCTCGTAGAC 59.511 66.667 0.00 0.00 0.00 2.59
1281 1282 1.830477 GAGCTCTTCATGGACCTCAGT 59.170 52.381 6.43 0.00 0.00 3.41
1322 1323 1.881925 CGATGGCAAAAGGGTGAGTGA 60.882 52.381 0.00 0.00 0.00 3.41
1323 1324 1.815003 GATGGCAAAAGGGTGAGTGAG 59.185 52.381 0.00 0.00 0.00 3.51
1325 1326 0.954452 GGCAAAAGGGTGAGTGAGTG 59.046 55.000 0.00 0.00 0.00 3.51
1326 1327 0.312102 GCAAAAGGGTGAGTGAGTGC 59.688 55.000 0.00 0.00 0.00 4.40
1328 1329 2.810400 GCAAAAGGGTGAGTGAGTGCTA 60.810 50.000 0.00 0.00 0.00 3.49
1329 1330 3.070018 CAAAAGGGTGAGTGAGTGCTAG 58.930 50.000 0.00 0.00 0.00 3.42
1330 1331 2.310779 AAGGGTGAGTGAGTGCTAGA 57.689 50.000 0.00 0.00 0.00 2.43
1334 1335 3.196685 AGGGTGAGTGAGTGCTAGATTTC 59.803 47.826 0.00 0.00 0.00 2.17
1337 1338 4.429108 GTGAGTGAGTGCTAGATTTCCTC 58.571 47.826 0.00 0.00 0.00 3.71
1338 1339 3.129462 TGAGTGAGTGCTAGATTTCCTCG 59.871 47.826 0.00 0.00 0.00 4.63
1341 1342 1.065701 GAGTGCTAGATTTCCTCGCGA 59.934 52.381 9.26 9.26 36.46 5.87
1342 1343 1.201343 GTGCTAGATTTCCTCGCGAC 58.799 55.000 3.71 0.00 36.46 5.19
1351 1363 3.806316 TTTCCTCGCGACAAAAAGATC 57.194 42.857 3.71 0.00 0.00 2.75
1362 1374 5.569059 GCGACAAAAAGATCATCGATTTGTT 59.431 36.000 18.90 8.25 38.86 2.83
1363 1375 6.237045 GCGACAAAAAGATCATCGATTTGTTC 60.237 38.462 18.90 12.90 38.86 3.18
1367 1379 9.132521 ACAAAAAGATCATCGATTTGTTCAATC 57.867 29.630 14.55 0.00 37.00 2.67
1375 1387 7.521529 TCATCGATTTGTTCAATCTGTTTCTC 58.478 34.615 0.00 0.00 39.50 2.87
1376 1388 7.388776 TCATCGATTTGTTCAATCTGTTTCTCT 59.611 33.333 0.00 0.00 39.50 3.10
1380 1392 7.480855 CGATTTGTTCAATCTGTTTCTCTGATG 59.519 37.037 0.00 0.00 39.50 3.07
1385 1397 8.150296 TGTTCAATCTGTTTCTCTGATGAAGTA 58.850 33.333 0.00 0.00 35.44 2.24
1392 1407 7.121463 TCTGTTTCTCTGATGAAGTAGAGTACC 59.879 40.741 0.00 0.00 40.92 3.34
1396 1411 5.992829 TCTCTGATGAAGTAGAGTACCGATC 59.007 44.000 0.00 0.00 40.92 3.69
1411 1426 2.262572 CGATCGATCGGACATATGCA 57.737 50.000 34.54 0.00 45.93 3.96
1412 1427 2.802256 CGATCGATCGGACATATGCAT 58.198 47.619 34.54 3.79 45.93 3.96
1428 1445 4.682778 ATGCATGCATGGCTTCTAATTT 57.317 36.364 31.74 3.87 35.03 1.82
1430 1447 5.794726 TGCATGCATGGCTTCTAATTTAT 57.205 34.783 27.34 0.00 0.00 1.40
1431 1448 5.534407 TGCATGCATGGCTTCTAATTTATG 58.466 37.500 27.34 0.00 0.00 1.90
1432 1449 5.302313 TGCATGCATGGCTTCTAATTTATGA 59.698 36.000 27.34 0.00 0.00 2.15
1433 1450 5.632347 GCATGCATGGCTTCTAATTTATGAC 59.368 40.000 27.34 1.22 0.00 3.06
1443 1463 8.352942 GGCTTCTAATTTATGACCTGGTTAATG 58.647 37.037 0.00 0.00 0.00 1.90
1447 1467 9.104965 TCTAATTTATGACCTGGTTAATGTTCG 57.895 33.333 0.00 0.00 0.00 3.95
1474 1514 2.852495 TTTGGGCTCCAGCGATCGAC 62.852 60.000 21.57 10.46 43.26 4.20
1475 1515 3.532155 GGGCTCCAGCGATCGACT 61.532 66.667 21.57 12.79 43.26 4.18
1508 1548 2.215907 ACATGCTATCTGTGAGCGAC 57.784 50.000 0.00 0.00 43.19 5.19
1525 1565 1.076777 ACATGGGAATCGCTTGGGG 60.077 57.895 15.50 0.00 0.00 4.96
1530 1570 0.472471 GGGAATCGCTTGGGGTCATA 59.528 55.000 0.00 0.00 0.00 2.15
1546 1586 5.221541 GGGGTCATACAGATCTTTACTGGAG 60.222 48.000 0.00 0.00 39.38 3.86
1548 1588 6.239176 GGGTCATACAGATCTTTACTGGAGAG 60.239 46.154 0.00 0.00 39.38 3.20
1551 1591 7.284489 GTCATACAGATCTTTACTGGAGAGAGT 59.716 40.741 0.00 0.00 39.38 3.24
1552 1592 7.836685 TCATACAGATCTTTACTGGAGAGAGTT 59.163 37.037 0.00 0.00 39.38 3.01
1566 1606 0.898320 AGAGTTGTCGGACCCAGATG 59.102 55.000 5.55 0.00 0.00 2.90
1569 1609 1.003839 TTGTCGGACCCAGATGCAC 60.004 57.895 5.55 0.00 0.00 4.57
1581 1621 4.578928 ACCCAGATGCACGGTAATTAATTC 59.421 41.667 3.39 0.00 0.00 2.17
1582 1622 4.023193 CCCAGATGCACGGTAATTAATTCC 60.023 45.833 3.39 5.42 0.00 3.01
1583 1623 4.023193 CCAGATGCACGGTAATTAATTCCC 60.023 45.833 3.39 1.37 0.00 3.97
1584 1624 4.578516 CAGATGCACGGTAATTAATTCCCA 59.421 41.667 10.13 4.41 0.00 4.37
1587 1627 7.121168 CAGATGCACGGTAATTAATTCCCATAT 59.879 37.037 10.13 4.21 0.00 1.78
1588 1628 8.325787 AGATGCACGGTAATTAATTCCCATATA 58.674 33.333 10.13 0.00 0.00 0.86
1589 1629 7.675962 TGCACGGTAATTAATTCCCATATAC 57.324 36.000 10.13 0.00 0.00 1.47
1592 1632 9.609346 GCACGGTAATTAATTCCCATATACTAT 57.391 33.333 10.13 0.00 0.00 2.12
1606 1646 7.465900 CCATATACTATACCATGGGGGATTT 57.534 40.000 18.09 0.00 39.10 2.17
1607 1647 7.290061 CCATATACTATACCATGGGGGATTTG 58.710 42.308 18.09 10.01 39.10 2.32
1608 1648 7.128728 CCATATACTATACCATGGGGGATTTGA 59.871 40.741 18.09 0.00 39.10 2.69
1609 1649 8.727149 CATATACTATACCATGGGGGATTTGAT 58.273 37.037 18.09 2.35 39.10 2.57
1610 1650 5.520748 ACTATACCATGGGGGATTTGATC 57.479 43.478 18.09 0.00 39.10 2.92
1611 1651 4.919510 ACTATACCATGGGGGATTTGATCA 59.080 41.667 18.09 0.00 39.10 2.92
1612 1652 5.557138 ACTATACCATGGGGGATTTGATCAT 59.443 40.000 18.09 0.00 39.10 2.45
1613 1653 3.711937 ACCATGGGGGATTTGATCATT 57.288 42.857 18.09 0.00 41.15 2.57
1614 1654 4.011591 ACCATGGGGGATTTGATCATTT 57.988 40.909 18.09 0.00 41.15 2.32
1615 1655 3.712733 ACCATGGGGGATTTGATCATTTG 59.287 43.478 18.09 0.00 41.15 2.32
1616 1656 3.495453 CCATGGGGGATTTGATCATTTGC 60.495 47.826 2.85 0.00 40.01 3.68
1617 1657 2.117865 TGGGGGATTTGATCATTTGCC 58.882 47.619 0.00 1.58 0.00 4.52
1618 1658 1.417517 GGGGGATTTGATCATTTGCCC 59.582 52.381 20.55 20.55 0.00 5.36
1619 1659 1.417517 GGGGATTTGATCATTTGCCCC 59.582 52.381 20.30 20.30 46.15 5.80
1620 1660 1.417517 GGGATTTGATCATTTGCCCCC 59.582 52.381 0.00 0.00 0.00 5.40
1621 1661 2.117865 GGATTTGATCATTTGCCCCCA 58.882 47.619 0.00 0.00 0.00 4.96
1622 1662 2.158914 GGATTTGATCATTTGCCCCCAC 60.159 50.000 0.00 0.00 0.00 4.61
1623 1663 2.323999 TTTGATCATTTGCCCCCACT 57.676 45.000 0.00 0.00 0.00 4.00
1624 1664 2.323999 TTGATCATTTGCCCCCACTT 57.676 45.000 0.00 0.00 0.00 3.16
1625 1665 2.323999 TGATCATTTGCCCCCACTTT 57.676 45.000 0.00 0.00 0.00 2.66
1626 1666 3.464720 TGATCATTTGCCCCCACTTTA 57.535 42.857 0.00 0.00 0.00 1.85
1627 1667 3.096092 TGATCATTTGCCCCCACTTTAC 58.904 45.455 0.00 0.00 0.00 2.01
1628 1668 1.540267 TCATTTGCCCCCACTTTACG 58.460 50.000 0.00 0.00 0.00 3.18
1629 1669 1.202952 TCATTTGCCCCCACTTTACGT 60.203 47.619 0.00 0.00 0.00 3.57
1630 1670 1.616374 CATTTGCCCCCACTTTACGTT 59.384 47.619 0.00 0.00 0.00 3.99
1631 1671 1.033574 TTTGCCCCCACTTTACGTTG 58.966 50.000 0.00 0.00 0.00 4.10
1632 1672 1.457009 TTGCCCCCACTTTACGTTGC 61.457 55.000 0.00 0.00 0.00 4.17
1633 1673 1.899534 GCCCCCACTTTACGTTGCA 60.900 57.895 0.00 0.00 0.00 4.08
1634 1674 1.953772 CCCCCACTTTACGTTGCAC 59.046 57.895 0.00 0.00 0.00 4.57
1635 1675 0.536460 CCCCCACTTTACGTTGCACT 60.536 55.000 0.00 0.00 0.00 4.40
1636 1676 1.314730 CCCCACTTTACGTTGCACTT 58.685 50.000 0.00 0.00 0.00 3.16
1637 1677 1.679153 CCCCACTTTACGTTGCACTTT 59.321 47.619 0.00 0.00 0.00 2.66
1638 1678 2.542824 CCCCACTTTACGTTGCACTTTG 60.543 50.000 0.00 0.00 0.00 2.77
1639 1679 2.356382 CCCACTTTACGTTGCACTTTGA 59.644 45.455 0.00 0.00 0.00 2.69
1640 1680 3.004315 CCCACTTTACGTTGCACTTTGAT 59.996 43.478 0.00 0.00 0.00 2.57
1641 1681 4.214545 CCCACTTTACGTTGCACTTTGATA 59.785 41.667 0.00 0.00 0.00 2.15
1642 1682 5.382303 CCACTTTACGTTGCACTTTGATAG 58.618 41.667 0.00 0.00 0.00 2.08
1643 1683 5.049680 CCACTTTACGTTGCACTTTGATAGT 60.050 40.000 0.00 0.00 37.68 2.12
1644 1684 6.146510 CCACTTTACGTTGCACTTTGATAGTA 59.853 38.462 0.00 0.00 34.56 1.82
1645 1685 7.007697 CACTTTACGTTGCACTTTGATAGTAC 58.992 38.462 0.00 0.00 34.56 2.73
1646 1686 6.927381 ACTTTACGTTGCACTTTGATAGTACT 59.073 34.615 0.00 0.00 34.56 2.73
1647 1687 6.699895 TTACGTTGCACTTTGATAGTACTG 57.300 37.500 5.39 0.00 34.56 2.74
1648 1688 4.628074 ACGTTGCACTTTGATAGTACTGT 58.372 39.130 5.39 0.00 34.56 3.55
1649 1689 5.775686 ACGTTGCACTTTGATAGTACTGTA 58.224 37.500 5.39 0.00 34.56 2.74
1650 1690 5.632347 ACGTTGCACTTTGATAGTACTGTAC 59.368 40.000 9.93 9.93 34.56 2.90
1651 1691 5.862323 CGTTGCACTTTGATAGTACTGTACT 59.138 40.000 22.72 22.72 42.68 2.73
1652 1692 7.025365 CGTTGCACTTTGATAGTACTGTACTA 58.975 38.462 25.19 25.19 44.64 1.82
1653 1693 7.008086 CGTTGCACTTTGATAGTACTGTACTAC 59.992 40.741 25.42 19.38 43.46 2.73
1654 1694 6.860080 TGCACTTTGATAGTACTGTACTACC 58.140 40.000 25.42 18.84 43.46 3.18
1655 1695 6.662234 TGCACTTTGATAGTACTGTACTACCT 59.338 38.462 25.42 13.82 43.46 3.08
1656 1696 7.148120 TGCACTTTGATAGTACTGTACTACCTC 60.148 40.741 25.42 20.41 43.46 3.85
1657 1697 7.067251 GCACTTTGATAGTACTGTACTACCTCT 59.933 40.741 25.42 12.85 43.46 3.69
1658 1698 8.614346 CACTTTGATAGTACTGTACTACCTCTC 58.386 40.741 25.42 19.55 43.46 3.20
1659 1699 8.327271 ACTTTGATAGTACTGTACTACCTCTCA 58.673 37.037 25.42 21.42 43.46 3.27
1662 1702 9.775854 TTGATAGTACTGTACTACCTCTCATAC 57.224 37.037 25.42 11.43 43.46 2.39
1667 1707 9.947433 AGTACTGTACTACCTCTCATACATATC 57.053 37.037 18.42 0.00 37.23 1.63
1671 1711 7.104290 TGTACTACCTCTCATACATATCTCGG 58.896 42.308 0.00 0.00 0.00 4.63
1672 1712 6.375830 ACTACCTCTCATACATATCTCGGA 57.624 41.667 0.00 0.00 0.00 4.55
1673 1713 6.780901 ACTACCTCTCATACATATCTCGGAA 58.219 40.000 0.00 0.00 0.00 4.30
1675 1715 7.891183 ACTACCTCTCATACATATCTCGGAAAT 59.109 37.037 0.00 0.00 0.00 2.17
1678 1718 6.312426 CCTCTCATACATATCTCGGAAATTGC 59.688 42.308 0.00 0.00 0.00 3.56
1685 1725 7.807977 ACATATCTCGGAAATTGCATTACTT 57.192 32.000 0.00 0.00 0.00 2.24
1686 1726 7.642669 ACATATCTCGGAAATTGCATTACTTG 58.357 34.615 0.00 0.00 0.00 3.16
1687 1727 7.283127 ACATATCTCGGAAATTGCATTACTTGT 59.717 33.333 0.00 0.00 0.00 3.16
1688 1728 8.773645 CATATCTCGGAAATTGCATTACTTGTA 58.226 33.333 0.00 0.00 0.00 2.41
1690 1730 5.935206 TCTCGGAAATTGCATTACTTGTACA 59.065 36.000 0.00 0.00 0.00 2.90
1693 1733 5.799936 CGGAAATTGCATTACTTGTACAAGG 59.200 40.000 33.11 19.46 42.53 3.61
1696 1736 8.301002 GGAAATTGCATTACTTGTACAAGGTTA 58.699 33.333 33.11 20.48 42.53 2.85
1697 1737 9.685828 GAAATTGCATTACTTGTACAAGGTTAA 57.314 29.630 33.11 24.34 42.53 2.01
1700 1740 9.638239 ATTGCATTACTTGTACAAGGTTAATTG 57.362 29.630 33.11 22.25 42.53 2.32
1701 1741 7.087639 TGCATTACTTGTACAAGGTTAATTGC 58.912 34.615 33.11 28.29 42.53 3.56
1702 1742 6.530181 GCATTACTTGTACAAGGTTAATTGCC 59.470 38.462 33.11 17.04 42.53 4.52
1703 1743 7.576856 GCATTACTTGTACAAGGTTAATTGCCT 60.577 37.037 33.11 14.86 42.53 4.75
1704 1744 7.826918 TTACTTGTACAAGGTTAATTGCCTT 57.173 32.000 33.11 14.41 46.39 4.35
1711 1751 4.600692 AAGGTTAATTGCCTTGTGTTCC 57.399 40.909 13.27 0.00 44.01 3.62
1712 1752 3.844640 AGGTTAATTGCCTTGTGTTCCT 58.155 40.909 0.00 0.00 31.04 3.36
1713 1753 4.223144 AGGTTAATTGCCTTGTGTTCCTT 58.777 39.130 0.00 0.00 31.04 3.36
1714 1754 4.653801 AGGTTAATTGCCTTGTGTTCCTTT 59.346 37.500 0.00 0.00 31.04 3.11
1715 1755 5.836358 AGGTTAATTGCCTTGTGTTCCTTTA 59.164 36.000 0.00 0.00 31.04 1.85
1717 1757 7.016170 AGGTTAATTGCCTTGTGTTCCTTTAAT 59.984 33.333 0.00 0.00 31.04 1.40
1723 1875 9.791801 ATTGCCTTGTGTTCCTTTAATTAAATT 57.208 25.926 10.97 0.00 0.00 1.82
1732 1884 9.171701 TGTTCCTTTAATTAAATTTGTTCGACG 57.828 29.630 10.97 0.00 0.00 5.12
1741 1893 9.620660 AATTAAATTTGTTCGACGATTAAGCTT 57.379 25.926 3.48 3.48 0.00 3.74
1743 1895 9.749490 TTAAATTTGTTCGACGATTAAGCTTAG 57.251 29.630 6.24 0.00 0.00 2.18
1744 1896 5.773239 TTTGTTCGACGATTAAGCTTAGG 57.227 39.130 6.24 3.28 0.00 2.69
1762 1920 1.376553 GTCCAAGGTGGCAGAGCTC 60.377 63.158 5.27 5.27 37.47 4.09
1763 1921 2.435586 CCAAGGTGGCAGAGCTCG 60.436 66.667 8.37 4.60 0.00 5.03
1765 1923 2.031516 CAAGGTGGCAGAGCTCGTG 61.032 63.158 8.37 8.35 0.00 4.35
1771 1929 1.735920 GGCAGAGCTCGTGTCAGTG 60.736 63.158 8.37 0.00 0.00 3.66
1780 1938 2.601398 CGTGTCAGTGTGCTGGCTG 61.601 63.158 0.93 0.00 46.84 4.85
1781 1939 2.111669 TGTCAGTGTGCTGGCTGG 59.888 61.111 0.93 0.00 46.84 4.85
1782 1940 2.670934 GTCAGTGTGCTGGCTGGG 60.671 66.667 0.00 0.00 43.60 4.45
1784 1942 4.655647 CAGTGTGCTGGCTGGGCT 62.656 66.667 0.00 0.00 39.01 5.19
1786 1944 3.677648 GTGTGCTGGCTGGGCTTG 61.678 66.667 0.00 0.00 0.00 4.01
1788 1946 3.368571 GTGCTGGCTGGGCTTGTC 61.369 66.667 0.00 0.00 0.00 3.18
1789 1947 3.573229 TGCTGGCTGGGCTTGTCT 61.573 61.111 0.00 0.00 0.00 3.41
1800 1958 1.372087 GGCTTGTCTGGCCGAATCAG 61.372 60.000 0.00 0.00 40.19 2.90
1804 1962 1.078848 GTCTGGCCGAATCAGCAGT 60.079 57.895 0.00 0.00 32.63 4.40
1806 1964 0.901827 TCTGGCCGAATCAGCAGTAA 59.098 50.000 0.00 0.00 32.63 2.24
1814 1972 2.100584 CGAATCAGCAGTAAGGAGCTCT 59.899 50.000 14.64 0.00 39.50 4.09
1816 1974 2.222227 TCAGCAGTAAGGAGCTCTCA 57.778 50.000 14.64 0.00 39.50 3.27
1821 1979 1.480137 CAGTAAGGAGCTCTCACCAGG 59.520 57.143 14.64 0.00 0.00 4.45
1834 1992 4.015406 CCAGGCACCCACTACGCA 62.015 66.667 0.00 0.00 0.00 5.24
1836 1994 3.706373 AGGCACCCACTACGCAGG 61.706 66.667 0.00 0.00 0.00 4.85
1858 2016 1.040646 ACCTCGTCTTCAAGCTCACA 58.959 50.000 0.00 0.00 0.00 3.58
1861 2019 1.789464 CTCGTCTTCAAGCTCACACAC 59.211 52.381 0.00 0.00 0.00 3.82
1864 2022 1.523095 GTCTTCAAGCTCACACACGAC 59.477 52.381 0.00 0.00 0.00 4.34
1868 2026 4.664677 AGCTCACACACGACGCCC 62.665 66.667 0.00 0.00 0.00 6.13
1869 2027 4.961511 GCTCACACACGACGCCCA 62.962 66.667 0.00 0.00 0.00 5.36
1870 2028 3.036084 CTCACACACGACGCCCAC 61.036 66.667 0.00 0.00 0.00 4.61
1899 2057 2.124901 CCCGCGCCAGGTTTCATA 60.125 61.111 0.00 0.00 0.00 2.15
1900 2058 1.525995 CCCGCGCCAGGTTTCATAT 60.526 57.895 0.00 0.00 0.00 1.78
1903 2061 0.732571 CGCGCCAGGTTTCATATGTT 59.267 50.000 0.00 0.00 0.00 2.71
1904 2062 1.531677 CGCGCCAGGTTTCATATGTTG 60.532 52.381 0.00 0.00 0.00 3.33
1911 2069 5.629133 GCCAGGTTTCATATGTTGAGGTAGA 60.629 44.000 1.90 0.00 35.27 2.59
1912 2070 5.817816 CCAGGTTTCATATGTTGAGGTAGAC 59.182 44.000 1.90 0.00 35.27 2.59
1916 2074 2.364324 TCATATGTTGAGGTAGACGGCC 59.636 50.000 1.90 0.00 0.00 6.13
1917 2075 1.855295 TATGTTGAGGTAGACGGCCA 58.145 50.000 2.24 0.00 0.00 5.36
1919 2077 1.218316 GTTGAGGTAGACGGCCAGG 59.782 63.158 2.24 0.00 0.00 4.45
1920 2078 1.229082 TTGAGGTAGACGGCCAGGT 60.229 57.895 2.24 0.00 0.00 4.00
1922 2080 2.683933 AGGTAGACGGCCAGGTGG 60.684 66.667 2.24 0.00 38.53 4.61
1923 2081 3.001406 GGTAGACGGCCAGGTGGT 61.001 66.667 2.24 0.00 37.57 4.16
1924 2082 2.264794 GTAGACGGCCAGGTGGTG 59.735 66.667 2.24 0.00 37.57 4.17
2020 2238 4.500116 GAGCACGCGGAGGAGGAC 62.500 72.222 12.47 0.00 0.00 3.85
2029 2247 3.217743 GAGGAGGACGGCGTAGGG 61.218 72.222 14.74 0.00 0.00 3.53
2047 2265 2.682494 GGCGTCAGGAGGTACCCA 60.682 66.667 8.74 0.00 40.05 4.51
2048 2266 2.288025 GGCGTCAGGAGGTACCCAA 61.288 63.158 8.74 0.00 40.05 4.12
2053 2271 0.474854 TCAGGAGGTACCCAAGGCAA 60.475 55.000 8.74 0.00 40.05 4.52
2058 2276 2.751688 GTACCCAAGGCAACGGGA 59.248 61.111 12.31 0.00 46.34 5.14
2074 2292 4.436998 GACGACGGGTGGCTGGAG 62.437 72.222 0.00 0.00 0.00 3.86
2083 2301 1.451028 GTGGCTGGAGCTGGTGATC 60.451 63.158 0.00 0.00 41.70 2.92
2091 2309 4.750460 GCTGGTGATCGGCGATTA 57.250 55.556 24.81 17.74 38.09 1.75
2098 2316 0.533032 TGATCGGCGATTACCACACA 59.467 50.000 24.81 12.30 0.00 3.72
2100 2318 0.179084 ATCGGCGATTACCACACAGG 60.179 55.000 18.14 0.00 45.67 4.00
2104 2322 0.953471 GCGATTACCACACAGGCACA 60.953 55.000 0.00 0.00 43.14 4.57
2109 2336 1.051556 TACCACACAGGCACAGGTGA 61.052 55.000 3.10 0.00 43.14 4.02
2110 2337 1.073722 CCACACAGGCACAGGTGAT 59.926 57.895 3.10 0.00 38.84 3.06
2118 2345 1.562942 AGGCACAGGTGATGATGATGT 59.437 47.619 3.10 0.00 0.00 3.06
2119 2346 2.773661 AGGCACAGGTGATGATGATGTA 59.226 45.455 3.10 0.00 0.00 2.29
2120 2347 3.136763 GGCACAGGTGATGATGATGTAG 58.863 50.000 3.10 0.00 0.00 2.74
2121 2348 3.136763 GCACAGGTGATGATGATGTAGG 58.863 50.000 3.10 0.00 0.00 3.18
2122 2349 3.181462 GCACAGGTGATGATGATGTAGGA 60.181 47.826 3.10 0.00 0.00 2.94
2123 2350 4.629092 CACAGGTGATGATGATGTAGGAG 58.371 47.826 0.00 0.00 0.00 3.69
2124 2351 3.070734 ACAGGTGATGATGATGTAGGAGC 59.929 47.826 0.00 0.00 0.00 4.70
2125 2352 3.070590 CAGGTGATGATGATGTAGGAGCA 59.929 47.826 0.00 0.00 0.00 4.26
2126 2353 3.324268 AGGTGATGATGATGTAGGAGCAG 59.676 47.826 0.00 0.00 0.00 4.24
2127 2354 3.323115 GGTGATGATGATGTAGGAGCAGA 59.677 47.826 0.00 0.00 0.00 4.26
2128 2355 4.020396 GGTGATGATGATGTAGGAGCAGAT 60.020 45.833 0.00 0.00 0.00 2.90
2129 2356 5.186603 GGTGATGATGATGTAGGAGCAGATA 59.813 44.000 0.00 0.00 0.00 1.98
2133 2360 9.039165 TGATGATGATGTAGGAGCAGATATTAA 57.961 33.333 0.00 0.00 0.00 1.40
2141 2368 7.671302 TGTAGGAGCAGATATTAAGATGGAAC 58.329 38.462 0.00 0.00 0.00 3.62
2176 2403 0.695347 AGCTCAAGTGGAAGAAGGGG 59.305 55.000 0.00 0.00 0.00 4.79
2186 2413 1.202867 GGAAGAAGGGGCTCATCATCC 60.203 57.143 0.00 0.00 0.00 3.51
2188 2415 1.138568 AGAAGGGGCTCATCATCCAG 58.861 55.000 0.00 0.00 0.00 3.86
2193 2420 0.179006 GGGCTCATCATCCAGGGAAC 60.179 60.000 0.00 0.00 0.00 3.62
2208 2435 0.611714 GGAACCGAGTTCAGGCCTAA 59.388 55.000 3.98 0.00 43.54 2.69
2209 2436 1.002773 GGAACCGAGTTCAGGCCTAAA 59.997 52.381 3.98 0.00 43.54 1.85
2210 2437 2.074576 GAACCGAGTTCAGGCCTAAAC 58.925 52.381 11.21 11.21 41.62 2.01
2211 2438 1.053424 ACCGAGTTCAGGCCTAAACA 58.947 50.000 21.23 0.00 0.00 2.83
2212 2439 1.418637 ACCGAGTTCAGGCCTAAACAA 59.581 47.619 21.23 1.53 0.00 2.83
2213 2440 2.076863 CCGAGTTCAGGCCTAAACAAG 58.923 52.381 21.23 13.21 0.00 3.16
2214 2441 1.464997 CGAGTTCAGGCCTAAACAAGC 59.535 52.381 21.23 8.66 0.00 4.01
2215 2442 2.784347 GAGTTCAGGCCTAAACAAGCT 58.216 47.619 21.23 0.00 0.00 3.74
2216 2443 3.149981 GAGTTCAGGCCTAAACAAGCTT 58.850 45.455 21.23 0.00 0.00 3.74
2217 2444 4.324267 GAGTTCAGGCCTAAACAAGCTTA 58.676 43.478 21.23 0.00 0.00 3.09
2218 2445 4.327680 AGTTCAGGCCTAAACAAGCTTAG 58.672 43.478 21.23 0.00 0.00 2.18
2219 2446 4.072839 GTTCAGGCCTAAACAAGCTTAGT 58.927 43.478 14.39 0.00 0.00 2.24
2220 2447 4.367039 TCAGGCCTAAACAAGCTTAGTT 57.633 40.909 3.98 3.47 0.00 2.24
2221 2448 4.324267 TCAGGCCTAAACAAGCTTAGTTC 58.676 43.478 3.98 0.00 0.00 3.01
2222 2449 4.072131 CAGGCCTAAACAAGCTTAGTTCA 58.928 43.478 3.98 0.00 0.00 3.18
2223 2450 4.702131 CAGGCCTAAACAAGCTTAGTTCAT 59.298 41.667 3.98 0.00 0.00 2.57
2224 2451 5.183904 CAGGCCTAAACAAGCTTAGTTCATT 59.816 40.000 3.98 0.00 0.00 2.57
2225 2452 5.775195 AGGCCTAAACAAGCTTAGTTCATTT 59.225 36.000 1.29 0.00 0.00 2.32
2226 2453 6.946009 AGGCCTAAACAAGCTTAGTTCATTTA 59.054 34.615 1.29 0.00 0.00 1.40
2227 2454 7.615757 AGGCCTAAACAAGCTTAGTTCATTTAT 59.384 33.333 1.29 0.00 0.00 1.40
2228 2455 7.915923 GGCCTAAACAAGCTTAGTTCATTTATC 59.084 37.037 0.00 0.00 0.00 1.75
2229 2456 8.458843 GCCTAAACAAGCTTAGTTCATTTATCA 58.541 33.333 0.00 0.00 0.00 2.15
2235 2462 9.632638 ACAAGCTTAGTTCATTTATCATATGGT 57.367 29.630 0.00 0.00 0.00 3.55
2250 2477 9.739276 TTATCATATGGTAATCAAATCTCCACC 57.261 33.333 4.23 0.00 0.00 4.61
2251 2478 6.230472 TCATATGGTAATCAAATCTCCACCG 58.770 40.000 2.13 0.00 0.00 4.94
2252 2479 3.992943 TGGTAATCAAATCTCCACCGT 57.007 42.857 0.00 0.00 0.00 4.83
2253 2480 3.605634 TGGTAATCAAATCTCCACCGTG 58.394 45.455 0.00 0.00 0.00 4.94
2254 2481 3.008594 TGGTAATCAAATCTCCACCGTGT 59.991 43.478 0.00 0.00 0.00 4.49
2255 2482 3.374058 GGTAATCAAATCTCCACCGTGTG 59.626 47.826 0.00 0.00 0.00 3.82
2266 2493 2.010145 CACCGTGTGGAATGGAGTAG 57.990 55.000 0.00 0.00 38.47 2.57
2267 2494 0.249398 ACCGTGTGGAATGGAGTAGC 59.751 55.000 0.00 0.00 38.47 3.58
2268 2495 0.537188 CCGTGTGGAATGGAGTAGCT 59.463 55.000 0.00 0.00 37.06 3.32
2269 2496 1.066143 CCGTGTGGAATGGAGTAGCTT 60.066 52.381 0.00 0.00 37.06 3.74
2270 2497 2.271800 CGTGTGGAATGGAGTAGCTTC 58.728 52.381 0.00 0.00 0.00 3.86
2271 2498 2.093973 CGTGTGGAATGGAGTAGCTTCT 60.094 50.000 0.00 0.00 0.00 2.85
2272 2499 3.617531 CGTGTGGAATGGAGTAGCTTCTT 60.618 47.826 0.00 0.00 0.00 2.52
2273 2500 4.381612 CGTGTGGAATGGAGTAGCTTCTTA 60.382 45.833 0.00 0.00 0.00 2.10
2274 2501 5.675538 GTGTGGAATGGAGTAGCTTCTTAT 58.324 41.667 0.00 0.00 0.00 1.73
2275 2502 5.755861 GTGTGGAATGGAGTAGCTTCTTATC 59.244 44.000 0.00 0.00 0.00 1.75
2276 2503 5.663106 TGTGGAATGGAGTAGCTTCTTATCT 59.337 40.000 0.00 0.00 0.00 1.98
2277 2504 6.156949 TGTGGAATGGAGTAGCTTCTTATCTT 59.843 38.462 0.00 0.00 0.00 2.40
2278 2505 7.344612 TGTGGAATGGAGTAGCTTCTTATCTTA 59.655 37.037 0.00 0.00 0.00 2.10
2279 2506 7.654116 GTGGAATGGAGTAGCTTCTTATCTTAC 59.346 40.741 0.00 0.00 0.00 2.34
2280 2507 7.344612 TGGAATGGAGTAGCTTCTTATCTTACA 59.655 37.037 0.00 0.00 0.00 2.41
2281 2508 7.654116 GGAATGGAGTAGCTTCTTATCTTACAC 59.346 40.741 0.00 0.00 0.00 2.90
2282 2509 7.906199 ATGGAGTAGCTTCTTATCTTACACT 57.094 36.000 0.00 0.00 0.00 3.55
2283 2510 8.998277 ATGGAGTAGCTTCTTATCTTACACTA 57.002 34.615 0.00 0.00 0.00 2.74
2284 2511 8.818622 TGGAGTAGCTTCTTATCTTACACTAA 57.181 34.615 0.00 0.00 0.00 2.24
2285 2512 9.251440 TGGAGTAGCTTCTTATCTTACACTAAA 57.749 33.333 0.00 0.00 0.00 1.85
2286 2513 9.738832 GGAGTAGCTTCTTATCTTACACTAAAG 57.261 37.037 0.00 0.00 0.00 1.85
2303 2530 8.706322 ACACTAAAGAAATAATTTGGGTCAGT 57.294 30.769 0.00 0.00 0.00 3.41
2304 2531 8.793592 ACACTAAAGAAATAATTTGGGTCAGTC 58.206 33.333 0.00 0.00 0.00 3.51
2305 2532 9.014297 CACTAAAGAAATAATTTGGGTCAGTCT 57.986 33.333 0.00 0.00 0.00 3.24
2311 2538 9.533831 AGAAATAATTTGGGTCAGTCTAAATGT 57.466 29.630 0.00 0.00 0.00 2.71
2312 2539 9.788960 GAAATAATTTGGGTCAGTCTAAATGTC 57.211 33.333 0.00 0.00 0.00 3.06
2313 2540 7.881775 ATAATTTGGGTCAGTCTAAATGTCC 57.118 36.000 0.00 0.00 0.00 4.02
2314 2541 4.715534 TTTGGGTCAGTCTAAATGTCCA 57.284 40.909 0.00 0.00 0.00 4.02
2315 2542 3.981071 TGGGTCAGTCTAAATGTCCAG 57.019 47.619 0.00 0.00 0.00 3.86
2316 2543 2.027192 TGGGTCAGTCTAAATGTCCAGC 60.027 50.000 0.00 0.00 0.00 4.85
2317 2544 2.271800 GGTCAGTCTAAATGTCCAGCG 58.728 52.381 0.00 0.00 0.00 5.18
2318 2545 2.094182 GGTCAGTCTAAATGTCCAGCGA 60.094 50.000 0.00 0.00 0.00 4.93
2319 2546 3.182967 GTCAGTCTAAATGTCCAGCGAG 58.817 50.000 0.00 0.00 0.00 5.03
2320 2547 1.929836 CAGTCTAAATGTCCAGCGAGC 59.070 52.381 0.00 0.00 0.00 5.03
2321 2548 1.550524 AGTCTAAATGTCCAGCGAGCA 59.449 47.619 0.00 0.00 0.00 4.26
2322 2549 2.028112 AGTCTAAATGTCCAGCGAGCAA 60.028 45.455 0.00 0.00 0.00 3.91
2323 2550 2.939103 GTCTAAATGTCCAGCGAGCAAT 59.061 45.455 0.00 0.00 0.00 3.56
2324 2551 4.119862 GTCTAAATGTCCAGCGAGCAATA 58.880 43.478 0.00 0.00 0.00 1.90
2325 2552 4.752101 GTCTAAATGTCCAGCGAGCAATAT 59.248 41.667 0.00 0.00 0.00 1.28
2326 2553 5.926542 GTCTAAATGTCCAGCGAGCAATATA 59.073 40.000 0.00 0.00 0.00 0.86
2327 2554 6.591834 GTCTAAATGTCCAGCGAGCAATATAT 59.408 38.462 0.00 0.00 0.00 0.86
2328 2555 7.118390 GTCTAAATGTCCAGCGAGCAATATATT 59.882 37.037 0.00 0.00 0.00 1.28
2329 2556 6.639632 AAATGTCCAGCGAGCAATATATTT 57.360 33.333 0.00 0.00 0.00 1.40
2330 2557 5.618056 ATGTCCAGCGAGCAATATATTTG 57.382 39.130 0.00 0.00 0.00 2.32
2331 2558 4.702831 TGTCCAGCGAGCAATATATTTGA 58.297 39.130 0.00 0.00 0.00 2.69
2332 2559 5.308014 TGTCCAGCGAGCAATATATTTGAT 58.692 37.500 0.00 0.00 0.00 2.57
2333 2560 6.463360 TGTCCAGCGAGCAATATATTTGATA 58.537 36.000 0.00 0.00 0.00 2.15
2334 2561 6.591448 TGTCCAGCGAGCAATATATTTGATAG 59.409 38.462 0.00 0.00 0.00 2.08
2335 2562 5.582269 TCCAGCGAGCAATATATTTGATAGC 59.418 40.000 10.56 10.56 36.85 2.97
2336 2563 5.220739 CCAGCGAGCAATATATTTGATAGCC 60.221 44.000 13.13 1.62 37.19 3.93
2337 2564 4.878397 AGCGAGCAATATATTTGATAGCCC 59.122 41.667 13.13 0.00 37.19 5.19
2338 2565 4.878397 GCGAGCAATATATTTGATAGCCCT 59.122 41.667 0.00 0.00 31.84 5.19
2339 2566 5.355350 GCGAGCAATATATTTGATAGCCCTT 59.645 40.000 0.00 0.00 31.84 3.95
2340 2567 6.457528 GCGAGCAATATATTTGATAGCCCTTC 60.458 42.308 0.00 0.00 31.84 3.46
2341 2568 6.595326 CGAGCAATATATTTGATAGCCCTTCA 59.405 38.462 0.00 0.00 0.00 3.02
2342 2569 7.201591 CGAGCAATATATTTGATAGCCCTTCAG 60.202 40.741 0.00 0.00 0.00 3.02
2343 2570 7.693132 AGCAATATATTTGATAGCCCTTCAGA 58.307 34.615 0.00 0.00 0.00 3.27
2344 2571 7.609532 AGCAATATATTTGATAGCCCTTCAGAC 59.390 37.037 0.00 0.00 0.00 3.51
2345 2572 7.413438 GCAATATATTTGATAGCCCTTCAGACG 60.413 40.741 0.00 0.00 0.00 4.18
2346 2573 3.914426 ATTTGATAGCCCTTCAGACGT 57.086 42.857 0.00 0.00 0.00 4.34
2347 2574 3.695830 TTTGATAGCCCTTCAGACGTT 57.304 42.857 0.00 0.00 0.00 3.99
2348 2575 4.811969 TTTGATAGCCCTTCAGACGTTA 57.188 40.909 0.00 0.00 0.00 3.18
2349 2576 4.811969 TTGATAGCCCTTCAGACGTTAA 57.188 40.909 0.00 0.00 0.00 2.01
2350 2577 4.119442 TGATAGCCCTTCAGACGTTAAC 57.881 45.455 0.00 0.00 0.00 2.01
2351 2578 3.767673 TGATAGCCCTTCAGACGTTAACT 59.232 43.478 3.71 0.00 0.00 2.24
2352 2579 2.457366 AGCCCTTCAGACGTTAACTG 57.543 50.000 3.71 0.00 36.80 3.16
2353 2580 1.692519 AGCCCTTCAGACGTTAACTGT 59.307 47.619 3.71 3.49 36.81 3.55
2354 2581 2.067013 GCCCTTCAGACGTTAACTGTC 58.933 52.381 17.34 17.34 36.81 3.51
2355 2582 2.547218 GCCCTTCAGACGTTAACTGTCA 60.547 50.000 23.14 8.84 38.83 3.58
2356 2583 3.864921 GCCCTTCAGACGTTAACTGTCAT 60.865 47.826 23.14 11.80 38.83 3.06
2357 2584 3.679980 CCCTTCAGACGTTAACTGTCATG 59.320 47.826 23.14 18.80 38.83 3.07
2358 2585 4.307432 CCTTCAGACGTTAACTGTCATGT 58.693 43.478 23.14 7.17 38.83 3.21
2359 2586 5.466819 CCTTCAGACGTTAACTGTCATGTA 58.533 41.667 23.14 14.66 38.83 2.29
2360 2587 6.100004 CCTTCAGACGTTAACTGTCATGTAT 58.900 40.000 23.14 7.81 38.83 2.29
2361 2588 6.590292 CCTTCAGACGTTAACTGTCATGTATT 59.410 38.462 23.14 7.31 38.83 1.89
2362 2589 7.117812 CCTTCAGACGTTAACTGTCATGTATTT 59.882 37.037 23.14 6.80 38.83 1.40
2363 2590 7.576750 TCAGACGTTAACTGTCATGTATTTC 57.423 36.000 23.14 3.96 38.83 2.17
2364 2591 7.375834 TCAGACGTTAACTGTCATGTATTTCT 58.624 34.615 23.14 5.78 38.83 2.52
2365 2592 7.328493 TCAGACGTTAACTGTCATGTATTTCTG 59.672 37.037 23.14 13.89 38.83 3.02
2366 2593 7.116376 CAGACGTTAACTGTCATGTATTTCTGT 59.884 37.037 23.14 3.29 38.83 3.41
2367 2594 7.656137 AGACGTTAACTGTCATGTATTTCTGTT 59.344 33.333 23.14 0.00 38.83 3.16
2368 2595 8.149973 ACGTTAACTGTCATGTATTTCTGTTT 57.850 30.769 3.71 0.00 0.00 2.83
2369 2596 8.280497 ACGTTAACTGTCATGTATTTCTGTTTC 58.720 33.333 3.71 0.00 0.00 2.78
2370 2597 8.495949 CGTTAACTGTCATGTATTTCTGTTTCT 58.504 33.333 3.71 0.00 0.00 2.52
2371 2598 9.599322 GTTAACTGTCATGTATTTCTGTTTCTG 57.401 33.333 0.00 0.00 0.00 3.02
2372 2599 6.246420 ACTGTCATGTATTTCTGTTTCTGC 57.754 37.500 0.00 0.00 0.00 4.26
2373 2600 6.000219 ACTGTCATGTATTTCTGTTTCTGCT 59.000 36.000 0.00 0.00 0.00 4.24
2374 2601 6.488006 ACTGTCATGTATTTCTGTTTCTGCTT 59.512 34.615 0.00 0.00 0.00 3.91
2375 2602 6.671190 TGTCATGTATTTCTGTTTCTGCTTG 58.329 36.000 0.00 0.00 0.00 4.01
2376 2603 6.262944 TGTCATGTATTTCTGTTTCTGCTTGT 59.737 34.615 0.00 0.00 0.00 3.16
2377 2604 7.443879 TGTCATGTATTTCTGTTTCTGCTTGTA 59.556 33.333 0.00 0.00 0.00 2.41
2378 2605 7.959651 GTCATGTATTTCTGTTTCTGCTTGTAG 59.040 37.037 0.00 0.00 0.00 2.74
2379 2606 7.661437 TCATGTATTTCTGTTTCTGCTTGTAGT 59.339 33.333 0.00 0.00 0.00 2.73
2380 2607 7.801716 TGTATTTCTGTTTCTGCTTGTAGTT 57.198 32.000 0.00 0.00 0.00 2.24
2381 2608 7.639039 TGTATTTCTGTTTCTGCTTGTAGTTG 58.361 34.615 0.00 0.00 0.00 3.16
2382 2609 6.699575 ATTTCTGTTTCTGCTTGTAGTTGT 57.300 33.333 0.00 0.00 0.00 3.32
2383 2610 6.509418 TTTCTGTTTCTGCTTGTAGTTGTT 57.491 33.333 0.00 0.00 0.00 2.83
2384 2611 6.509418 TTCTGTTTCTGCTTGTAGTTGTTT 57.491 33.333 0.00 0.00 0.00 2.83
2385 2612 6.509418 TCTGTTTCTGCTTGTAGTTGTTTT 57.491 33.333 0.00 0.00 0.00 2.43
2386 2613 6.919721 TCTGTTTCTGCTTGTAGTTGTTTTT 58.080 32.000 0.00 0.00 0.00 1.94
2387 2614 6.806249 TCTGTTTCTGCTTGTAGTTGTTTTTG 59.194 34.615 0.00 0.00 0.00 2.44
2388 2615 6.682746 TGTTTCTGCTTGTAGTTGTTTTTGA 58.317 32.000 0.00 0.00 0.00 2.69
2389 2616 7.148641 TGTTTCTGCTTGTAGTTGTTTTTGAA 58.851 30.769 0.00 0.00 0.00 2.69
2390 2617 7.816995 TGTTTCTGCTTGTAGTTGTTTTTGAAT 59.183 29.630 0.00 0.00 0.00 2.57
2391 2618 9.296400 GTTTCTGCTTGTAGTTGTTTTTGAATA 57.704 29.630 0.00 0.00 0.00 1.75
2392 2619 9.862371 TTTCTGCTTGTAGTTGTTTTTGAATAA 57.138 25.926 0.00 0.00 0.00 1.40
2393 2620 9.862371 TTCTGCTTGTAGTTGTTTTTGAATAAA 57.138 25.926 0.00 0.00 0.00 1.40
2394 2621 9.515020 TCTGCTTGTAGTTGTTTTTGAATAAAG 57.485 29.630 0.00 0.00 0.00 1.85
2395 2622 9.515020 CTGCTTGTAGTTGTTTTTGAATAAAGA 57.485 29.630 0.00 0.00 0.00 2.52
2396 2623 9.862371 TGCTTGTAGTTGTTTTTGAATAAAGAA 57.138 25.926 0.00 0.00 0.00 2.52
2421 2648 9.449719 AATATATTACATCCGGAAGAATTGACC 57.550 33.333 14.76 0.00 0.00 4.02
2422 2649 4.561500 TTACATCCGGAAGAATTGACCA 57.438 40.909 14.76 0.00 0.00 4.02
2423 2650 3.652057 ACATCCGGAAGAATTGACCAT 57.348 42.857 14.76 0.00 0.00 3.55
2424 2651 3.545703 ACATCCGGAAGAATTGACCATC 58.454 45.455 14.76 0.00 0.00 3.51
2425 2652 3.200825 ACATCCGGAAGAATTGACCATCT 59.799 43.478 14.76 0.00 0.00 2.90
2426 2653 4.202441 CATCCGGAAGAATTGACCATCTT 58.798 43.478 9.01 0.00 38.56 2.40
2427 2654 4.301072 TCCGGAAGAATTGACCATCTTT 57.699 40.909 0.00 0.00 36.08 2.52
2428 2655 4.009675 TCCGGAAGAATTGACCATCTTTG 58.990 43.478 0.00 0.00 36.08 2.77
2429 2656 4.009675 CCGGAAGAATTGACCATCTTTGA 58.990 43.478 0.00 0.00 36.08 2.69
2430 2657 4.142600 CCGGAAGAATTGACCATCTTTGAC 60.143 45.833 0.00 0.00 36.08 3.18
2431 2658 4.142600 CGGAAGAATTGACCATCTTTGACC 60.143 45.833 0.00 0.00 36.08 4.02
2432 2659 4.766891 GGAAGAATTGACCATCTTTGACCA 59.233 41.667 0.00 0.00 36.08 4.02
2433 2660 5.243730 GGAAGAATTGACCATCTTTGACCAA 59.756 40.000 0.00 0.00 36.08 3.67
2434 2661 6.071165 GGAAGAATTGACCATCTTTGACCAAT 60.071 38.462 0.00 0.00 36.08 3.16
2435 2662 6.923199 AGAATTGACCATCTTTGACCAATT 57.077 33.333 0.00 0.00 37.37 2.32
2436 2663 8.421249 AAGAATTGACCATCTTTGACCAATTA 57.579 30.769 0.00 0.00 36.12 1.40
2437 2664 8.599624 AGAATTGACCATCTTTGACCAATTAT 57.400 30.769 0.00 0.00 36.12 1.28
2438 2665 9.039165 AGAATTGACCATCTTTGACCAATTATT 57.961 29.630 0.00 0.00 36.12 1.40
2439 2666 9.657419 GAATTGACCATCTTTGACCAATTATTT 57.343 29.630 0.00 0.00 36.12 1.40
2440 2667 9.439500 AATTGACCATCTTTGACCAATTATTTG 57.561 29.630 0.00 0.00 35.20 2.32
2455 2682 7.206981 CAATTATTTGGGGCTGTAGTATGAG 57.793 40.000 0.00 0.00 0.00 2.90
2456 2683 3.864789 ATTTGGGGCTGTAGTATGAGG 57.135 47.619 0.00 0.00 0.00 3.86
2457 2684 2.263895 TTGGGGCTGTAGTATGAGGT 57.736 50.000 0.00 0.00 0.00 3.85
2458 2685 2.263895 TGGGGCTGTAGTATGAGGTT 57.736 50.000 0.00 0.00 0.00 3.50
2459 2686 1.837439 TGGGGCTGTAGTATGAGGTTG 59.163 52.381 0.00 0.00 0.00 3.77
2460 2687 1.475213 GGGGCTGTAGTATGAGGTTGC 60.475 57.143 0.00 0.00 0.00 4.17
2461 2688 1.486726 GGGCTGTAGTATGAGGTTGCT 59.513 52.381 0.00 0.00 0.00 3.91
2462 2689 2.092914 GGGCTGTAGTATGAGGTTGCTT 60.093 50.000 0.00 0.00 0.00 3.91
2463 2690 3.134081 GGGCTGTAGTATGAGGTTGCTTA 59.866 47.826 0.00 0.00 0.00 3.09
2464 2691 4.202367 GGGCTGTAGTATGAGGTTGCTTAT 60.202 45.833 0.00 0.00 0.00 1.73
2465 2692 4.752101 GGCTGTAGTATGAGGTTGCTTATG 59.248 45.833 0.00 0.00 0.00 1.90
2466 2693 5.360591 GCTGTAGTATGAGGTTGCTTATGT 58.639 41.667 0.00 0.00 0.00 2.29
2467 2694 6.462487 GGCTGTAGTATGAGGTTGCTTATGTA 60.462 42.308 0.00 0.00 0.00 2.29
2468 2695 7.155328 GCTGTAGTATGAGGTTGCTTATGTAT 58.845 38.462 0.00 0.00 0.00 2.29
2469 2696 7.329717 GCTGTAGTATGAGGTTGCTTATGTATC 59.670 40.741 0.00 0.00 0.00 2.24
2470 2697 8.245195 TGTAGTATGAGGTTGCTTATGTATCA 57.755 34.615 0.00 0.00 0.00 2.15
2471 2698 8.870116 TGTAGTATGAGGTTGCTTATGTATCAT 58.130 33.333 0.00 0.00 0.00 2.45
2472 2699 9.712305 GTAGTATGAGGTTGCTTATGTATCATT 57.288 33.333 0.00 0.00 0.00 2.57
2474 2701 9.712305 AGTATGAGGTTGCTTATGTATCATTAC 57.288 33.333 0.00 0.00 0.00 1.89
2475 2702 9.489084 GTATGAGGTTGCTTATGTATCATTACA 57.511 33.333 0.00 0.00 42.35 2.41
2476 2703 8.978874 ATGAGGTTGCTTATGTATCATTACAA 57.021 30.769 0.00 0.00 41.51 2.41
2477 2704 8.978874 TGAGGTTGCTTATGTATCATTACAAT 57.021 30.769 0.00 0.00 41.51 2.71
2478 2705 9.407380 TGAGGTTGCTTATGTATCATTACAATT 57.593 29.630 0.00 0.00 41.51 2.32
2479 2706 9.669353 GAGGTTGCTTATGTATCATTACAATTG 57.331 33.333 3.24 3.24 41.51 2.32
2480 2707 9.189156 AGGTTGCTTATGTATCATTACAATTGT 57.811 29.630 16.68 16.68 41.51 2.71
2481 2708 9.450807 GGTTGCTTATGTATCATTACAATTGTC 57.549 33.333 15.85 0.00 41.51 3.18
2488 2715 8.915871 ATGTATCATTACAATTGTCTTTGTGC 57.084 30.769 15.85 4.56 41.51 4.57
2489 2716 7.880105 TGTATCATTACAATTGTCTTTGTGCA 58.120 30.769 15.85 7.07 40.00 4.57
2490 2717 8.355913 TGTATCATTACAATTGTCTTTGTGCAA 58.644 29.630 15.85 1.18 40.00 4.08
2491 2718 9.357652 GTATCATTACAATTGTCTTTGTGCAAT 57.642 29.630 15.85 3.75 40.00 3.56
2492 2719 8.836268 ATCATTACAATTGTCTTTGTGCAATT 57.164 26.923 15.85 0.00 43.53 2.32
2493 2720 9.926158 ATCATTACAATTGTCTTTGTGCAATTA 57.074 25.926 15.85 0.00 41.62 1.40
2494 2721 9.926158 TCATTACAATTGTCTTTGTGCAATTAT 57.074 25.926 15.85 0.00 41.62 1.28
2498 2725 8.761575 ACAATTGTCTTTGTGCAATTATTAGG 57.238 30.769 4.92 0.00 41.62 2.69
2499 2726 7.331687 ACAATTGTCTTTGTGCAATTATTAGGC 59.668 33.333 4.92 0.00 41.62 3.93
2500 2727 6.588719 TTGTCTTTGTGCAATTATTAGGCT 57.411 33.333 0.00 0.00 0.00 4.58
2501 2728 6.588719 TGTCTTTGTGCAATTATTAGGCTT 57.411 33.333 0.00 0.00 0.00 4.35
2502 2729 6.389091 TGTCTTTGTGCAATTATTAGGCTTG 58.611 36.000 0.00 0.00 0.00 4.01
2503 2730 5.289434 GTCTTTGTGCAATTATTAGGCTTGC 59.711 40.000 0.00 0.00 44.25 4.01
2508 2735 3.709987 GCAATTATTAGGCTTGCACAGG 58.290 45.455 0.00 0.00 43.62 4.00
2509 2736 3.491447 GCAATTATTAGGCTTGCACAGGG 60.491 47.826 0.00 0.00 43.62 4.45
2510 2737 3.669939 ATTATTAGGCTTGCACAGGGT 57.330 42.857 0.00 0.00 0.00 4.34
2511 2738 3.449746 TTATTAGGCTTGCACAGGGTT 57.550 42.857 0.00 0.00 0.00 4.11
2512 2739 2.309136 ATTAGGCTTGCACAGGGTTT 57.691 45.000 0.00 0.00 0.00 3.27
2513 2740 2.080654 TTAGGCTTGCACAGGGTTTT 57.919 45.000 0.00 0.00 0.00 2.43
2514 2741 1.616159 TAGGCTTGCACAGGGTTTTC 58.384 50.000 0.00 0.00 0.00 2.29
2515 2742 0.396974 AGGCTTGCACAGGGTTTTCA 60.397 50.000 0.00 0.00 0.00 2.69
2516 2743 0.463620 GGCTTGCACAGGGTTTTCAA 59.536 50.000 0.00 0.00 0.00 2.69
2517 2744 1.134551 GGCTTGCACAGGGTTTTCAAA 60.135 47.619 0.00 0.00 0.00 2.69
2518 2745 2.626840 GCTTGCACAGGGTTTTCAAAA 58.373 42.857 0.00 0.00 0.00 2.44
2519 2746 3.205338 GCTTGCACAGGGTTTTCAAAAT 58.795 40.909 0.00 0.00 0.00 1.82
2520 2747 3.002553 GCTTGCACAGGGTTTTCAAAATG 59.997 43.478 0.00 0.00 0.00 2.32
2521 2748 2.559440 TGCACAGGGTTTTCAAAATGC 58.441 42.857 0.00 0.00 0.00 3.56
2522 2749 2.093288 TGCACAGGGTTTTCAAAATGCA 60.093 40.909 4.33 4.33 39.38 3.96
2523 2750 2.941720 GCACAGGGTTTTCAAAATGCAA 59.058 40.909 0.00 0.00 0.00 4.08
2524 2751 3.002553 GCACAGGGTTTTCAAAATGCAAG 59.997 43.478 0.00 0.00 0.00 4.01
2525 2752 4.190772 CACAGGGTTTTCAAAATGCAAGT 58.809 39.130 0.00 0.00 0.00 3.16
2526 2753 4.635324 CACAGGGTTTTCAAAATGCAAGTT 59.365 37.500 0.00 0.00 0.00 2.66
2527 2754 5.814705 CACAGGGTTTTCAAAATGCAAGTTA 59.185 36.000 0.00 0.00 0.00 2.24
2528 2755 6.314896 CACAGGGTTTTCAAAATGCAAGTTAA 59.685 34.615 0.00 0.00 0.00 2.01
2529 2756 7.012232 CACAGGGTTTTCAAAATGCAAGTTAAT 59.988 33.333 0.00 0.00 0.00 1.40
2530 2757 7.226523 ACAGGGTTTTCAAAATGCAAGTTAATC 59.773 33.333 0.00 0.00 0.00 1.75
2531 2758 6.710295 AGGGTTTTCAAAATGCAAGTTAATCC 59.290 34.615 0.00 0.00 0.00 3.01
2532 2759 6.347321 GGGTTTTCAAAATGCAAGTTAATCCG 60.347 38.462 0.00 0.00 0.00 4.18
2533 2760 5.837586 TTTCAAAATGCAAGTTAATCCGC 57.162 34.783 0.00 0.00 0.00 5.54
2534 2761 3.843999 TCAAAATGCAAGTTAATCCGCC 58.156 40.909 0.00 0.00 0.00 6.13
2535 2762 3.256879 TCAAAATGCAAGTTAATCCGCCA 59.743 39.130 0.00 0.00 0.00 5.69
2536 2763 2.939460 AATGCAAGTTAATCCGCCAC 57.061 45.000 0.00 0.00 0.00 5.01
2537 2764 1.832883 ATGCAAGTTAATCCGCCACA 58.167 45.000 0.00 0.00 0.00 4.17
2538 2765 1.610363 TGCAAGTTAATCCGCCACAA 58.390 45.000 0.00 0.00 0.00 3.33
2539 2766 1.957177 TGCAAGTTAATCCGCCACAAA 59.043 42.857 0.00 0.00 0.00 2.83
2540 2767 2.287909 TGCAAGTTAATCCGCCACAAAC 60.288 45.455 0.00 0.00 0.00 2.93
2541 2768 2.287909 GCAAGTTAATCCGCCACAAACA 60.288 45.455 0.00 0.00 0.00 2.83
2542 2769 3.305110 CAAGTTAATCCGCCACAAACAC 58.695 45.455 0.00 0.00 0.00 3.32
2543 2770 2.577700 AGTTAATCCGCCACAAACACA 58.422 42.857 0.00 0.00 0.00 3.72
2544 2771 2.952978 AGTTAATCCGCCACAAACACAA 59.047 40.909 0.00 0.00 0.00 3.33
2545 2772 3.572255 AGTTAATCCGCCACAAACACAAT 59.428 39.130 0.00 0.00 0.00 2.71
2546 2773 4.762765 AGTTAATCCGCCACAAACACAATA 59.237 37.500 0.00 0.00 0.00 1.90
2547 2774 5.417580 AGTTAATCCGCCACAAACACAATAT 59.582 36.000 0.00 0.00 0.00 1.28
2548 2775 6.600032 AGTTAATCCGCCACAAACACAATATA 59.400 34.615 0.00 0.00 0.00 0.86
2549 2776 5.906113 AATCCGCCACAAACACAATATAA 57.094 34.783 0.00 0.00 0.00 0.98
2550 2777 6.463995 AATCCGCCACAAACACAATATAAT 57.536 33.333 0.00 0.00 0.00 1.28
2551 2778 5.906113 TCCGCCACAAACACAATATAATT 57.094 34.783 0.00 0.00 0.00 1.40
2552 2779 5.645624 TCCGCCACAAACACAATATAATTG 58.354 37.500 0.00 0.00 0.00 2.32
2553 2780 4.267452 CCGCCACAAACACAATATAATTGC 59.733 41.667 0.00 0.00 0.00 3.56
2554 2781 5.101628 CGCCACAAACACAATATAATTGCT 58.898 37.500 0.00 0.00 0.00 3.91
2555 2782 5.004630 CGCCACAAACACAATATAATTGCTG 59.995 40.000 0.00 1.45 0.00 4.41
2556 2783 5.291614 GCCACAAACACAATATAATTGCTGG 59.708 40.000 0.00 0.00 0.00 4.85
2557 2784 5.291614 CCACAAACACAATATAATTGCTGGC 59.708 40.000 0.00 0.00 0.00 4.85
2558 2785 6.101332 CACAAACACAATATAATTGCTGGCT 58.899 36.000 0.00 0.00 0.00 4.75
2559 2786 6.591062 CACAAACACAATATAATTGCTGGCTT 59.409 34.615 0.00 0.00 0.00 4.35
2560 2787 7.758980 CACAAACACAATATAATTGCTGGCTTA 59.241 33.333 0.00 0.00 0.00 3.09
2561 2788 7.759433 ACAAACACAATATAATTGCTGGCTTAC 59.241 33.333 0.00 0.00 0.00 2.34
2562 2789 7.645058 AACACAATATAATTGCTGGCTTACT 57.355 32.000 0.00 0.00 0.00 2.24
2563 2790 7.645058 ACACAATATAATTGCTGGCTTACTT 57.355 32.000 0.00 0.00 0.00 2.24
2564 2791 7.483307 ACACAATATAATTGCTGGCTTACTTG 58.517 34.615 0.00 0.00 0.00 3.16
2565 2792 7.122650 ACACAATATAATTGCTGGCTTACTTGT 59.877 33.333 0.00 0.00 0.00 3.16
2566 2793 7.433131 CACAATATAATTGCTGGCTTACTTGTG 59.567 37.037 0.00 0.00 32.94 3.33
2567 2794 7.122650 ACAATATAATTGCTGGCTTACTTGTGT 59.877 33.333 0.00 0.00 0.00 3.72
2568 2795 5.982890 ATAATTGCTGGCTTACTTGTGTT 57.017 34.783 0.00 0.00 0.00 3.32
2569 2796 3.648339 ATTGCTGGCTTACTTGTGTTG 57.352 42.857 0.00 0.00 0.00 3.33
2570 2797 2.051334 TGCTGGCTTACTTGTGTTGT 57.949 45.000 0.00 0.00 0.00 3.32
2571 2798 2.374184 TGCTGGCTTACTTGTGTTGTT 58.626 42.857 0.00 0.00 0.00 2.83
2572 2799 2.357637 TGCTGGCTTACTTGTGTTGTTC 59.642 45.455 0.00 0.00 0.00 3.18
2573 2800 2.287608 GCTGGCTTACTTGTGTTGTTCC 60.288 50.000 0.00 0.00 0.00 3.62
2574 2801 3.214328 CTGGCTTACTTGTGTTGTTCCT 58.786 45.455 0.00 0.00 0.00 3.36
2575 2802 2.948979 TGGCTTACTTGTGTTGTTCCTG 59.051 45.455 0.00 0.00 0.00 3.86
2576 2803 2.949644 GGCTTACTTGTGTTGTTCCTGT 59.050 45.455 0.00 0.00 0.00 4.00
2577 2804 3.243068 GGCTTACTTGTGTTGTTCCTGTG 60.243 47.826 0.00 0.00 0.00 3.66
2578 2805 3.243068 GCTTACTTGTGTTGTTCCTGTGG 60.243 47.826 0.00 0.00 0.00 4.17
2579 2806 2.507407 ACTTGTGTTGTTCCTGTGGT 57.493 45.000 0.00 0.00 0.00 4.16
2580 2807 2.802719 ACTTGTGTTGTTCCTGTGGTT 58.197 42.857 0.00 0.00 0.00 3.67
2581 2808 3.958018 ACTTGTGTTGTTCCTGTGGTTA 58.042 40.909 0.00 0.00 0.00 2.85
2582 2809 3.945285 ACTTGTGTTGTTCCTGTGGTTAG 59.055 43.478 0.00 0.00 0.00 2.34
2583 2810 3.637911 TGTGTTGTTCCTGTGGTTAGT 57.362 42.857 0.00 0.00 0.00 2.24
2584 2811 4.757019 TGTGTTGTTCCTGTGGTTAGTA 57.243 40.909 0.00 0.00 0.00 1.82
2585 2812 5.298989 TGTGTTGTTCCTGTGGTTAGTAT 57.701 39.130 0.00 0.00 0.00 2.12
2586 2813 5.060506 TGTGTTGTTCCTGTGGTTAGTATG 58.939 41.667 0.00 0.00 0.00 2.39
2587 2814 4.069304 TGTTGTTCCTGTGGTTAGTATGC 58.931 43.478 0.00 0.00 0.00 3.14
2588 2815 4.069304 GTTGTTCCTGTGGTTAGTATGCA 58.931 43.478 0.00 0.00 0.00 3.96
2589 2816 4.359434 TGTTCCTGTGGTTAGTATGCAA 57.641 40.909 0.00 0.00 0.00 4.08
2590 2817 4.069304 TGTTCCTGTGGTTAGTATGCAAC 58.931 43.478 0.00 0.00 0.00 4.17
2591 2818 4.069304 GTTCCTGTGGTTAGTATGCAACA 58.931 43.478 0.00 0.00 0.00 3.33
2592 2819 4.568072 TCCTGTGGTTAGTATGCAACAT 57.432 40.909 0.00 0.00 0.00 2.71
2593 2820 4.260985 TCCTGTGGTTAGTATGCAACATG 58.739 43.478 0.00 0.00 0.00 3.21
2594 2821 3.181497 CCTGTGGTTAGTATGCAACATGC 60.181 47.826 0.00 0.00 45.29 4.06
2604 2831 3.708195 GCAACATGCAGATGTCACC 57.292 52.632 0.00 0.00 42.30 4.02
2605 2832 0.179181 GCAACATGCAGATGTCACCG 60.179 55.000 0.00 0.00 42.30 4.94
2606 2833 1.159285 CAACATGCAGATGTCACCGT 58.841 50.000 0.00 0.00 42.30 4.83
2607 2834 1.536766 CAACATGCAGATGTCACCGTT 59.463 47.619 0.00 0.00 42.30 4.44
2608 2835 1.896220 ACATGCAGATGTCACCGTTT 58.104 45.000 0.00 0.00 38.53 3.60
2609 2836 2.229792 ACATGCAGATGTCACCGTTTT 58.770 42.857 0.00 0.00 38.53 2.43
2610 2837 2.226437 ACATGCAGATGTCACCGTTTTC 59.774 45.455 0.00 0.00 38.53 2.29
2611 2838 1.960417 TGCAGATGTCACCGTTTTCA 58.040 45.000 0.00 0.00 0.00 2.69
2612 2839 2.503331 TGCAGATGTCACCGTTTTCAT 58.497 42.857 0.00 0.00 0.00 2.57
2613 2840 2.884012 TGCAGATGTCACCGTTTTCATT 59.116 40.909 0.00 0.00 0.00 2.57
2614 2841 3.317711 TGCAGATGTCACCGTTTTCATTT 59.682 39.130 0.00 0.00 0.00 2.32
2615 2842 4.202101 TGCAGATGTCACCGTTTTCATTTT 60.202 37.500 0.00 0.00 0.00 1.82
2616 2843 4.744631 GCAGATGTCACCGTTTTCATTTTT 59.255 37.500 0.00 0.00 0.00 1.94
2638 2865 8.893219 TTTTTATGCCTCTACTACTGATCATG 57.107 34.615 0.00 0.00 0.00 3.07
2639 2866 4.533919 ATGCCTCTACTACTGATCATGC 57.466 45.455 0.00 0.00 0.00 4.06
2640 2867 3.570540 TGCCTCTACTACTGATCATGCT 58.429 45.455 0.00 0.00 0.00 3.79
2641 2868 4.729868 TGCCTCTACTACTGATCATGCTA 58.270 43.478 0.00 0.00 0.00 3.49
2642 2869 4.764308 TGCCTCTACTACTGATCATGCTAG 59.236 45.833 0.00 0.00 0.00 3.42
2643 2870 4.157656 GCCTCTACTACTGATCATGCTAGG 59.842 50.000 0.00 0.00 0.00 3.02
2644 2871 5.565509 CCTCTACTACTGATCATGCTAGGA 58.434 45.833 0.00 0.00 0.00 2.94
2645 2872 6.007076 CCTCTACTACTGATCATGCTAGGAA 58.993 44.000 0.00 0.00 0.00 3.36
2646 2873 6.072175 CCTCTACTACTGATCATGCTAGGAAC 60.072 46.154 0.00 0.00 0.00 3.62
2647 2874 6.606069 TCTACTACTGATCATGCTAGGAACT 58.394 40.000 0.00 0.00 46.37 3.01
2648 2875 7.063593 TCTACTACTGATCATGCTAGGAACTT 58.936 38.462 0.00 0.00 41.75 2.66
2649 2876 5.911752 ACTACTGATCATGCTAGGAACTTG 58.088 41.667 0.00 0.00 41.75 3.16
2650 2877 5.658634 ACTACTGATCATGCTAGGAACTTGA 59.341 40.000 0.00 0.00 41.75 3.02
2651 2878 5.426689 ACTGATCATGCTAGGAACTTGAA 57.573 39.130 0.00 0.00 41.75 2.69
2652 2879 5.426504 ACTGATCATGCTAGGAACTTGAAG 58.573 41.667 0.00 0.00 41.75 3.02
2653 2880 5.046014 ACTGATCATGCTAGGAACTTGAAGT 60.046 40.000 0.00 0.00 41.75 3.01
2654 2881 5.181009 TGATCATGCTAGGAACTTGAAGTG 58.819 41.667 0.00 0.00 41.75 3.16
2655 2882 4.890158 TCATGCTAGGAACTTGAAGTGA 57.110 40.909 0.00 0.00 41.75 3.41
2656 2883 5.227569 TCATGCTAGGAACTTGAAGTGAA 57.772 39.130 0.00 0.00 41.75 3.18
2657 2884 5.809001 TCATGCTAGGAACTTGAAGTGAAT 58.191 37.500 0.00 0.00 41.75 2.57
2658 2885 5.877012 TCATGCTAGGAACTTGAAGTGAATC 59.123 40.000 0.00 0.00 41.75 2.52
2672 2899 0.401356 TGAATCTTGTCAGCAGCCCA 59.599 50.000 0.00 0.00 0.00 5.36
2680 2907 1.820906 TCAGCAGCCCAATCATCGC 60.821 57.895 0.00 0.00 0.00 4.58
2708 2935 2.023113 AGAGGAGGCTCTTCAGGAAGAT 60.023 50.000 26.00 3.14 45.40 2.40
2722 2949 4.537433 AGATGCGCGGGAAGAGGC 62.537 66.667 8.83 0.00 0.00 4.70
2825 3053 1.538687 AAGCGGGTGTAACGGTAGCT 61.539 55.000 0.00 0.00 41.63 3.32
2839 3067 4.604082 CGGTAGCTAGCGTTTAAATACG 57.396 45.455 31.65 5.12 44.09 3.06
2849 3078 2.785477 CGTTTAAATACGGCGATCGACT 59.215 45.455 21.57 8.80 42.43 4.18
2850 3079 3.121894 CGTTTAAATACGGCGATCGACTC 60.122 47.826 21.57 6.39 42.43 3.36
2871 3101 1.066286 CAGCAGAGGACAGGAAGGAAG 60.066 57.143 0.00 0.00 0.00 3.46
2881 3111 1.632920 CAGGAAGGAAGAGGAGGCTTT 59.367 52.381 0.00 0.00 0.00 3.51
2915 3151 3.058570 TGTGGCGTGTGTGATTTGTAATC 60.059 43.478 0.00 0.00 0.00 1.75
2921 3157 6.183360 GGCGTGTGTGATTTGTAATCTGAATA 60.183 38.462 0.00 0.00 0.00 1.75
2956 3194 1.777878 TGGGAGGACAGCTAAACCAAA 59.222 47.619 0.00 0.00 0.00 3.28
2960 3198 3.127030 GGAGGACAGCTAAACCAAATTCG 59.873 47.826 0.00 0.00 0.00 3.34
2988 3226 3.634448 AGATCTCGTTCATGGAGGTAGTG 59.366 47.826 0.00 0.00 32.34 2.74
3003 3241 3.012502 AGGTAGTGGGTTCCTCACATCTA 59.987 47.826 11.07 0.00 37.58 1.98
3012 3251 5.777732 GGGTTCCTCACATCTAGTATCAGAT 59.222 44.000 0.00 0.00 35.60 2.90
3158 3397 3.133014 CCGAGGTGCTGGATCGAT 58.867 61.111 0.00 0.00 38.72 3.59
3160 3399 1.439228 CGAGGTGCTGGATCGATGT 59.561 57.895 0.54 0.00 38.72 3.06
3174 3413 1.574428 GATGTTTCAAGGCGCACGT 59.426 52.632 10.83 0.00 0.00 4.49
3201 3440 0.460284 ATCATCAAGTCCGTCGGCAC 60.460 55.000 6.34 6.08 0.00 5.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 4.493747 GAGGGGCGAAGACGGACG 62.494 72.222 0.00 0.00 33.41 4.79
5 6 3.069318 AGAGGGGCGAAGACGGAC 61.069 66.667 0.00 0.00 33.41 4.79
6 7 3.068691 CAGAGGGGCGAAGACGGA 61.069 66.667 0.00 0.00 33.41 4.69
7 8 4.148825 CCAGAGGGGCGAAGACGG 62.149 72.222 0.00 0.00 33.41 4.79
16 17 1.878102 GCGTAATACATGCCAGAGGGG 60.878 57.143 0.00 0.00 40.85 4.79
17 18 1.512926 GCGTAATACATGCCAGAGGG 58.487 55.000 0.00 0.00 32.57 4.30
18 19 1.139989 CGCGTAATACATGCCAGAGG 58.860 55.000 0.00 0.00 35.59 3.69
19 20 1.139989 CCGCGTAATACATGCCAGAG 58.860 55.000 4.92 0.00 35.59 3.35
20 21 0.462375 ACCGCGTAATACATGCCAGA 59.538 50.000 4.92 0.00 35.59 3.86
21 22 1.260561 GAACCGCGTAATACATGCCAG 59.739 52.381 4.92 0.00 35.59 4.85
22 23 1.292061 GAACCGCGTAATACATGCCA 58.708 50.000 4.92 0.00 35.59 4.92
23 24 0.584876 GGAACCGCGTAATACATGCC 59.415 55.000 4.92 0.00 35.59 4.40
24 25 0.231279 CGGAACCGCGTAATACATGC 59.769 55.000 4.92 0.00 35.67 4.06
25 26 0.856641 CCGGAACCGCGTAATACATG 59.143 55.000 4.92 0.00 38.24 3.21
26 27 0.746063 TCCGGAACCGCGTAATACAT 59.254 50.000 0.00 0.00 38.24 2.29
27 28 0.101040 CTCCGGAACCGCGTAATACA 59.899 55.000 5.23 0.00 38.24 2.29
28 29 0.381801 TCTCCGGAACCGCGTAATAC 59.618 55.000 5.23 0.00 38.24 1.89
29 30 1.321474 ATCTCCGGAACCGCGTAATA 58.679 50.000 5.23 0.00 38.24 0.98
30 31 1.000938 GTATCTCCGGAACCGCGTAAT 60.001 52.381 5.23 0.00 38.24 1.89
31 32 0.381801 GTATCTCCGGAACCGCGTAA 59.618 55.000 5.23 0.00 38.24 3.18
32 33 0.747644 TGTATCTCCGGAACCGCGTA 60.748 55.000 5.23 0.00 38.24 4.42
33 34 2.048023 TGTATCTCCGGAACCGCGT 61.048 57.895 5.23 0.00 38.24 6.01
34 35 1.588139 GTGTATCTCCGGAACCGCG 60.588 63.158 5.23 0.00 38.24 6.46
35 36 1.588139 CGTGTATCTCCGGAACCGC 60.588 63.158 5.23 0.00 38.24 5.68
36 37 1.588139 GCGTGTATCTCCGGAACCG 60.588 63.158 5.23 8.28 39.44 4.44
37 38 1.227176 GGCGTGTATCTCCGGAACC 60.227 63.158 5.23 0.00 0.00 3.62
38 39 0.248949 GAGGCGTGTATCTCCGGAAC 60.249 60.000 5.23 0.76 0.00 3.62
39 40 1.721664 CGAGGCGTGTATCTCCGGAA 61.722 60.000 5.23 0.00 0.00 4.30
40 41 2.184830 CGAGGCGTGTATCTCCGGA 61.185 63.158 2.93 2.93 0.00 5.14
41 42 2.331805 CGAGGCGTGTATCTCCGG 59.668 66.667 0.00 0.00 0.00 5.14
42 43 2.331805 CCGAGGCGTGTATCTCCG 59.668 66.667 0.00 0.00 0.00 4.63
43 44 2.728817 CCCGAGGCGTGTATCTCC 59.271 66.667 0.00 0.00 0.00 3.71
44 45 2.027751 GCCCGAGGCGTGTATCTC 59.972 66.667 0.00 0.00 39.62 2.75
54 55 1.369091 CGAATGTTCCAAGCCCGAGG 61.369 60.000 0.00 0.00 0.00 4.63
55 56 0.391130 TCGAATGTTCCAAGCCCGAG 60.391 55.000 0.00 0.00 0.00 4.63
56 57 0.391130 CTCGAATGTTCCAAGCCCGA 60.391 55.000 0.00 0.00 0.00 5.14
57 58 0.391130 TCTCGAATGTTCCAAGCCCG 60.391 55.000 0.00 0.00 0.00 6.13
58 59 1.373570 CTCTCGAATGTTCCAAGCCC 58.626 55.000 0.00 0.00 0.00 5.19
59 60 0.729690 GCTCTCGAATGTTCCAAGCC 59.270 55.000 0.00 0.00 0.00 4.35
60 61 1.129437 GTGCTCTCGAATGTTCCAAGC 59.871 52.381 0.00 0.00 0.00 4.01
61 62 1.734465 GGTGCTCTCGAATGTTCCAAG 59.266 52.381 0.00 0.00 0.00 3.61
62 63 1.610624 GGGTGCTCTCGAATGTTCCAA 60.611 52.381 0.00 0.00 0.00 3.53
63 64 0.036388 GGGTGCTCTCGAATGTTCCA 60.036 55.000 0.00 0.00 0.00 3.53
64 65 0.036388 TGGGTGCTCTCGAATGTTCC 60.036 55.000 0.00 0.00 0.00 3.62
65 66 1.079503 GTGGGTGCTCTCGAATGTTC 58.920 55.000 0.00 0.00 0.00 3.18
66 67 0.670546 CGTGGGTGCTCTCGAATGTT 60.671 55.000 0.00 0.00 0.00 2.71
67 68 1.079819 CGTGGGTGCTCTCGAATGT 60.080 57.895 0.00 0.00 0.00 2.71
68 69 0.803768 CTCGTGGGTGCTCTCGAATG 60.804 60.000 0.00 0.00 32.12 2.67
69 70 1.513158 CTCGTGGGTGCTCTCGAAT 59.487 57.895 0.00 0.00 32.12 3.34
70 71 2.636412 CCTCGTGGGTGCTCTCGAA 61.636 63.158 0.00 0.00 32.12 3.71
71 72 3.062466 CCTCGTGGGTGCTCTCGA 61.062 66.667 0.00 0.00 0.00 4.04
72 73 4.803426 GCCTCGTGGGTGCTCTCG 62.803 72.222 5.54 0.00 37.43 4.04
73 74 4.459089 GGCCTCGTGGGTGCTCTC 62.459 72.222 5.54 0.00 37.43 3.20
120 121 3.917760 GATCGAGGCCACCCGAGG 61.918 72.222 17.45 0.00 38.25 4.63
121 122 4.271816 CGATCGAGGCCACCCGAG 62.272 72.222 10.26 4.63 38.25 4.63
124 125 4.899239 CTGCGATCGAGGCCACCC 62.899 72.222 21.57 0.00 0.00 4.61
125 126 3.157217 ATCTGCGATCGAGGCCACC 62.157 63.158 21.57 0.00 0.00 4.61
126 127 1.953138 CATCTGCGATCGAGGCCAC 60.953 63.158 21.57 0.00 0.00 5.01
127 128 1.675720 TTCATCTGCGATCGAGGCCA 61.676 55.000 21.57 6.11 0.00 5.36
128 129 1.068083 TTCATCTGCGATCGAGGCC 59.932 57.895 21.57 0.00 0.00 5.19
129 130 0.249238 AGTTCATCTGCGATCGAGGC 60.249 55.000 21.57 0.94 0.00 4.70
130 131 1.601663 GGAGTTCATCTGCGATCGAGG 60.602 57.143 21.57 10.37 0.00 4.63
131 132 1.336440 AGGAGTTCATCTGCGATCGAG 59.664 52.381 21.57 13.35 39.54 4.04
132 133 1.335182 GAGGAGTTCATCTGCGATCGA 59.665 52.381 21.57 3.01 39.54 3.59
133 134 1.336440 AGAGGAGTTCATCTGCGATCG 59.664 52.381 11.69 11.69 39.54 3.69
134 135 2.741612 CAGAGGAGTTCATCTGCGATC 58.258 52.381 10.41 0.00 45.80 3.69
135 136 2.886862 CAGAGGAGTTCATCTGCGAT 57.113 50.000 10.41 0.00 45.80 4.58
140 141 3.260380 CCACTTGTCAGAGGAGTTCATCT 59.740 47.826 0.00 0.00 37.51 2.90
141 142 3.259374 TCCACTTGTCAGAGGAGTTCATC 59.741 47.826 0.00 0.00 35.02 2.92
142 143 3.007398 GTCCACTTGTCAGAGGAGTTCAT 59.993 47.826 0.00 0.00 40.20 2.57
143 144 2.365617 GTCCACTTGTCAGAGGAGTTCA 59.634 50.000 0.00 0.00 40.20 3.18
144 145 2.608261 CGTCCACTTGTCAGAGGAGTTC 60.608 54.545 0.00 0.00 40.20 3.01
145 146 1.341531 CGTCCACTTGTCAGAGGAGTT 59.658 52.381 0.00 0.00 40.20 3.01
146 147 0.962489 CGTCCACTTGTCAGAGGAGT 59.038 55.000 0.00 0.00 40.20 3.85
147 148 0.389166 GCGTCCACTTGTCAGAGGAG 60.389 60.000 0.00 0.00 40.20 3.69
148 149 1.666011 GCGTCCACTTGTCAGAGGA 59.334 57.895 0.00 0.00 37.44 3.71
149 150 1.734477 CGCGTCCACTTGTCAGAGG 60.734 63.158 0.00 0.00 32.08 3.69
150 151 2.375766 GCGCGTCCACTTGTCAGAG 61.376 63.158 8.43 0.00 0.00 3.35
151 152 2.355837 GCGCGTCCACTTGTCAGA 60.356 61.111 8.43 0.00 0.00 3.27
152 153 3.767230 CGCGCGTCCACTTGTCAG 61.767 66.667 24.19 0.00 0.00 3.51
153 154 4.273257 TCGCGCGTCCACTTGTCA 62.273 61.111 30.98 2.41 0.00 3.58
154 155 3.470567 CTCGCGCGTCCACTTGTC 61.471 66.667 30.98 0.00 0.00 3.18
168 169 3.815569 GAGATCCCGCGTCTGCTCG 62.816 68.421 4.92 0.00 39.65 5.03
169 170 2.026879 GAGATCCCGCGTCTGCTC 59.973 66.667 4.92 2.82 39.65 4.26
170 171 3.893763 CGAGATCCCGCGTCTGCT 61.894 66.667 4.92 0.00 39.65 4.24
189 190 3.516866 GATTAGTCGCGGGGGAGGC 62.517 68.421 6.13 0.00 0.00 4.70
190 191 1.682451 TTGATTAGTCGCGGGGGAGG 61.682 60.000 6.13 0.00 0.00 4.30
191 192 0.529992 GTTGATTAGTCGCGGGGGAG 60.530 60.000 6.13 0.00 0.00 4.30
192 193 1.518774 GTTGATTAGTCGCGGGGGA 59.481 57.895 6.13 0.00 0.00 4.81
193 194 1.881252 CGTTGATTAGTCGCGGGGG 60.881 63.158 6.13 0.00 0.00 5.40
194 195 1.140161 TCGTTGATTAGTCGCGGGG 59.860 57.895 6.13 0.00 0.00 5.73
195 196 1.469126 CGTCGTTGATTAGTCGCGGG 61.469 60.000 6.13 0.00 0.00 6.13
196 197 0.521867 TCGTCGTTGATTAGTCGCGG 60.522 55.000 6.13 0.00 0.00 6.46
197 198 0.832030 CTCGTCGTTGATTAGTCGCG 59.168 55.000 0.00 0.00 0.00 5.87
198 199 1.189403 CCTCGTCGTTGATTAGTCGC 58.811 55.000 0.00 0.00 0.00 5.19
199 200 2.819422 TCCTCGTCGTTGATTAGTCG 57.181 50.000 0.00 0.00 0.00 4.18
200 201 3.289911 CGATCCTCGTCGTTGATTAGTC 58.710 50.000 0.00 0.00 36.88 2.59
201 202 2.541178 GCGATCCTCGTCGTTGATTAGT 60.541 50.000 0.00 0.00 42.81 2.24
202 203 2.044860 GCGATCCTCGTCGTTGATTAG 58.955 52.381 0.00 0.00 42.81 1.73
203 204 1.268896 GGCGATCCTCGTCGTTGATTA 60.269 52.381 0.00 0.00 42.81 1.75
204 205 0.527817 GGCGATCCTCGTCGTTGATT 60.528 55.000 0.00 0.00 42.81 2.57
205 206 1.065928 GGCGATCCTCGTCGTTGAT 59.934 57.895 0.00 0.00 42.81 2.57
206 207 2.488355 GGCGATCCTCGTCGTTGA 59.512 61.111 0.00 0.00 42.81 3.18
211 212 4.632458 GAGGCGGCGATCCTCGTC 62.632 72.222 12.98 0.00 42.81 4.20
216 217 2.219325 CTATGAGGAGGCGGCGATCC 62.219 65.000 20.12 20.12 35.71 3.36
217 218 1.214062 CTATGAGGAGGCGGCGATC 59.786 63.158 12.98 7.65 0.00 3.69
218 219 2.936912 GCTATGAGGAGGCGGCGAT 61.937 63.158 12.98 0.00 0.00 4.58
219 220 3.606662 GCTATGAGGAGGCGGCGA 61.607 66.667 12.98 0.00 0.00 5.54
229 230 2.336809 GTCCGCCTCCGCTATGAG 59.663 66.667 0.00 0.00 0.00 2.90
230 231 3.592814 CGTCCGCCTCCGCTATGA 61.593 66.667 0.00 0.00 0.00 2.15
231 232 3.544167 CTCGTCCGCCTCCGCTATG 62.544 68.421 0.00 0.00 0.00 2.23
232 233 3.288290 CTCGTCCGCCTCCGCTAT 61.288 66.667 0.00 0.00 0.00 2.97
237 238 4.803426 CTGTGCTCGTCCGCCTCC 62.803 72.222 0.00 0.00 0.00 4.30
238 239 3.691744 CTCTGTGCTCGTCCGCCTC 62.692 68.421 0.00 0.00 0.00 4.70
239 240 3.753434 CTCTGTGCTCGTCCGCCT 61.753 66.667 0.00 0.00 0.00 5.52
240 241 4.803426 CCTCTGTGCTCGTCCGCC 62.803 72.222 0.00 0.00 0.00 6.13
241 242 4.803426 CCCTCTGTGCTCGTCCGC 62.803 72.222 0.00 0.00 0.00 5.54
242 243 4.803426 GCCCTCTGTGCTCGTCCG 62.803 72.222 0.00 0.00 0.00 4.79
243 244 4.803426 CGCCCTCTGTGCTCGTCC 62.803 72.222 0.00 0.00 0.00 4.79
244 245 4.803426 CCGCCCTCTGTGCTCGTC 62.803 72.222 0.00 0.00 0.00 4.20
264 265 4.680237 TGGGAAGTGCTCACGCCG 62.680 66.667 8.21 0.00 36.20 6.46
265 266 3.050275 GTGGGAAGTGCTCACGCC 61.050 66.667 0.00 6.46 38.42 5.68
269 270 0.325933 CATCCTGTGGGAAGTGCTCA 59.674 55.000 0.00 0.00 45.78 4.26
270 271 0.326264 ACATCCTGTGGGAAGTGCTC 59.674 55.000 0.00 0.00 45.78 4.26
271 272 0.326264 GACATCCTGTGGGAAGTGCT 59.674 55.000 0.00 0.00 42.72 4.40
272 273 0.036732 TGACATCCTGTGGGAAGTGC 59.963 55.000 0.00 0.00 42.72 4.40
273 274 1.611673 GGTGACATCCTGTGGGAAGTG 60.612 57.143 0.00 0.00 42.72 3.16
274 275 0.693049 GGTGACATCCTGTGGGAAGT 59.307 55.000 0.00 0.00 44.96 3.01
275 276 0.391661 CGGTGACATCCTGTGGGAAG 60.392 60.000 0.00 0.00 45.78 3.46
276 277 1.676968 CGGTGACATCCTGTGGGAA 59.323 57.895 0.00 0.00 45.78 3.97
277 278 2.954684 GCGGTGACATCCTGTGGGA 61.955 63.158 0.00 0.00 46.81 4.37
278 279 2.436646 GCGGTGACATCCTGTGGG 60.437 66.667 0.00 0.00 0.00 4.61
279 280 2.436646 GGCGGTGACATCCTGTGG 60.437 66.667 0.00 0.00 0.00 4.17
280 281 2.815211 CGGCGGTGACATCCTGTG 60.815 66.667 0.00 0.00 0.00 3.66
281 282 2.994995 TCGGCGGTGACATCCTGT 60.995 61.111 7.21 0.00 0.00 4.00
282 283 2.202797 CTCGGCGGTGACATCCTG 60.203 66.667 7.21 0.00 0.00 3.86
283 284 1.982395 TTCTCGGCGGTGACATCCT 60.982 57.895 7.21 0.00 0.00 3.24
284 285 1.810030 GTTCTCGGCGGTGACATCC 60.810 63.158 7.21 0.00 0.00 3.51
285 286 2.158959 CGTTCTCGGCGGTGACATC 61.159 63.158 7.21 0.00 0.00 3.06
286 287 2.126071 CGTTCTCGGCGGTGACAT 60.126 61.111 7.21 0.00 0.00 3.06
287 288 3.263503 CTCGTTCTCGGCGGTGACA 62.264 63.158 7.21 0.00 37.69 3.58
288 289 2.504244 CTCGTTCTCGGCGGTGAC 60.504 66.667 7.21 2.05 37.69 3.67
289 290 2.467946 GAACTCGTTCTCGGCGGTGA 62.468 60.000 7.21 2.87 36.69 4.02
290 291 2.049433 AACTCGTTCTCGGCGGTG 60.049 61.111 7.21 0.00 37.69 4.94
291 292 2.257676 GAACTCGTTCTCGGCGGT 59.742 61.111 7.21 0.00 36.69 5.68
292 293 1.801913 CAGAACTCGTTCTCGGCGG 60.802 63.158 7.21 0.00 46.13 6.13
293 294 1.801913 CCAGAACTCGTTCTCGGCG 60.802 63.158 9.24 0.00 46.13 6.46
294 295 0.173708 ATCCAGAACTCGTTCTCGGC 59.826 55.000 9.24 0.00 46.13 5.54
295 296 1.914634 CATCCAGAACTCGTTCTCGG 58.085 55.000 9.24 13.31 46.13 4.63
296 297 1.272781 GCATCCAGAACTCGTTCTCG 58.727 55.000 9.24 3.90 46.13 4.04
297 298 2.370281 TGCATCCAGAACTCGTTCTC 57.630 50.000 9.24 0.00 46.13 2.87
299 300 2.160417 CCTTTGCATCCAGAACTCGTTC 59.840 50.000 1.62 1.62 39.78 3.95
300 301 2.154462 CCTTTGCATCCAGAACTCGTT 58.846 47.619 0.00 0.00 0.00 3.85
301 302 1.347707 TCCTTTGCATCCAGAACTCGT 59.652 47.619 0.00 0.00 0.00 4.18
302 303 2.005451 CTCCTTTGCATCCAGAACTCG 58.995 52.381 0.00 0.00 0.00 4.18
303 304 2.363683 CCTCCTTTGCATCCAGAACTC 58.636 52.381 0.00 0.00 0.00 3.01
304 305 1.005215 CCCTCCTTTGCATCCAGAACT 59.995 52.381 0.00 0.00 0.00 3.01
305 306 1.467920 CCCTCCTTTGCATCCAGAAC 58.532 55.000 0.00 0.00 0.00 3.01
306 307 0.323725 GCCCTCCTTTGCATCCAGAA 60.324 55.000 0.00 0.00 0.00 3.02
307 308 1.304282 GCCCTCCTTTGCATCCAGA 59.696 57.895 0.00 0.00 0.00 3.86
308 309 2.117156 CGCCCTCCTTTGCATCCAG 61.117 63.158 0.00 0.00 0.00 3.86
309 310 2.045045 CGCCCTCCTTTGCATCCA 60.045 61.111 0.00 0.00 0.00 3.41
310 311 2.830370 CCGCCCTCCTTTGCATCC 60.830 66.667 0.00 0.00 0.00 3.51
311 312 1.821332 CTCCGCCCTCCTTTGCATC 60.821 63.158 0.00 0.00 0.00 3.91
312 313 2.273449 CTCCGCCCTCCTTTGCAT 59.727 61.111 0.00 0.00 0.00 3.96
313 314 4.722700 GCTCCGCCCTCCTTTGCA 62.723 66.667 0.00 0.00 0.00 4.08
315 316 4.082523 TCGCTCCGCCCTCCTTTG 62.083 66.667 0.00 0.00 0.00 2.77
316 317 3.775654 CTCGCTCCGCCCTCCTTT 61.776 66.667 0.00 0.00 0.00 3.11
327 328 4.854784 TCGATGCACGGCTCGCTC 62.855 66.667 2.57 0.00 42.82 5.03
328 329 4.435436 TTCGATGCACGGCTCGCT 62.435 61.111 2.57 0.00 42.82 4.93
329 330 4.210304 GTTCGATGCACGGCTCGC 62.210 66.667 2.57 0.00 42.82 5.03
330 331 3.902063 CGTTCGATGCACGGCTCG 61.902 66.667 0.98 0.98 42.82 5.03
335 336 1.416049 CTTGTCCGTTCGATGCACG 59.584 57.895 1.16 1.16 44.09 5.34
336 337 1.132640 GCTTGTCCGTTCGATGCAC 59.867 57.895 0.00 0.00 0.00 4.57
337 338 0.673333 ATGCTTGTCCGTTCGATGCA 60.673 50.000 0.00 0.00 0.00 3.96
338 339 0.247814 CATGCTTGTCCGTTCGATGC 60.248 55.000 0.00 0.00 0.00 3.91
339 340 1.078709 ACATGCTTGTCCGTTCGATG 58.921 50.000 0.00 0.00 0.00 3.84
340 341 1.078709 CACATGCTTGTCCGTTCGAT 58.921 50.000 1.56 0.00 32.34 3.59
341 342 1.565156 GCACATGCTTGTCCGTTCGA 61.565 55.000 1.56 0.00 38.21 3.71
342 343 1.154413 GCACATGCTTGTCCGTTCG 60.154 57.895 1.56 0.00 38.21 3.95
343 344 1.154413 CGCACATGCTTGTCCGTTC 60.154 57.895 7.84 0.00 32.28 3.95
344 345 2.616330 CCGCACATGCTTGTCCGTT 61.616 57.895 14.16 0.00 35.19 4.44
345 346 3.049674 CCGCACATGCTTGTCCGT 61.050 61.111 14.16 0.00 35.19 4.69
346 347 2.244436 CTTCCGCACATGCTTGTCCG 62.244 60.000 8.98 8.98 36.76 4.79
347 348 1.503542 CTTCCGCACATGCTTGTCC 59.496 57.895 1.56 0.00 39.32 4.02
348 349 0.955428 TCCTTCCGCACATGCTTGTC 60.955 55.000 1.56 0.00 39.32 3.18
349 350 0.537143 TTCCTTCCGCACATGCTTGT 60.537 50.000 0.00 0.00 39.32 3.16
350 351 0.109597 GTTCCTTCCGCACATGCTTG 60.110 55.000 1.82 0.00 39.32 4.01
351 352 0.250901 AGTTCCTTCCGCACATGCTT 60.251 50.000 1.82 0.00 39.32 3.91
352 353 0.957395 CAGTTCCTTCCGCACATGCT 60.957 55.000 1.82 0.00 39.32 3.79
353 354 1.503542 CAGTTCCTTCCGCACATGC 59.496 57.895 0.00 0.00 37.78 4.06
354 355 1.926511 GCCAGTTCCTTCCGCACATG 61.927 60.000 0.00 0.00 0.00 3.21
355 356 1.675641 GCCAGTTCCTTCCGCACAT 60.676 57.895 0.00 0.00 0.00 3.21
356 357 2.281484 GCCAGTTCCTTCCGCACA 60.281 61.111 0.00 0.00 0.00 4.57
357 358 3.423154 CGCCAGTTCCTTCCGCAC 61.423 66.667 0.00 0.00 0.00 5.34
358 359 4.697756 CCGCCAGTTCCTTCCGCA 62.698 66.667 0.00 0.00 0.00 5.69
359 360 3.894547 TTCCGCCAGTTCCTTCCGC 62.895 63.158 0.00 0.00 0.00 5.54
360 361 1.741770 CTTCCGCCAGTTCCTTCCG 60.742 63.158 0.00 0.00 0.00 4.30
361 362 2.041115 GCTTCCGCCAGTTCCTTCC 61.041 63.158 0.00 0.00 0.00 3.46
362 363 3.579685 GCTTCCGCCAGTTCCTTC 58.420 61.111 0.00 0.00 0.00 3.46
372 373 1.372375 GCTCGATCTAGGCTTCCGC 60.372 63.158 0.00 0.00 0.00 5.54
373 374 0.039617 CAGCTCGATCTAGGCTTCCG 60.040 60.000 0.00 0.00 33.74 4.30
374 375 0.316841 CCAGCTCGATCTAGGCTTCC 59.683 60.000 0.00 0.00 33.74 3.46
375 376 0.316841 CCCAGCTCGATCTAGGCTTC 59.683 60.000 0.00 0.00 33.74 3.86
376 377 0.105964 TCCCAGCTCGATCTAGGCTT 60.106 55.000 0.00 0.00 33.74 4.35
377 378 0.825840 GTCCCAGCTCGATCTAGGCT 60.826 60.000 0.00 0.00 36.70 4.58
378 379 1.663173 GTCCCAGCTCGATCTAGGC 59.337 63.158 0.00 0.00 0.00 3.93
379 380 0.178975 AGGTCCCAGCTCGATCTAGG 60.179 60.000 0.00 0.00 0.00 3.02
380 381 2.156098 GTAGGTCCCAGCTCGATCTAG 58.844 57.143 1.27 0.00 0.00 2.43
381 382 1.542767 CGTAGGTCCCAGCTCGATCTA 60.543 57.143 0.00 0.00 0.00 1.98
382 383 0.820074 CGTAGGTCCCAGCTCGATCT 60.820 60.000 0.00 0.00 0.00 2.75
383 384 1.102222 ACGTAGGTCCCAGCTCGATC 61.102 60.000 0.00 0.00 0.00 3.69
384 385 1.076923 ACGTAGGTCCCAGCTCGAT 60.077 57.895 0.00 0.00 0.00 3.59
385 386 1.748122 GACGTAGGTCCCAGCTCGA 60.748 63.158 4.15 0.00 37.19 4.04
386 387 2.799371 GACGTAGGTCCCAGCTCG 59.201 66.667 4.15 0.00 37.19 5.03
387 388 1.748122 TCGACGTAGGTCCCAGCTC 60.748 63.158 9.86 0.00 40.17 4.09
388 389 2.045131 GTCGACGTAGGTCCCAGCT 61.045 63.158 9.86 0.00 40.17 4.24
389 390 2.488820 GTCGACGTAGGTCCCAGC 59.511 66.667 9.86 0.00 40.17 4.85
390 391 1.378250 AGGTCGACGTAGGTCCCAG 60.378 63.158 9.40 0.00 40.17 4.45
391 392 1.676635 CAGGTCGACGTAGGTCCCA 60.677 63.158 10.91 0.00 40.17 4.37
392 393 2.413142 CCAGGTCGACGTAGGTCCC 61.413 68.421 10.91 6.40 40.17 4.46
393 394 2.413142 CCCAGGTCGACGTAGGTCC 61.413 68.421 13.65 0.00 40.17 4.46
394 395 1.377725 TCCCAGGTCGACGTAGGTC 60.378 63.158 19.72 5.47 39.89 3.85
395 396 1.676967 GTCCCAGGTCGACGTAGGT 60.677 63.158 19.72 0.00 0.00 3.08
396 397 2.758089 CGTCCCAGGTCGACGTAGG 61.758 68.421 15.42 15.42 46.17 3.18
397 398 2.789917 CGTCCCAGGTCGACGTAG 59.210 66.667 10.91 3.31 46.17 3.51
401 402 0.179134 CTTCATCGTCCCAGGTCGAC 60.179 60.000 7.13 7.13 38.31 4.20
402 403 0.323087 TCTTCATCGTCCCAGGTCGA 60.323 55.000 8.42 8.42 39.57 4.20
403 404 0.747255 ATCTTCATCGTCCCAGGTCG 59.253 55.000 0.00 0.00 0.00 4.79
404 405 1.069358 GGATCTTCATCGTCCCAGGTC 59.931 57.143 0.00 0.00 0.00 3.85
405 406 1.123928 GGATCTTCATCGTCCCAGGT 58.876 55.000 0.00 0.00 0.00 4.00
406 407 1.342819 GAGGATCTTCATCGTCCCAGG 59.657 57.143 0.00 0.00 37.78 4.45
407 408 1.000827 CGAGGATCTTCATCGTCCCAG 60.001 57.143 5.61 0.00 44.47 4.45
408 409 1.032794 CGAGGATCTTCATCGTCCCA 58.967 55.000 5.61 0.00 44.47 4.37
409 410 3.875838 CGAGGATCTTCATCGTCCC 57.124 57.895 5.61 0.00 44.47 4.46
414 415 0.671251 AGCGACCGAGGATCTTCATC 59.329 55.000 5.61 1.26 0.00 2.92
415 416 0.671251 GAGCGACCGAGGATCTTCAT 59.329 55.000 5.61 0.00 0.00 2.57
416 417 1.715862 CGAGCGACCGAGGATCTTCA 61.716 60.000 5.61 0.00 0.00 3.02
417 418 1.009449 CGAGCGACCGAGGATCTTC 60.009 63.158 0.00 0.00 0.00 2.87
418 419 1.451567 TCGAGCGACCGAGGATCTT 60.452 57.895 0.00 0.00 34.19 2.40
419 420 2.181521 GTCGAGCGACCGAGGATCT 61.182 63.158 11.70 0.00 39.43 2.75
420 421 2.328639 GTCGAGCGACCGAGGATC 59.671 66.667 11.70 0.00 39.43 3.36
421 422 3.574445 CGTCGAGCGACCGAGGAT 61.574 66.667 16.35 0.00 44.30 3.24
431 432 4.887763 ATAAAAATAGATCGCGTCGAGC 57.112 40.909 5.77 9.00 42.87 5.03
432 433 6.943311 GCTAAATAAAAATAGATCGCGTCGAG 59.057 38.462 5.77 0.00 39.91 4.04
433 434 6.398205 CGCTAAATAAAAATAGATCGCGTCGA 60.398 38.462 5.77 4.51 41.13 4.20
434 435 5.717649 CGCTAAATAAAAATAGATCGCGTCG 59.282 40.000 5.77 0.00 33.11 5.12
435 436 6.578691 ACGCTAAATAAAAATAGATCGCGTC 58.421 36.000 5.77 2.98 45.62 5.19
436 437 6.520792 ACGCTAAATAAAAATAGATCGCGT 57.479 33.333 5.77 0.00 44.19 6.01
437 438 6.007677 GGACGCTAAATAAAAATAGATCGCG 58.992 40.000 0.00 0.00 42.17 5.87
438 439 7.118422 AGGACGCTAAATAAAAATAGATCGC 57.882 36.000 0.00 0.00 0.00 4.58
439 440 9.931210 AAAAGGACGCTAAATAAAAATAGATCG 57.069 29.630 0.00 0.00 0.00 3.69
475 476 9.613428 ACAAGCAAGTTCATACTATGCTAAATA 57.387 29.630 12.13 0.00 42.51 1.40
476 477 8.400947 CACAAGCAAGTTCATACTATGCTAAAT 58.599 33.333 12.13 3.44 42.51 1.40
477 478 7.148255 CCACAAGCAAGTTCATACTATGCTAAA 60.148 37.037 12.13 0.00 42.51 1.85
478 479 6.316140 CCACAAGCAAGTTCATACTATGCTAA 59.684 38.462 12.13 0.00 42.51 3.09
479 480 5.817296 CCACAAGCAAGTTCATACTATGCTA 59.183 40.000 12.13 0.00 42.51 3.49
480 481 4.637534 CCACAAGCAAGTTCATACTATGCT 59.362 41.667 0.00 0.00 43.82 3.79
481 482 4.396166 ACCACAAGCAAGTTCATACTATGC 59.604 41.667 0.00 0.00 38.02 3.14
482 483 7.254898 CCATACCACAAGCAAGTTCATACTATG 60.255 40.741 0.00 0.00 33.17 2.23
483 484 6.767902 CCATACCACAAGCAAGTTCATACTAT 59.232 38.462 0.00 0.00 33.17 2.12
484 485 6.070481 TCCATACCACAAGCAAGTTCATACTA 60.070 38.462 0.00 0.00 33.17 1.82
485 486 4.943705 CCATACCACAAGCAAGTTCATACT 59.056 41.667 0.00 0.00 35.68 2.12
486 487 4.941263 TCCATACCACAAGCAAGTTCATAC 59.059 41.667 0.00 0.00 0.00 2.39
487 488 5.172687 TCCATACCACAAGCAAGTTCATA 57.827 39.130 0.00 0.00 0.00 2.15
488 489 4.012374 CTCCATACCACAAGCAAGTTCAT 58.988 43.478 0.00 0.00 0.00 2.57
489 490 3.411446 CTCCATACCACAAGCAAGTTCA 58.589 45.455 0.00 0.00 0.00 3.18
490 491 2.162408 GCTCCATACCACAAGCAAGTTC 59.838 50.000 0.00 0.00 34.86 3.01
491 492 2.162681 GCTCCATACCACAAGCAAGTT 58.837 47.619 0.00 0.00 34.86 2.66
492 493 1.352352 AGCTCCATACCACAAGCAAGT 59.648 47.619 0.00 0.00 37.22 3.16
493 494 2.119801 AGCTCCATACCACAAGCAAG 57.880 50.000 0.00 0.00 37.22 4.01
494 495 2.161855 CAAGCTCCATACCACAAGCAA 58.838 47.619 0.00 0.00 37.22 3.91
495 496 1.350684 TCAAGCTCCATACCACAAGCA 59.649 47.619 0.00 0.00 37.22 3.91
496 497 2.113860 TCAAGCTCCATACCACAAGC 57.886 50.000 0.00 0.00 34.95 4.01
497 498 3.438087 CAGTTCAAGCTCCATACCACAAG 59.562 47.826 0.00 0.00 0.00 3.16
498 499 3.181445 ACAGTTCAAGCTCCATACCACAA 60.181 43.478 0.00 0.00 0.00 3.33
499 500 2.371841 ACAGTTCAAGCTCCATACCACA 59.628 45.455 0.00 0.00 0.00 4.17
500 501 2.744202 CACAGTTCAAGCTCCATACCAC 59.256 50.000 0.00 0.00 0.00 4.16
501 502 2.875672 GCACAGTTCAAGCTCCATACCA 60.876 50.000 0.00 0.00 0.00 3.25
502 503 1.740025 GCACAGTTCAAGCTCCATACC 59.260 52.381 0.00 0.00 0.00 2.73
503 504 2.704572 AGCACAGTTCAAGCTCCATAC 58.295 47.619 0.00 0.00 32.05 2.39
504 505 4.162131 TCATAGCACAGTTCAAGCTCCATA 59.838 41.667 0.00 0.00 39.68 2.74
505 506 3.054875 TCATAGCACAGTTCAAGCTCCAT 60.055 43.478 0.00 0.00 39.68 3.41
506 507 2.302733 TCATAGCACAGTTCAAGCTCCA 59.697 45.455 0.00 0.00 39.68 3.86
507 508 2.977914 TCATAGCACAGTTCAAGCTCC 58.022 47.619 0.00 0.00 39.68 4.70
508 509 5.557891 AATTCATAGCACAGTTCAAGCTC 57.442 39.130 0.00 0.00 39.68 4.09
509 510 8.781196 CATATAATTCATAGCACAGTTCAAGCT 58.219 33.333 0.00 0.00 42.14 3.74
510 511 8.562892 ACATATAATTCATAGCACAGTTCAAGC 58.437 33.333 0.00 0.00 0.00 4.01
513 514 9.394767 ACAACATATAATTCATAGCACAGTTCA 57.605 29.630 0.00 0.00 0.00 3.18
533 534 8.963130 CACGTACAAACAAATATGAAACAACAT 58.037 29.630 0.00 0.00 0.00 2.71
534 535 8.182227 TCACGTACAAACAAATATGAAACAACA 58.818 29.630 0.00 0.00 0.00 3.33
535 536 8.549777 TCACGTACAAACAAATATGAAACAAC 57.450 30.769 0.00 0.00 0.00 3.32
536 537 9.737427 AATCACGTACAAACAAATATGAAACAA 57.263 25.926 0.00 0.00 0.00 2.83
537 538 9.737427 AAATCACGTACAAACAAATATGAAACA 57.263 25.926 0.00 0.00 0.00 2.83
545 546 8.918961 TTGAGAAAAATCACGTACAAACAAAT 57.081 26.923 0.00 0.00 0.00 2.32
546 547 7.008810 GCTTGAGAAAAATCACGTACAAACAAA 59.991 33.333 0.00 0.00 0.00 2.83
547 548 6.470877 GCTTGAGAAAAATCACGTACAAACAA 59.529 34.615 0.00 0.00 0.00 2.83
548 549 5.968848 GCTTGAGAAAAATCACGTACAAACA 59.031 36.000 0.00 0.00 0.00 2.83
549 550 5.968848 TGCTTGAGAAAAATCACGTACAAAC 59.031 36.000 0.00 0.00 0.00 2.93
550 551 6.125327 TGCTTGAGAAAAATCACGTACAAA 57.875 33.333 0.00 0.00 0.00 2.83
551 552 5.743026 TGCTTGAGAAAAATCACGTACAA 57.257 34.783 0.00 0.00 0.00 2.41
552 553 5.468409 TGATGCTTGAGAAAAATCACGTACA 59.532 36.000 0.00 0.00 0.00 2.90
553 554 5.927030 TGATGCTTGAGAAAAATCACGTAC 58.073 37.500 0.00 0.00 0.00 3.67
554 555 5.390885 GCTGATGCTTGAGAAAAATCACGTA 60.391 40.000 0.00 0.00 36.03 3.57
555 556 4.614535 GCTGATGCTTGAGAAAAATCACGT 60.615 41.667 0.00 0.00 36.03 4.49
556 557 3.850273 GCTGATGCTTGAGAAAAATCACG 59.150 43.478 0.00 0.00 36.03 4.35
571 572 3.260483 CTCGCGACCAGCTGATGC 61.260 66.667 17.39 14.61 45.59 3.91
572 573 3.260483 GCTCGCGACCAGCTGATG 61.260 66.667 17.39 5.30 45.59 3.07
573 574 4.862092 CGCTCGCGACCAGCTGAT 62.862 66.667 17.39 0.00 45.59 2.90
584 585 1.154282 GGTAAAAACCAGCGCTCGC 60.154 57.895 7.13 6.09 42.33 5.03
585 586 0.110373 GTGGTAAAAACCAGCGCTCG 60.110 55.000 7.13 2.49 41.00 5.03
586 587 0.110373 CGTGGTAAAAACCAGCGCTC 60.110 55.000 7.13 0.00 41.00 5.03
587 588 0.816421 ACGTGGTAAAAACCAGCGCT 60.816 50.000 2.64 2.64 41.00 5.92
588 589 0.385098 GACGTGGTAAAAACCAGCGC 60.385 55.000 0.00 0.00 41.00 5.92
589 590 1.223187 AGACGTGGTAAAAACCAGCG 58.777 50.000 0.00 13.94 41.00 5.18
590 591 4.530388 GTTAAGACGTGGTAAAAACCAGC 58.470 43.478 0.00 0.00 41.00 4.85
591 592 4.764940 CGTTAAGACGTGGTAAAAACCAG 58.235 43.478 0.00 0.00 44.08 4.00
592 593 4.792528 CGTTAAGACGTGGTAAAAACCA 57.207 40.909 0.00 0.00 44.08 3.67
614 615 6.048073 TGCAAAATTTAGCGTGCTCTATAG 57.952 37.500 12.47 0.00 37.87 1.31
615 616 5.504010 GCTGCAAAATTTAGCGTGCTCTATA 60.504 40.000 12.47 0.00 37.87 1.31
616 617 4.731773 GCTGCAAAATTTAGCGTGCTCTAT 60.732 41.667 12.47 0.00 37.87 1.98
617 618 3.426159 GCTGCAAAATTTAGCGTGCTCTA 60.426 43.478 12.47 0.00 37.87 2.43
618 619 2.669391 GCTGCAAAATTTAGCGTGCTCT 60.669 45.455 12.47 0.00 37.87 4.09
619 620 1.650645 GCTGCAAAATTTAGCGTGCTC 59.349 47.619 12.47 3.10 37.87 4.26
620 621 1.701704 GCTGCAAAATTTAGCGTGCT 58.298 45.000 12.47 0.00 37.87 4.40
625 626 2.253603 CCTGACGCTGCAAAATTTAGC 58.746 47.619 0.00 1.94 0.00 3.09
626 627 3.559238 ACCTGACGCTGCAAAATTTAG 57.441 42.857 0.00 0.00 0.00 1.85
627 628 5.440234 TTTACCTGACGCTGCAAAATTTA 57.560 34.783 0.00 0.00 0.00 1.40
628 629 4.298332 CTTTACCTGACGCTGCAAAATTT 58.702 39.130 0.00 0.00 0.00 1.82
629 630 3.857010 GCTTTACCTGACGCTGCAAAATT 60.857 43.478 0.00 0.00 0.00 1.82
630 631 2.351738 GCTTTACCTGACGCTGCAAAAT 60.352 45.455 0.00 0.00 0.00 1.82
631 632 1.001815 GCTTTACCTGACGCTGCAAAA 60.002 47.619 0.00 0.00 0.00 2.44
632 633 0.591170 GCTTTACCTGACGCTGCAAA 59.409 50.000 0.00 0.00 0.00 3.68
633 634 0.533978 TGCTTTACCTGACGCTGCAA 60.534 50.000 0.00 0.00 0.00 4.08
634 635 0.533978 TTGCTTTACCTGACGCTGCA 60.534 50.000 0.00 0.00 0.00 4.41
635 636 0.110192 GTTGCTTTACCTGACGCTGC 60.110 55.000 0.00 0.00 0.00 5.25
636 637 0.517316 GGTTGCTTTACCTGACGCTG 59.483 55.000 0.00 0.00 35.23 5.18
637 638 0.107831 TGGTTGCTTTACCTGACGCT 59.892 50.000 0.00 0.00 39.04 5.07
638 639 0.237498 GTGGTTGCTTTACCTGACGC 59.763 55.000 0.00 0.00 39.04 5.19
639 640 0.872388 GGTGGTTGCTTTACCTGACG 59.128 55.000 0.00 0.00 39.04 4.35
640 641 1.202891 AGGGTGGTTGCTTTACCTGAC 60.203 52.381 0.00 0.00 39.04 3.51
641 642 1.073284 GAGGGTGGTTGCTTTACCTGA 59.927 52.381 0.00 0.00 39.04 3.86
642 643 1.073923 AGAGGGTGGTTGCTTTACCTG 59.926 52.381 0.00 0.00 39.04 4.00
643 644 1.351350 GAGAGGGTGGTTGCTTTACCT 59.649 52.381 0.00 0.00 39.04 3.08
644 645 1.822506 GAGAGGGTGGTTGCTTTACC 58.177 55.000 0.00 0.00 38.73 2.85
645 646 1.439679 CGAGAGGGTGGTTGCTTTAC 58.560 55.000 0.00 0.00 0.00 2.01
646 647 0.321298 GCGAGAGGGTGGTTGCTTTA 60.321 55.000 0.00 0.00 0.00 1.85
647 648 1.600916 GCGAGAGGGTGGTTGCTTT 60.601 57.895 0.00 0.00 0.00 3.51
648 649 2.032681 GCGAGAGGGTGGTTGCTT 59.967 61.111 0.00 0.00 0.00 3.91
649 650 2.925170 AGCGAGAGGGTGGTTGCT 60.925 61.111 0.00 0.00 0.00 3.91
650 651 2.743928 CAGCGAGAGGGTGGTTGC 60.744 66.667 0.00 0.00 40.47 4.17
651 652 2.743928 GCAGCGAGAGGGTGGTTG 60.744 66.667 0.00 0.00 44.32 3.77
652 653 3.241530 TGCAGCGAGAGGGTGGTT 61.242 61.111 0.00 0.00 44.32 3.67
653 654 4.008933 GTGCAGCGAGAGGGTGGT 62.009 66.667 0.00 0.00 44.32 4.16
664 665 2.865151 CGTTTTAGCGCGTGCAGC 60.865 61.111 24.79 3.47 46.23 5.25
672 673 3.792956 TCCGAAATACTAGCGTTTTAGCG 59.207 43.478 0.00 0.00 43.00 4.26
673 674 4.317909 GCTCCGAAATACTAGCGTTTTAGC 60.318 45.833 0.00 0.00 37.41 3.09
674 675 4.802039 TGCTCCGAAATACTAGCGTTTTAG 59.198 41.667 0.00 0.00 37.80 1.85
675 676 4.746729 TGCTCCGAAATACTAGCGTTTTA 58.253 39.130 0.00 0.00 37.80 1.52
676 677 3.592059 TGCTCCGAAATACTAGCGTTTT 58.408 40.909 0.00 0.00 37.80 2.43
677 678 3.241067 TGCTCCGAAATACTAGCGTTT 57.759 42.857 0.00 0.00 37.80 3.60
678 679 2.928116 GTTGCTCCGAAATACTAGCGTT 59.072 45.455 0.00 0.00 37.80 4.84
679 680 2.094390 TGTTGCTCCGAAATACTAGCGT 60.094 45.455 0.00 0.00 37.80 5.07
680 681 2.536365 TGTTGCTCCGAAATACTAGCG 58.464 47.619 0.00 0.00 37.80 4.26
681 682 4.939509 TTTGTTGCTCCGAAATACTAGC 57.060 40.909 0.00 0.00 35.51 3.42
682 683 7.305474 ACAAATTTGTTGCTCCGAAATACTAG 58.695 34.615 18.13 0.00 38.47 2.57
683 684 7.209471 ACAAATTTGTTGCTCCGAAATACTA 57.791 32.000 18.13 0.00 38.47 1.82
684 685 6.084326 ACAAATTTGTTGCTCCGAAATACT 57.916 33.333 18.13 0.00 38.47 2.12
696 697 8.032104 GCATCTCGCACTAAAACAAATTTGTTG 61.032 37.037 31.54 22.62 44.99 3.33
697 698 6.074356 GCATCTCGCACTAAAACAAATTTGTT 60.074 34.615 27.01 27.01 46.47 2.83
698 699 5.402270 GCATCTCGCACTAAAACAAATTTGT 59.598 36.000 18.13 18.13 41.54 2.83
699 700 5.630680 AGCATCTCGCACTAAAACAAATTTG 59.369 36.000 16.67 16.67 46.13 2.32
700 701 5.772521 AGCATCTCGCACTAAAACAAATTT 58.227 33.333 0.00 0.00 46.13 1.82
701 702 5.376854 AGCATCTCGCACTAAAACAAATT 57.623 34.783 0.00 0.00 46.13 1.82
702 703 4.974591 GAGCATCTCGCACTAAAACAAAT 58.025 39.130 0.00 0.00 46.13 2.32
703 704 4.404507 GAGCATCTCGCACTAAAACAAA 57.595 40.909 0.00 0.00 46.13 2.83
718 719 3.648009 CGGTGAAGAGGATAAGAGCATC 58.352 50.000 0.00 0.00 0.00 3.91
719 720 2.224161 GCGGTGAAGAGGATAAGAGCAT 60.224 50.000 0.00 0.00 0.00 3.79
720 721 1.137086 GCGGTGAAGAGGATAAGAGCA 59.863 52.381 0.00 0.00 0.00 4.26
721 722 1.859383 GCGGTGAAGAGGATAAGAGC 58.141 55.000 0.00 0.00 0.00 4.09
722 723 1.676529 TCGCGGTGAAGAGGATAAGAG 59.323 52.381 6.13 0.00 0.00 2.85
723 724 1.404391 GTCGCGGTGAAGAGGATAAGA 59.596 52.381 6.13 0.00 0.00 2.10
724 725 1.405821 AGTCGCGGTGAAGAGGATAAG 59.594 52.381 6.13 0.00 0.00 1.73
725 726 1.134367 CAGTCGCGGTGAAGAGGATAA 59.866 52.381 6.13 0.00 0.00 1.75
726 727 0.738975 CAGTCGCGGTGAAGAGGATA 59.261 55.000 6.13 0.00 0.00 2.59
727 728 1.513158 CAGTCGCGGTGAAGAGGAT 59.487 57.895 6.13 0.00 0.00 3.24
728 729 2.962569 CAGTCGCGGTGAAGAGGA 59.037 61.111 6.13 0.00 0.00 3.71
729 730 2.811317 GCAGTCGCGGTGAAGAGG 60.811 66.667 6.13 0.00 0.00 3.69
730 731 2.091112 CAGCAGTCGCGGTGAAGAG 61.091 63.158 6.13 0.00 45.49 2.85
731 732 2.049156 CAGCAGTCGCGGTGAAGA 60.049 61.111 6.13 0.00 45.49 2.87
732 733 3.114616 CCAGCAGTCGCGGTGAAG 61.115 66.667 6.13 0.62 45.49 3.02
733 734 4.680237 CCCAGCAGTCGCGGTGAA 62.680 66.667 6.13 0.00 45.49 3.18
761 762 2.753043 GATGTGCTGTGGGGCCAG 60.753 66.667 4.39 0.00 35.49 4.85
762 763 4.365111 GGATGTGCTGTGGGGCCA 62.365 66.667 4.39 0.00 0.00 5.36
765 766 3.976701 GACGGGATGTGCTGTGGGG 62.977 68.421 0.00 0.00 0.00 4.96
766 767 2.436646 GACGGGATGTGCTGTGGG 60.437 66.667 0.00 0.00 0.00 4.61
767 768 2.436646 GGACGGGATGTGCTGTGG 60.437 66.667 0.00 0.00 35.76 4.17
768 769 2.436646 GGGACGGGATGTGCTGTG 60.437 66.667 0.00 0.00 39.22 3.66
769 770 1.779061 AAAGGGACGGGATGTGCTGT 61.779 55.000 0.00 0.00 39.22 4.40
770 771 0.609131 AAAAGGGACGGGATGTGCTG 60.609 55.000 0.00 0.00 39.22 4.41
771 772 0.322546 GAAAAGGGACGGGATGTGCT 60.323 55.000 0.00 0.00 39.22 4.40
772 773 0.322546 AGAAAAGGGACGGGATGTGC 60.323 55.000 0.00 0.00 38.37 4.57
773 774 2.084546 GAAGAAAAGGGACGGGATGTG 58.915 52.381 0.00 0.00 0.00 3.21
774 775 1.004394 GGAAGAAAAGGGACGGGATGT 59.996 52.381 0.00 0.00 0.00 3.06
775 776 1.282157 AGGAAGAAAAGGGACGGGATG 59.718 52.381 0.00 0.00 0.00 3.51
776 777 1.282157 CAGGAAGAAAAGGGACGGGAT 59.718 52.381 0.00 0.00 0.00 3.85
777 778 0.690762 CAGGAAGAAAAGGGACGGGA 59.309 55.000 0.00 0.00 0.00 5.14
778 779 0.960861 GCAGGAAGAAAAGGGACGGG 60.961 60.000 0.00 0.00 0.00 5.28
779 780 0.960861 GGCAGGAAGAAAAGGGACGG 60.961 60.000 0.00 0.00 0.00 4.79
780 781 1.298859 CGGCAGGAAGAAAAGGGACG 61.299 60.000 0.00 0.00 0.00 4.79
781 782 0.250770 ACGGCAGGAAGAAAAGGGAC 60.251 55.000 0.00 0.00 0.00 4.46
782 783 0.250727 CACGGCAGGAAGAAAAGGGA 60.251 55.000 0.00 0.00 0.00 4.20
783 784 1.866853 GCACGGCAGGAAGAAAAGGG 61.867 60.000 0.00 0.00 0.00 3.95
784 785 1.581447 GCACGGCAGGAAGAAAAGG 59.419 57.895 0.00 0.00 0.00 3.11
785 786 1.581447 GGCACGGCAGGAAGAAAAG 59.419 57.895 0.00 0.00 0.00 2.27
786 787 1.901464 GGGCACGGCAGGAAGAAAA 60.901 57.895 0.00 0.00 0.00 2.29
787 788 2.282180 GGGCACGGCAGGAAGAAA 60.282 61.111 0.00 0.00 0.00 2.52
788 789 3.565214 TGGGCACGGCAGGAAGAA 61.565 61.111 0.00 0.00 0.00 2.52
789 790 4.329545 GTGGGCACGGCAGGAAGA 62.330 66.667 0.00 0.00 0.00 2.87
806 807 3.144120 ATAGGCAGGAGCAGCGTCG 62.144 63.158 0.00 0.00 44.61 5.12
807 808 1.300542 GATAGGCAGGAGCAGCGTC 60.301 63.158 0.00 0.00 44.61 5.19
808 809 0.468214 TAGATAGGCAGGAGCAGCGT 60.468 55.000 0.00 0.00 44.61 5.07
809 810 0.038709 GTAGATAGGCAGGAGCAGCG 60.039 60.000 0.00 0.00 44.61 5.18
810 811 1.337118 AGTAGATAGGCAGGAGCAGC 58.663 55.000 0.00 0.00 44.61 5.25
811 812 4.414337 AAAAGTAGATAGGCAGGAGCAG 57.586 45.455 0.00 0.00 44.61 4.24
812 813 5.602561 TGATAAAAGTAGATAGGCAGGAGCA 59.397 40.000 0.00 0.00 44.61 4.26
813 814 6.015010 TCTGATAAAAGTAGATAGGCAGGAGC 60.015 42.308 0.00 0.00 41.10 4.70
814 815 7.375053 GTCTGATAAAAGTAGATAGGCAGGAG 58.625 42.308 0.00 0.00 0.00 3.69
815 816 6.016192 CGTCTGATAAAAGTAGATAGGCAGGA 60.016 42.308 0.00 0.00 0.00 3.86
816 817 6.153067 CGTCTGATAAAAGTAGATAGGCAGG 58.847 44.000 0.00 0.00 0.00 4.85
817 818 5.631512 GCGTCTGATAAAAGTAGATAGGCAG 59.368 44.000 0.00 0.00 0.00 4.85
818 819 5.509163 GGCGTCTGATAAAAGTAGATAGGCA 60.509 44.000 0.00 0.00 31.74 4.75
819 820 4.924462 GGCGTCTGATAAAAGTAGATAGGC 59.076 45.833 0.00 0.00 0.00 3.93
820 821 6.085555 TGGCGTCTGATAAAAGTAGATAGG 57.914 41.667 0.00 0.00 0.00 2.57
821 822 7.359598 GCAATGGCGTCTGATAAAAGTAGATAG 60.360 40.741 0.00 0.00 0.00 2.08
822 823 6.423905 GCAATGGCGTCTGATAAAAGTAGATA 59.576 38.462 0.00 0.00 0.00 1.98
823 824 5.237344 GCAATGGCGTCTGATAAAAGTAGAT 59.763 40.000 0.00 0.00 0.00 1.98
824 825 4.570772 GCAATGGCGTCTGATAAAAGTAGA 59.429 41.667 0.00 0.00 0.00 2.59
825 826 4.837567 GCAATGGCGTCTGATAAAAGTAG 58.162 43.478 0.00 0.00 0.00 2.57
826 827 4.875544 GCAATGGCGTCTGATAAAAGTA 57.124 40.909 0.00 0.00 0.00 2.24
827 828 3.764885 GCAATGGCGTCTGATAAAAGT 57.235 42.857 0.00 0.00 0.00 2.66
869 870 3.665675 CTTCGTGGGGAGGAAGGCG 62.666 68.421 0.00 0.00 36.78 5.52
870 871 2.269241 CTTCGTGGGGAGGAAGGC 59.731 66.667 0.00 0.00 36.78 4.35
871 872 2.269241 GCTTCGTGGGGAGGAAGG 59.731 66.667 0.00 0.00 39.96 3.46
872 873 2.269241 GGCTTCGTGGGGAGGAAG 59.731 66.667 0.00 0.00 41.96 3.46
873 874 3.702048 CGGCTTCGTGGGGAGGAA 61.702 66.667 0.00 0.00 0.00 3.36
882 883 2.893404 ACAACAACGCGGCTTCGT 60.893 55.556 12.47 0.00 45.58 3.85
883 884 2.425124 CACAACAACGCGGCTTCG 60.425 61.111 12.47 0.00 0.00 3.79
884 885 2.051345 CCACAACAACGCGGCTTC 60.051 61.111 12.47 0.00 0.00 3.86
885 886 2.515057 TCCACAACAACGCGGCTT 60.515 55.556 12.47 0.00 0.00 4.35
886 887 2.972505 CTCCACAACAACGCGGCT 60.973 61.111 12.47 0.00 0.00 5.52
887 888 4.683334 GCTCCACAACAACGCGGC 62.683 66.667 12.47 0.00 0.00 6.53
888 889 2.972505 AGCTCCACAACAACGCGG 60.973 61.111 12.47 0.00 0.00 6.46
889 890 2.249309 CAGCTCCACAACAACGCG 59.751 61.111 3.53 3.53 0.00 6.01
890 891 2.050985 GCAGCTCCACAACAACGC 60.051 61.111 0.00 0.00 0.00 4.84
891 892 1.280746 CAGCAGCTCCACAACAACG 59.719 57.895 0.00 0.00 0.00 4.10
892 893 1.008079 GCAGCAGCTCCACAACAAC 60.008 57.895 0.00 0.00 37.91 3.32
893 894 3.435590 GCAGCAGCTCCACAACAA 58.564 55.556 0.00 0.00 37.91 2.83
916 917 1.154197 CATAGCGATGGCATCCTGTG 58.846 55.000 21.20 20.38 43.41 3.66
917 918 0.035881 CCATAGCGATGGCATCCTGT 59.964 55.000 21.20 14.05 46.30 4.00
918 919 2.850439 CCATAGCGATGGCATCCTG 58.150 57.895 21.20 12.96 46.30 3.86
931 932 0.952280 CCATTGCAGCAGCTCCATAG 59.048 55.000 1.76 0.00 42.74 2.23
932 933 0.466739 CCCATTGCAGCAGCTCCATA 60.467 55.000 1.76 0.00 42.74 2.74
933 934 1.756950 CCCATTGCAGCAGCTCCAT 60.757 57.895 1.76 0.00 42.74 3.41
934 935 2.361992 CCCATTGCAGCAGCTCCA 60.362 61.111 1.76 0.00 42.74 3.86
935 936 3.145551 CCCCATTGCAGCAGCTCC 61.146 66.667 1.76 0.00 42.74 4.70
936 937 1.252904 TTTCCCCATTGCAGCAGCTC 61.253 55.000 1.76 0.00 42.74 4.09
937 938 1.228956 TTTCCCCATTGCAGCAGCT 60.229 52.632 1.76 0.00 42.74 4.24
938 939 1.217244 CTTTCCCCATTGCAGCAGC 59.783 57.895 0.00 0.00 42.57 5.25
939 940 0.901580 ACCTTTCCCCATTGCAGCAG 60.902 55.000 0.00 0.00 0.00 4.24
940 941 1.155859 ACCTTTCCCCATTGCAGCA 59.844 52.632 0.00 0.00 0.00 4.41
941 942 1.593265 CACCTTTCCCCATTGCAGC 59.407 57.895 0.00 0.00 0.00 5.25
942 943 1.186917 TGCACCTTTCCCCATTGCAG 61.187 55.000 0.00 0.00 38.25 4.41
943 944 0.762082 TTGCACCTTTCCCCATTGCA 60.762 50.000 0.00 0.00 41.33 4.08
944 945 0.037046 CTTGCACCTTTCCCCATTGC 60.037 55.000 0.00 0.00 0.00 3.56
945 946 0.037046 GCTTGCACCTTTCCCCATTG 60.037 55.000 0.00 0.00 0.00 2.82
946 947 1.194121 GGCTTGCACCTTTCCCCATT 61.194 55.000 0.00 0.00 0.00 3.16
947 948 1.610379 GGCTTGCACCTTTCCCCAT 60.610 57.895 0.00 0.00 0.00 4.00
948 949 2.203625 GGCTTGCACCTTTCCCCA 60.204 61.111 0.00 0.00 0.00 4.96
949 950 1.610379 ATGGCTTGCACCTTTCCCC 60.610 57.895 0.00 0.00 0.00 4.81
950 951 0.899717 TCATGGCTTGCACCTTTCCC 60.900 55.000 0.00 0.00 0.00 3.97
951 952 0.968405 TTCATGGCTTGCACCTTTCC 59.032 50.000 0.00 0.00 0.00 3.13
952 953 1.615392 AGTTCATGGCTTGCACCTTTC 59.385 47.619 0.00 0.00 0.00 2.62
953 954 1.708341 AGTTCATGGCTTGCACCTTT 58.292 45.000 0.00 0.00 0.00 3.11
954 955 2.558359 GTTAGTTCATGGCTTGCACCTT 59.442 45.455 0.00 0.00 0.00 3.50
955 956 2.162681 GTTAGTTCATGGCTTGCACCT 58.837 47.619 0.00 0.00 0.00 4.00
956 957 2.095059 CAGTTAGTTCATGGCTTGCACC 60.095 50.000 0.00 0.00 0.00 5.01
957 958 2.669391 GCAGTTAGTTCATGGCTTGCAC 60.669 50.000 0.00 0.00 0.00 4.57
958 959 1.541147 GCAGTTAGTTCATGGCTTGCA 59.459 47.619 0.00 0.00 0.00 4.08
959 960 1.541147 TGCAGTTAGTTCATGGCTTGC 59.459 47.619 0.00 0.19 0.00 4.01
960 961 3.254166 AGTTGCAGTTAGTTCATGGCTTG 59.746 43.478 0.00 0.00 0.00 4.01
961 962 3.490348 AGTTGCAGTTAGTTCATGGCTT 58.510 40.909 0.00 0.00 0.00 4.35
962 963 3.077359 GAGTTGCAGTTAGTTCATGGCT 58.923 45.455 0.00 0.00 0.00 4.75
963 964 3.077359 AGAGTTGCAGTTAGTTCATGGC 58.923 45.455 0.00 0.00 0.00 4.40
964 965 4.756642 TCAAGAGTTGCAGTTAGTTCATGG 59.243 41.667 0.00 0.00 0.00 3.66
965 966 5.929697 TCAAGAGTTGCAGTTAGTTCATG 57.070 39.130 0.00 0.00 0.00 3.07
966 967 5.050091 CGTTCAAGAGTTGCAGTTAGTTCAT 60.050 40.000 0.00 0.00 0.00 2.57
967 968 4.270084 CGTTCAAGAGTTGCAGTTAGTTCA 59.730 41.667 0.00 0.00 0.00 3.18
968 969 4.506654 TCGTTCAAGAGTTGCAGTTAGTTC 59.493 41.667 0.00 0.00 0.00 3.01
969 970 4.439057 TCGTTCAAGAGTTGCAGTTAGTT 58.561 39.130 0.00 0.00 0.00 2.24
970 971 4.054780 TCGTTCAAGAGTTGCAGTTAGT 57.945 40.909 0.00 0.00 0.00 2.24
971 972 4.745125 TCTTCGTTCAAGAGTTGCAGTTAG 59.255 41.667 0.00 0.00 36.08 2.34
972 973 4.506654 GTCTTCGTTCAAGAGTTGCAGTTA 59.493 41.667 0.00 0.00 42.13 2.24
973 974 3.309954 GTCTTCGTTCAAGAGTTGCAGTT 59.690 43.478 0.00 0.00 42.13 3.16
974 975 2.866762 GTCTTCGTTCAAGAGTTGCAGT 59.133 45.455 0.00 0.00 42.13 4.40
975 976 2.221981 GGTCTTCGTTCAAGAGTTGCAG 59.778 50.000 0.00 0.00 42.13 4.41
976 977 2.210116 GGTCTTCGTTCAAGAGTTGCA 58.790 47.619 0.00 0.00 42.13 4.08
977 978 2.032808 GTGGTCTTCGTTCAAGAGTTGC 60.033 50.000 0.00 0.00 42.13 4.17
978 979 2.544267 GGTGGTCTTCGTTCAAGAGTTG 59.456 50.000 0.00 0.00 42.13 3.16
979 980 2.169769 TGGTGGTCTTCGTTCAAGAGTT 59.830 45.455 0.00 0.00 42.13 3.01
980 981 1.760613 TGGTGGTCTTCGTTCAAGAGT 59.239 47.619 0.00 0.00 42.13 3.24
981 982 2.526304 TGGTGGTCTTCGTTCAAGAG 57.474 50.000 0.00 0.00 42.13 2.85
982 983 2.549992 CCATGGTGGTCTTCGTTCAAGA 60.550 50.000 2.57 0.00 38.95 3.02
983 984 1.806542 CCATGGTGGTCTTCGTTCAAG 59.193 52.381 2.57 0.00 31.35 3.02
984 985 1.418264 TCCATGGTGGTCTTCGTTCAA 59.582 47.619 12.58 0.00 39.03 2.69
985 986 1.001974 CTCCATGGTGGTCTTCGTTCA 59.998 52.381 12.58 0.00 39.03 3.18
986 987 1.726853 CTCCATGGTGGTCTTCGTTC 58.273 55.000 12.58 0.00 39.03 3.95
987 988 0.321653 GCTCCATGGTGGTCTTCGTT 60.322 55.000 12.58 0.00 39.03 3.85
988 989 1.296715 GCTCCATGGTGGTCTTCGT 59.703 57.895 12.58 0.00 39.03 3.85
989 990 0.742281 CTGCTCCATGGTGGTCTTCG 60.742 60.000 12.58 0.00 39.03 3.79
990 991 0.393537 CCTGCTCCATGGTGGTCTTC 60.394 60.000 12.58 0.00 39.03 2.87
991 992 1.687612 CCTGCTCCATGGTGGTCTT 59.312 57.895 12.58 0.00 39.03 3.01
992 993 2.976490 GCCTGCTCCATGGTGGTCT 61.976 63.158 12.58 0.00 39.03 3.85
993 994 2.439156 GCCTGCTCCATGGTGGTC 60.439 66.667 12.58 0.00 39.03 4.02
994 995 4.415150 CGCCTGCTCCATGGTGGT 62.415 66.667 12.58 0.00 39.03 4.16
995 996 4.100084 TCGCCTGCTCCATGGTGG 62.100 66.667 12.58 11.03 39.43 4.61
996 997 2.513204 CTCGCCTGCTCCATGGTG 60.513 66.667 12.58 10.95 35.34 4.17
997 998 3.790437 CCTCGCCTGCTCCATGGT 61.790 66.667 12.58 0.00 0.00 3.55
998 999 3.473647 TCCTCGCCTGCTCCATGG 61.474 66.667 4.97 4.97 0.00 3.66
999 1000 2.202987 GTCCTCGCCTGCTCCATG 60.203 66.667 0.00 0.00 0.00 3.66
1000 1001 3.842923 CGTCCTCGCCTGCTCCAT 61.843 66.667 0.00 0.00 0.00 3.41
1002 1003 4.500116 GTCGTCCTCGCCTGCTCC 62.500 72.222 0.00 0.00 36.96 4.70
1003 1004 4.500116 GGTCGTCCTCGCCTGCTC 62.500 72.222 0.00 0.00 36.96 4.26
1005 1006 4.373116 TTGGTCGTCCTCGCCTGC 62.373 66.667 0.00 0.00 35.47 4.85
1006 1007 2.125912 CTTGGTCGTCCTCGCCTG 60.126 66.667 0.00 0.00 35.47 4.85
1007 1008 2.282958 TCTTGGTCGTCCTCGCCT 60.283 61.111 0.00 0.00 35.47 5.52
1008 1009 2.126031 GTCTTGGTCGTCCTCGCC 60.126 66.667 0.00 0.00 36.96 5.54
1009 1010 2.504244 CGTCTTGGTCGTCCTCGC 60.504 66.667 0.00 0.00 36.96 5.03
1010 1011 2.504244 GCGTCTTGGTCGTCCTCG 60.504 66.667 0.00 1.74 38.55 4.63
1011 1012 1.444553 CTGCGTCTTGGTCGTCCTC 60.445 63.158 0.00 0.00 34.23 3.71
1012 1013 1.867919 CTCTGCGTCTTGGTCGTCCT 61.868 60.000 0.00 0.00 34.23 3.85
1013 1014 1.444553 CTCTGCGTCTTGGTCGTCC 60.445 63.158 0.00 0.00 0.00 4.79
1014 1015 1.444553 CCTCTGCGTCTTGGTCGTC 60.445 63.158 0.00 0.00 0.00 4.20
1015 1016 1.901948 TCCTCTGCGTCTTGGTCGT 60.902 57.895 0.00 0.00 0.00 4.34
1016 1017 1.444553 GTCCTCTGCGTCTTGGTCG 60.445 63.158 0.00 0.00 0.00 4.79
1017 1018 1.444553 CGTCCTCTGCGTCTTGGTC 60.445 63.158 0.00 0.00 0.00 4.02
1018 1019 2.651361 CGTCCTCTGCGTCTTGGT 59.349 61.111 0.00 0.00 0.00 3.67
1019 1020 2.125912 CCGTCCTCTGCGTCTTGG 60.126 66.667 0.00 0.00 0.00 3.61
1020 1021 0.734253 CTTCCGTCCTCTGCGTCTTG 60.734 60.000 0.00 0.00 0.00 3.02
1021 1022 0.894184 TCTTCCGTCCTCTGCGTCTT 60.894 55.000 0.00 0.00 0.00 3.01
1022 1023 1.303398 TCTTCCGTCCTCTGCGTCT 60.303 57.895 0.00 0.00 0.00 4.18
1023 1024 1.153997 GTCTTCCGTCCTCTGCGTC 60.154 63.158 0.00 0.00 0.00 5.19
1024 1025 2.963371 GTCTTCCGTCCTCTGCGT 59.037 61.111 0.00 0.00 0.00 5.24
1025 1026 2.202492 CGTCTTCCGTCCTCTGCG 60.202 66.667 0.00 0.00 0.00 5.18
1026 1027 1.137825 CTCGTCTTCCGTCCTCTGC 59.862 63.158 0.00 0.00 37.94 4.26
1027 1028 0.677098 TCCTCGTCTTCCGTCCTCTG 60.677 60.000 0.00 0.00 37.94 3.35
1028 1029 0.037877 TTCCTCGTCTTCCGTCCTCT 59.962 55.000 0.00 0.00 37.94 3.69
1029 1030 0.170784 GTTCCTCGTCTTCCGTCCTC 59.829 60.000 0.00 0.00 37.94 3.71
1030 1031 0.538977 TGTTCCTCGTCTTCCGTCCT 60.539 55.000 0.00 0.00 37.94 3.85
1031 1032 0.388263 GTGTTCCTCGTCTTCCGTCC 60.388 60.000 0.00 0.00 37.94 4.79
1032 1033 0.728466 CGTGTTCCTCGTCTTCCGTC 60.728 60.000 0.00 0.00 37.94 4.79
1033 1034 1.168407 TCGTGTTCCTCGTCTTCCGT 61.168 55.000 0.00 0.00 37.94 4.69
1034 1035 0.454620 CTCGTGTTCCTCGTCTTCCG 60.455 60.000 0.00 0.00 38.13 4.30
1035 1036 0.109226 CCTCGTGTTCCTCGTCTTCC 60.109 60.000 0.00 0.00 0.00 3.46
1036 1037 0.109226 CCCTCGTGTTCCTCGTCTTC 60.109 60.000 0.00 0.00 0.00 2.87
1037 1038 0.826672 ACCCTCGTGTTCCTCGTCTT 60.827 55.000 0.00 0.00 0.00 3.01
1038 1039 1.228490 ACCCTCGTGTTCCTCGTCT 60.228 57.895 0.00 0.00 0.00 4.18
1039 1040 1.080705 CACCCTCGTGTTCCTCGTC 60.081 63.158 0.00 0.00 35.10 4.20
1040 1041 2.571216 CCACCCTCGTGTTCCTCGT 61.571 63.158 0.00 0.00 38.41 4.18
1041 1042 2.261671 CCACCCTCGTGTTCCTCG 59.738 66.667 0.00 0.00 38.41 4.63
1042 1043 2.047179 GCCACCCTCGTGTTCCTC 60.047 66.667 0.00 0.00 38.41 3.71
1043 1044 4.003788 CGCCACCCTCGTGTTCCT 62.004 66.667 0.00 0.00 38.41 3.36
1048 1049 4.838152 CATCCCGCCACCCTCGTG 62.838 72.222 0.00 0.00 39.91 4.35
1051 1052 4.864334 CTGCATCCCGCCACCCTC 62.864 72.222 0.00 0.00 41.33 4.30
1059 1060 4.899239 GGGACTCGCTGCATCCCG 62.899 72.222 15.47 1.10 42.78 5.14
1061 1062 4.899239 CCGGGACTCGCTGCATCC 62.899 72.222 0.00 3.17 37.59 3.51
1062 1063 3.781770 CTCCGGGACTCGCTGCATC 62.782 68.421 0.00 0.00 37.59 3.91
1069 1070 2.107141 GCATTCCTCCGGGACTCG 59.893 66.667 0.00 0.00 42.05 4.18
1203 1204 4.498520 AGGATGGCGTCGCAGTCG 62.499 66.667 20.50 0.00 42.81 4.18
1242 1243 1.719378 TCCTTCTTGGAGGAGGAGTCT 59.281 52.381 0.66 0.00 40.87 3.24
1281 1282 0.526211 CGAGGAGGACATGTTCGTCA 59.474 55.000 16.42 0.00 40.37 4.35
1322 1323 1.103803 TCGCGAGGAAATCTAGCACT 58.896 50.000 3.71 0.00 43.08 4.40
1323 1324 1.201343 GTCGCGAGGAAATCTAGCAC 58.799 55.000 10.24 0.00 43.08 4.40
1325 1326 1.922570 TTGTCGCGAGGAAATCTAGC 58.077 50.000 10.24 0.00 40.15 3.42
1326 1327 4.625742 TCTTTTTGTCGCGAGGAAATCTAG 59.374 41.667 10.24 8.32 0.00 2.43
1328 1329 3.399330 TCTTTTTGTCGCGAGGAAATCT 58.601 40.909 10.24 0.00 0.00 2.40
1329 1330 3.806316 TCTTTTTGTCGCGAGGAAATC 57.194 42.857 10.24 0.00 0.00 2.17
1330 1331 3.751175 TGATCTTTTTGTCGCGAGGAAAT 59.249 39.130 10.24 0.00 0.00 2.17
1334 1335 2.285256 CGATGATCTTTTTGTCGCGAGG 60.285 50.000 10.24 0.00 0.00 4.63
1337 1338 3.575858 ATCGATGATCTTTTTGTCGCG 57.424 42.857 0.00 0.00 32.74 5.87
1338 1339 5.088739 ACAAATCGATGATCTTTTTGTCGC 58.911 37.500 13.42 0.00 36.12 5.19
1341 1342 9.132521 GATTGAACAAATCGATGATCTTTTTGT 57.867 29.630 13.42 13.42 41.01 2.83
1362 1374 8.127150 TCTACTTCATCAGAGAAACAGATTGA 57.873 34.615 0.00 0.00 0.00 2.57
1363 1375 8.034215 ACTCTACTTCATCAGAGAAACAGATTG 58.966 37.037 5.65 0.00 40.68 2.67
1367 1379 7.254852 GGTACTCTACTTCATCAGAGAAACAG 58.745 42.308 5.65 0.00 40.68 3.16
1375 1387 4.750598 TCGATCGGTACTCTACTTCATCAG 59.249 45.833 16.41 0.00 0.00 2.90
1376 1388 4.700700 TCGATCGGTACTCTACTTCATCA 58.299 43.478 16.41 0.00 0.00 3.07
1380 1392 4.310675 CGATCGATCGGTACTCTACTTC 57.689 50.000 34.54 1.34 45.93 3.01
1392 1407 5.106228 GCATGCATATGTCCGATCGATCG 62.106 52.174 35.03 35.03 41.76 3.69
1396 1411 1.431496 TGCATGCATATGTCCGATCG 58.569 50.000 18.46 8.51 36.65 3.69
1404 1419 4.776795 TTAGAAGCCATGCATGCATATG 57.223 40.909 31.73 24.94 34.91 1.78
1408 1423 5.302313 TCATAAATTAGAAGCCATGCATGCA 59.698 36.000 25.04 25.04 0.00 3.96
1409 1424 5.632347 GTCATAAATTAGAAGCCATGCATGC 59.368 40.000 21.69 11.82 0.00 4.06
1410 1425 6.015688 AGGTCATAAATTAGAAGCCATGCATG 60.016 38.462 20.19 20.19 0.00 4.06
1411 1426 6.015688 CAGGTCATAAATTAGAAGCCATGCAT 60.016 38.462 0.00 0.00 0.00 3.96
1412 1427 5.300034 CAGGTCATAAATTAGAAGCCATGCA 59.700 40.000 0.00 0.00 0.00 3.96
1428 1445 7.093640 ACTCTAACGAACATTAACCAGGTCATA 60.094 37.037 0.00 0.00 0.00 2.15
1430 1447 5.011329 ACTCTAACGAACATTAACCAGGTCA 59.989 40.000 0.00 0.00 0.00 4.02
1431 1448 5.476614 ACTCTAACGAACATTAACCAGGTC 58.523 41.667 0.00 0.00 0.00 3.85
1432 1449 5.479124 ACTCTAACGAACATTAACCAGGT 57.521 39.130 0.00 0.00 0.00 4.00
1433 1450 6.796705 AAACTCTAACGAACATTAACCAGG 57.203 37.500 0.00 0.00 0.00 4.45
1443 1463 2.483106 GGAGCCCAAAACTCTAACGAAC 59.517 50.000 0.00 0.00 34.46 3.95
1445 1465 1.695242 TGGAGCCCAAAACTCTAACGA 59.305 47.619 0.00 0.00 34.46 3.85
1446 1466 2.076863 CTGGAGCCCAAAACTCTAACG 58.923 52.381 0.00 0.00 34.46 3.18
1447 1467 1.813178 GCTGGAGCCCAAAACTCTAAC 59.187 52.381 0.00 0.00 34.46 2.34
1508 1548 1.076777 ACCCCAAGCGATTCCCATG 60.077 57.895 0.00 0.00 0.00 3.66
1525 1565 7.284489 ACTCTCTCCAGTAAAGATCTGTATGAC 59.716 40.741 0.00 0.00 0.00 3.06
1530 1570 5.777732 ACAACTCTCTCCAGTAAAGATCTGT 59.222 40.000 0.00 0.00 0.00 3.41
1546 1586 1.134965 CATCTGGGTCCGACAACTCTC 60.135 57.143 0.00 0.00 0.00 3.20
1548 1588 0.741221 GCATCTGGGTCCGACAACTC 60.741 60.000 0.00 0.00 0.00 3.01
1551 1591 1.003839 GTGCATCTGGGTCCGACAA 60.004 57.895 0.00 0.00 0.00 3.18
1552 1592 2.662596 GTGCATCTGGGTCCGACA 59.337 61.111 0.00 0.00 0.00 4.35
1566 1606 7.916914 AGTATATGGGAATTAATTACCGTGC 57.083 36.000 28.01 19.00 44.09 5.34
1582 1622 7.128728 TCAAATCCCCCATGGTATAGTATATGG 59.871 40.741 11.73 0.00 39.77 2.74
1583 1623 8.101309 TCAAATCCCCCATGGTATAGTATATG 57.899 38.462 11.73 0.00 34.77 1.78
1584 1624 8.892312 ATCAAATCCCCCATGGTATAGTATAT 57.108 34.615 11.73 0.00 34.77 0.86
1587 1627 6.094991 TGATCAAATCCCCCATGGTATAGTA 58.905 40.000 11.73 0.00 34.77 1.82
1588 1628 4.919510 TGATCAAATCCCCCATGGTATAGT 59.080 41.667 11.73 0.00 34.77 2.12
1589 1629 5.519183 TGATCAAATCCCCCATGGTATAG 57.481 43.478 11.73 0.00 34.77 1.31
1592 1632 4.830717 AATGATCAAATCCCCCATGGTA 57.169 40.909 11.73 0.00 34.77 3.25
1593 1633 3.711937 AATGATCAAATCCCCCATGGT 57.288 42.857 11.73 0.00 34.77 3.55
1594 1634 3.495453 GCAAATGATCAAATCCCCCATGG 60.495 47.826 4.14 4.14 0.00 3.66
1595 1635 3.495453 GGCAAATGATCAAATCCCCCATG 60.495 47.826 0.00 0.00 0.00 3.66
1598 1638 1.417517 GGGCAAATGATCAAATCCCCC 59.582 52.381 0.00 2.75 0.00 5.40
1599 1639 1.417517 GGGGCAAATGATCAAATCCCC 59.582 52.381 21.51 21.51 44.32 4.81
1600 1640 1.417517 GGGGGCAAATGATCAAATCCC 59.582 52.381 14.03 14.03 0.00 3.85
1601 1641 2.117865 TGGGGGCAAATGATCAAATCC 58.882 47.619 0.00 0.00 0.00 3.01
1602 1642 2.767960 AGTGGGGGCAAATGATCAAATC 59.232 45.455 0.00 0.00 0.00 2.17
1603 1643 2.836667 AGTGGGGGCAAATGATCAAAT 58.163 42.857 0.00 0.00 0.00 2.32
1606 1646 2.323999 AAAGTGGGGGCAAATGATCA 57.676 45.000 0.00 0.00 0.00 2.92
1607 1647 2.099098 CGTAAAGTGGGGGCAAATGATC 59.901 50.000 0.00 0.00 0.00 2.92
1608 1648 2.099405 CGTAAAGTGGGGGCAAATGAT 58.901 47.619 0.00 0.00 0.00 2.45
1609 1649 1.202952 ACGTAAAGTGGGGGCAAATGA 60.203 47.619 0.00 0.00 0.00 2.57
1610 1650 1.253100 ACGTAAAGTGGGGGCAAATG 58.747 50.000 0.00 0.00 0.00 2.32
1611 1651 1.616374 CAACGTAAAGTGGGGGCAAAT 59.384 47.619 0.00 0.00 0.00 2.32
1612 1652 1.033574 CAACGTAAAGTGGGGGCAAA 58.966 50.000 0.00 0.00 0.00 3.68
1613 1653 1.457009 GCAACGTAAAGTGGGGGCAA 61.457 55.000 0.00 0.00 0.00 4.52
1614 1654 1.899534 GCAACGTAAAGTGGGGGCA 60.900 57.895 0.00 0.00 0.00 5.36
1615 1655 1.899534 TGCAACGTAAAGTGGGGGC 60.900 57.895 0.00 0.00 0.00 5.80
1616 1656 0.536460 AGTGCAACGTAAAGTGGGGG 60.536 55.000 0.00 0.00 45.86 5.40
1617 1657 1.314730 AAGTGCAACGTAAAGTGGGG 58.685 50.000 0.00 0.00 45.86 4.96
1618 1658 2.356382 TCAAAGTGCAACGTAAAGTGGG 59.644 45.455 0.00 0.00 45.86 4.61
1619 1659 3.684103 TCAAAGTGCAACGTAAAGTGG 57.316 42.857 0.00 0.00 45.86 4.00
1620 1660 5.985781 ACTATCAAAGTGCAACGTAAAGTG 58.014 37.500 0.00 0.00 45.86 3.16
1621 1661 6.927381 AGTACTATCAAAGTGCAACGTAAAGT 59.073 34.615 0.00 0.00 45.86 2.66
1622 1662 7.095774 ACAGTACTATCAAAGTGCAACGTAAAG 60.096 37.037 0.00 0.00 45.86 1.85
1623 1663 6.702723 ACAGTACTATCAAAGTGCAACGTAAA 59.297 34.615 0.00 0.00 45.86 2.01
1624 1664 6.218019 ACAGTACTATCAAAGTGCAACGTAA 58.782 36.000 0.00 0.00 45.86 3.18
1625 1665 5.775686 ACAGTACTATCAAAGTGCAACGTA 58.224 37.500 0.00 0.00 45.86 3.57
1626 1666 4.628074 ACAGTACTATCAAAGTGCAACGT 58.372 39.130 0.00 0.00 45.86 3.99
1627 1667 5.862323 AGTACAGTACTATCAAAGTGCAACG 59.138 40.000 11.84 0.00 42.81 4.10
1628 1668 7.275123 GGTAGTACAGTACTATCAAAGTGCAAC 59.725 40.741 21.74 9.04 42.81 4.17
1629 1669 7.177921 AGGTAGTACAGTACTATCAAAGTGCAA 59.822 37.037 26.37 1.35 43.31 4.08
1630 1670 6.662234 AGGTAGTACAGTACTATCAAAGTGCA 59.338 38.462 26.37 1.81 43.31 4.57
1631 1671 7.067251 AGAGGTAGTACAGTACTATCAAAGTGC 59.933 40.741 26.37 11.36 43.31 4.40
1632 1672 8.508883 AGAGGTAGTACAGTACTATCAAAGTG 57.491 38.462 26.37 0.00 43.31 3.16
1633 1673 8.327271 TGAGAGGTAGTACAGTACTATCAAAGT 58.673 37.037 26.37 10.89 43.31 2.66
1634 1674 8.734218 TGAGAGGTAGTACAGTACTATCAAAG 57.266 38.462 26.37 0.00 43.31 2.77
1636 1676 9.775854 GTATGAGAGGTAGTACAGTACTATCAA 57.224 37.037 26.37 13.28 43.31 2.57
1637 1677 8.931568 TGTATGAGAGGTAGTACAGTACTATCA 58.068 37.037 26.37 22.00 43.31 2.15
1638 1678 9.947433 ATGTATGAGAGGTAGTACAGTACTATC 57.053 37.037 21.07 20.42 42.68 2.08
1641 1681 9.947433 GATATGTATGAGAGGTAGTACAGTACT 57.053 37.037 17.51 17.51 42.68 2.73
1642 1682 9.947433 AGATATGTATGAGAGGTAGTACAGTAC 57.053 37.037 2.05 2.05 31.35 2.73
1644 1684 7.820386 CGAGATATGTATGAGAGGTAGTACAGT 59.180 40.741 2.06 0.00 31.35 3.55
1645 1685 7.279090 CCGAGATATGTATGAGAGGTAGTACAG 59.721 44.444 2.06 0.00 31.35 2.74
1646 1686 7.038516 TCCGAGATATGTATGAGAGGTAGTACA 60.039 40.741 2.06 0.00 0.00 2.90
1647 1687 7.329499 TCCGAGATATGTATGAGAGGTAGTAC 58.671 42.308 0.00 0.00 0.00 2.73
1648 1688 7.492077 TCCGAGATATGTATGAGAGGTAGTA 57.508 40.000 0.00 0.00 0.00 1.82
1649 1689 6.375830 TCCGAGATATGTATGAGAGGTAGT 57.624 41.667 0.00 0.00 0.00 2.73
1650 1690 7.689446 TTTCCGAGATATGTATGAGAGGTAG 57.311 40.000 0.00 0.00 0.00 3.18
1651 1691 8.523658 CAATTTCCGAGATATGTATGAGAGGTA 58.476 37.037 0.00 0.00 0.00 3.08
1652 1692 7.382110 CAATTTCCGAGATATGTATGAGAGGT 58.618 38.462 0.00 0.00 0.00 3.85
1653 1693 6.312426 GCAATTTCCGAGATATGTATGAGAGG 59.688 42.308 0.00 0.00 0.00 3.69
1654 1694 6.870439 TGCAATTTCCGAGATATGTATGAGAG 59.130 38.462 0.00 0.00 0.00 3.20
1655 1695 6.758254 TGCAATTTCCGAGATATGTATGAGA 58.242 36.000 0.00 0.00 0.00 3.27
1656 1696 7.606858 ATGCAATTTCCGAGATATGTATGAG 57.393 36.000 0.00 0.00 0.00 2.90
1657 1697 7.984422 AATGCAATTTCCGAGATATGTATGA 57.016 32.000 0.00 0.00 26.74 2.15
1658 1698 8.939929 AGTAATGCAATTTCCGAGATATGTATG 58.060 33.333 0.00 0.00 37.87 2.39
1659 1699 9.507329 AAGTAATGCAATTTCCGAGATATGTAT 57.493 29.630 0.00 0.00 37.87 2.29
1662 1702 7.642669 ACAAGTAATGCAATTTCCGAGATATG 58.357 34.615 0.00 0.00 37.87 1.78
1667 1707 6.176975 TGTACAAGTAATGCAATTTCCGAG 57.823 37.500 0.00 0.00 37.87 4.63
1669 1709 5.799936 CCTTGTACAAGTAATGCAATTTCCG 59.200 40.000 29.05 9.07 35.20 4.30
1671 1711 9.685828 TTAACCTTGTACAAGTAATGCAATTTC 57.314 29.630 29.05 0.00 35.20 2.17
1675 1715 7.596995 GCAATTAACCTTGTACAAGTAATGCAA 59.403 33.333 29.05 16.11 36.72 4.08
1678 1718 7.826690 AGGCAATTAACCTTGTACAAGTAATG 58.173 34.615 29.05 18.31 36.72 1.90
1693 1733 8.601845 AATTAAAGGAACACAAGGCAATTAAC 57.398 30.769 0.00 0.00 0.00 2.01
1696 1736 9.791801 ATTTAATTAAAGGAACACAAGGCAATT 57.208 25.926 15.45 0.00 0.00 2.32
1697 1737 9.791801 AATTTAATTAAAGGAACACAAGGCAAT 57.208 25.926 15.45 0.00 0.00 3.56
1698 1738 9.620259 AAATTTAATTAAAGGAACACAAGGCAA 57.380 25.926 15.45 0.00 0.00 4.52
1700 1740 9.051679 ACAAATTTAATTAAAGGAACACAAGGC 57.948 29.630 15.45 0.00 0.00 4.35
1706 1746 9.171701 CGTCGAACAAATTTAATTAAAGGAACA 57.828 29.630 15.45 0.00 0.00 3.18
1707 1747 9.384682 TCGTCGAACAAATTTAATTAAAGGAAC 57.615 29.630 15.45 5.17 0.00 3.62
1715 1755 9.620660 AAGCTTAATCGTCGAACAAATTTAATT 57.379 25.926 0.00 0.00 0.00 1.40
1717 1757 9.749490 CTAAGCTTAATCGTCGAACAAATTTAA 57.251 29.630 7.74 0.00 0.00 1.52
1720 1760 6.370718 ACCTAAGCTTAATCGTCGAACAAATT 59.629 34.615 7.74 0.00 0.00 1.82
1723 1875 4.813027 ACCTAAGCTTAATCGTCGAACAA 58.187 39.130 7.74 0.00 0.00 2.83
1728 1880 3.431922 TGGACCTAAGCTTAATCGTCG 57.568 47.619 7.74 0.00 0.00 5.12
1732 1884 4.200092 CCACCTTGGACCTAAGCTTAATC 58.800 47.826 7.74 8.09 40.96 1.75
1735 1887 1.280998 GCCACCTTGGACCTAAGCTTA 59.719 52.381 5.94 5.94 40.96 3.09
1738 1890 0.678048 CTGCCACCTTGGACCTAAGC 60.678 60.000 0.00 0.00 40.96 3.09
1739 1891 0.984230 TCTGCCACCTTGGACCTAAG 59.016 55.000 0.00 0.00 40.96 2.18
1740 1892 0.984230 CTCTGCCACCTTGGACCTAA 59.016 55.000 0.00 0.00 40.96 2.69
1741 1893 1.553690 GCTCTGCCACCTTGGACCTA 61.554 60.000 0.00 0.00 40.96 3.08
1742 1894 2.900106 GCTCTGCCACCTTGGACCT 61.900 63.158 0.00 0.00 40.96 3.85
1743 1895 2.360475 GCTCTGCCACCTTGGACC 60.360 66.667 0.00 0.00 40.96 4.46
1744 1896 1.376553 GAGCTCTGCCACCTTGGAC 60.377 63.158 6.43 0.00 40.96 4.02
1771 1929 3.368571 GACAAGCCCAGCCAGCAC 61.369 66.667 0.00 0.00 0.00 4.40
1782 1940 1.986575 GCTGATTCGGCCAGACAAGC 61.987 60.000 2.24 1.75 33.65 4.01
1784 1942 0.674581 CTGCTGATTCGGCCAGACAA 60.675 55.000 14.77 0.00 34.37 3.18
1786 1944 0.175760 TACTGCTGATTCGGCCAGAC 59.824 55.000 14.77 0.00 34.37 3.51
1788 1946 1.293924 CTTACTGCTGATTCGGCCAG 58.706 55.000 14.77 13.44 34.37 4.85
1789 1947 0.107703 CCTTACTGCTGATTCGGCCA 60.108 55.000 14.77 2.70 34.37 5.36
1793 1951 2.100584 AGAGCTCCTTACTGCTGATTCG 59.899 50.000 10.93 0.00 39.91 3.34
1794 1952 3.131933 TGAGAGCTCCTTACTGCTGATTC 59.868 47.826 10.93 0.00 39.91 2.52
1795 1953 3.102972 TGAGAGCTCCTTACTGCTGATT 58.897 45.455 10.93 0.00 39.91 2.57
1800 1958 0.898320 TGGTGAGAGCTCCTTACTGC 59.102 55.000 10.93 0.00 32.49 4.40
1804 1962 0.252239 TGCCTGGTGAGAGCTCCTTA 60.252 55.000 10.93 0.00 0.00 2.69
1806 1964 2.121385 TGCCTGGTGAGAGCTCCT 59.879 61.111 10.93 0.00 0.00 3.69
1814 1972 2.579657 CGTAGTGGGTGCCTGGTGA 61.580 63.158 0.00 0.00 0.00 4.02
1816 1974 4.016706 GCGTAGTGGGTGCCTGGT 62.017 66.667 0.00 0.00 0.00 4.00
1821 1979 3.014085 TAGCCTGCGTAGTGGGTGC 62.014 63.158 0.00 0.00 35.86 5.01
1834 1992 0.533032 GCTTGAAGACGAGGTAGCCT 59.467 55.000 0.00 0.00 36.03 4.58
1836 1994 1.202582 TGAGCTTGAAGACGAGGTAGC 59.797 52.381 0.00 0.00 38.23 3.58
1888 2046 5.817816 GTCTACCTCAACATATGAAACCTGG 59.182 44.000 10.38 6.25 37.67 4.45
1892 2050 4.270325 GCCGTCTACCTCAACATATGAAAC 59.730 45.833 10.38 0.00 37.67 2.78
1893 2051 4.439057 GCCGTCTACCTCAACATATGAAA 58.561 43.478 10.38 0.00 37.67 2.69
1894 2052 3.181469 GGCCGTCTACCTCAACATATGAA 60.181 47.826 10.38 0.00 37.67 2.57
1897 2055 2.365617 CTGGCCGTCTACCTCAACATAT 59.634 50.000 0.00 0.00 0.00 1.78
1899 2057 0.537188 CTGGCCGTCTACCTCAACAT 59.463 55.000 0.00 0.00 0.00 2.71
1900 2058 1.541310 CCTGGCCGTCTACCTCAACA 61.541 60.000 0.00 0.00 0.00 3.33
1903 2061 1.982395 CACCTGGCCGTCTACCTCA 60.982 63.158 0.00 0.00 0.00 3.86
1904 2062 2.722201 CCACCTGGCCGTCTACCTC 61.722 68.421 0.00 0.00 0.00 3.85
1934 2146 3.774702 GAAAGACGGCGTGCGGAC 61.775 66.667 21.19 1.37 0.00 4.79
1938 2150 2.750888 GGATGGAAAGACGGCGTGC 61.751 63.158 21.19 9.52 0.00 5.34
1942 2154 2.115291 GCAGGGATGGAAAGACGGC 61.115 63.158 0.00 0.00 0.00 5.68
1943 2155 0.322456 TTGCAGGGATGGAAAGACGG 60.322 55.000 0.00 0.00 0.00 4.79
1944 2156 0.804989 GTTGCAGGGATGGAAAGACG 59.195 55.000 0.00 0.00 0.00 4.18
1949 2161 1.303236 CACGGTTGCAGGGATGGAA 60.303 57.895 0.00 0.00 0.00 3.53
2010 2228 3.584052 CTACGCCGTCCTCCTCCG 61.584 72.222 0.00 0.00 0.00 4.63
2012 2230 3.217743 CCCTACGCCGTCCTCCTC 61.218 72.222 0.00 0.00 0.00 3.71
2023 2241 3.528370 CTCCTGACGCCCCCTACG 61.528 72.222 0.00 0.00 0.00 3.51
2026 2244 3.680196 TACCTCCTGACGCCCCCT 61.680 66.667 0.00 0.00 0.00 4.79
2047 2265 4.675029 CCGTCGTCCCGTTGCCTT 62.675 66.667 0.00 0.00 0.00 4.35
2069 2287 2.202987 GCCGATCACCAGCTCCAG 60.203 66.667 0.00 0.00 0.00 3.86
2074 2292 1.222115 GGTAATCGCCGATCACCAGC 61.222 60.000 14.63 0.03 0.00 4.85
2079 2297 0.533032 TGTGTGGTAATCGCCGATCA 59.467 50.000 0.00 0.00 0.00 2.92
2083 2301 2.461110 GCCTGTGTGGTAATCGCCG 61.461 63.158 0.00 0.00 38.35 6.46
2089 2307 0.179032 CACCTGTGCCTGTGTGGTAA 60.179 55.000 0.00 0.00 38.35 2.85
2091 2309 1.708993 ATCACCTGTGCCTGTGTGGT 61.709 55.000 0.00 0.00 38.35 4.16
2098 2316 1.562942 ACATCATCATCACCTGTGCCT 59.437 47.619 0.00 0.00 0.00 4.75
2100 2318 3.136763 CCTACATCATCATCACCTGTGC 58.863 50.000 0.00 0.00 0.00 4.57
2104 2322 3.311990 TGCTCCTACATCATCATCACCT 58.688 45.455 0.00 0.00 0.00 4.00
2109 2336 9.264653 TCTTAATATCTGCTCCTACATCATCAT 57.735 33.333 0.00 0.00 0.00 2.45
2110 2337 8.655935 TCTTAATATCTGCTCCTACATCATCA 57.344 34.615 0.00 0.00 0.00 3.07
2118 2345 7.526192 GCAGTTCCATCTTAATATCTGCTCCTA 60.526 40.741 0.00 0.00 42.16 2.94
2119 2346 6.743773 GCAGTTCCATCTTAATATCTGCTCCT 60.744 42.308 0.00 0.00 42.16 3.69
2120 2347 5.411053 GCAGTTCCATCTTAATATCTGCTCC 59.589 44.000 0.00 0.00 42.16 4.70
2121 2348 5.994054 TGCAGTTCCATCTTAATATCTGCTC 59.006 40.000 13.43 0.00 44.57 4.26
2122 2349 5.933617 TGCAGTTCCATCTTAATATCTGCT 58.066 37.500 13.43 0.00 44.57 4.24
2123 2350 6.429078 TCATGCAGTTCCATCTTAATATCTGC 59.571 38.462 0.00 0.00 44.54 4.26
2124 2351 7.660617 ACTCATGCAGTTCCATCTTAATATCTG 59.339 37.037 0.00 0.00 26.56 2.90
2125 2352 7.660617 CACTCATGCAGTTCCATCTTAATATCT 59.339 37.037 0.00 0.00 30.26 1.98
2126 2353 7.094890 CCACTCATGCAGTTCCATCTTAATATC 60.095 40.741 0.00 0.00 30.26 1.63
2127 2354 6.713903 CCACTCATGCAGTTCCATCTTAATAT 59.286 38.462 0.00 0.00 30.26 1.28
2128 2355 6.057533 CCACTCATGCAGTTCCATCTTAATA 58.942 40.000 0.00 0.00 30.26 0.98
2129 2356 4.885907 CCACTCATGCAGTTCCATCTTAAT 59.114 41.667 0.00 0.00 30.26 1.40
2133 2360 1.064906 CCCACTCATGCAGTTCCATCT 60.065 52.381 0.00 0.00 30.26 2.90
2141 2368 1.153208 GCTCCTCCCACTCATGCAG 60.153 63.158 0.00 0.00 0.00 4.41
2176 2403 0.533755 CGGTTCCCTGGATGATGAGC 60.534 60.000 0.00 0.00 0.00 4.26
2186 2413 1.376037 GCCTGAACTCGGTTCCCTG 60.376 63.158 12.35 4.53 41.35 4.45
2188 2415 1.262640 TAGGCCTGAACTCGGTTCCC 61.263 60.000 17.99 7.85 41.35 3.97
2193 2420 2.076863 CTTGTTTAGGCCTGAACTCGG 58.923 52.381 33.00 21.36 31.31 4.63
2198 2425 4.367039 ACTAAGCTTGTTTAGGCCTGAA 57.633 40.909 17.99 11.64 35.43 3.02
2209 2436 9.632638 ACCATATGATAAATGAACTAAGCTTGT 57.367 29.630 9.86 2.27 0.00 3.16
2224 2451 9.739276 GGTGGAGATTTGATTACCATATGATAA 57.261 33.333 3.65 0.00 33.19 1.75
2225 2452 8.040727 CGGTGGAGATTTGATTACCATATGATA 58.959 37.037 3.65 0.00 33.19 2.15
2226 2453 6.881065 CGGTGGAGATTTGATTACCATATGAT 59.119 38.462 3.65 0.00 33.19 2.45
2227 2454 6.183361 ACGGTGGAGATTTGATTACCATATGA 60.183 38.462 3.65 0.00 33.19 2.15
2228 2455 5.997746 ACGGTGGAGATTTGATTACCATATG 59.002 40.000 0.00 0.00 33.19 1.78
2229 2456 5.997746 CACGGTGGAGATTTGATTACCATAT 59.002 40.000 0.00 0.00 33.19 1.78
2230 2457 5.104693 ACACGGTGGAGATTTGATTACCATA 60.105 40.000 13.48 0.00 33.19 2.74
2231 2458 4.199310 CACGGTGGAGATTTGATTACCAT 58.801 43.478 0.00 0.00 33.19 3.55
2232 2459 3.008594 ACACGGTGGAGATTTGATTACCA 59.991 43.478 13.48 0.00 0.00 3.25
2233 2460 3.374058 CACACGGTGGAGATTTGATTACC 59.626 47.826 13.48 0.00 0.00 2.85
2234 2461 4.600012 CACACGGTGGAGATTTGATTAC 57.400 45.455 13.48 0.00 0.00 1.89
2247 2474 2.007049 GCTACTCCATTCCACACGGTG 61.007 57.143 6.58 6.58 0.00 4.94
2248 2475 0.249398 GCTACTCCATTCCACACGGT 59.751 55.000 0.00 0.00 0.00 4.83
2249 2476 0.537188 AGCTACTCCATTCCACACGG 59.463 55.000 0.00 0.00 0.00 4.94
2250 2477 2.093973 AGAAGCTACTCCATTCCACACG 60.094 50.000 0.00 0.00 0.00 4.49
2251 2478 3.618690 AGAAGCTACTCCATTCCACAC 57.381 47.619 0.00 0.00 0.00 3.82
2252 2479 5.663106 AGATAAGAAGCTACTCCATTCCACA 59.337 40.000 0.00 0.00 0.00 4.17
2253 2480 6.168270 AGATAAGAAGCTACTCCATTCCAC 57.832 41.667 0.00 0.00 0.00 4.02
2254 2481 6.814954 AAGATAAGAAGCTACTCCATTCCA 57.185 37.500 0.00 0.00 0.00 3.53
2255 2482 7.654116 GTGTAAGATAAGAAGCTACTCCATTCC 59.346 40.741 0.00 0.00 0.00 3.01
2256 2483 8.417884 AGTGTAAGATAAGAAGCTACTCCATTC 58.582 37.037 0.00 0.00 0.00 2.67
2257 2484 8.312669 AGTGTAAGATAAGAAGCTACTCCATT 57.687 34.615 0.00 0.00 0.00 3.16
2258 2485 7.906199 AGTGTAAGATAAGAAGCTACTCCAT 57.094 36.000 0.00 0.00 0.00 3.41
2259 2486 8.818622 TTAGTGTAAGATAAGAAGCTACTCCA 57.181 34.615 0.00 0.00 0.00 3.86
2260 2487 9.738832 CTTTAGTGTAAGATAAGAAGCTACTCC 57.261 37.037 0.00 0.00 0.00 3.85
2277 2504 9.802039 ACTGACCCAAATTATTTCTTTAGTGTA 57.198 29.630 0.00 0.00 0.00 2.90
2278 2505 8.706322 ACTGACCCAAATTATTTCTTTAGTGT 57.294 30.769 0.00 0.00 0.00 3.55
2279 2506 9.014297 AGACTGACCCAAATTATTTCTTTAGTG 57.986 33.333 0.00 0.00 0.00 2.74
2285 2512 9.533831 ACATTTAGACTGACCCAAATTATTTCT 57.466 29.630 0.00 0.00 0.00 2.52
2286 2513 9.788960 GACATTTAGACTGACCCAAATTATTTC 57.211 33.333 0.00 0.00 0.00 2.17
2287 2514 8.749354 GGACATTTAGACTGACCCAAATTATTT 58.251 33.333 0.00 0.00 0.00 1.40
2288 2515 7.893302 TGGACATTTAGACTGACCCAAATTATT 59.107 33.333 0.00 0.00 0.00 1.40
2289 2516 7.410174 TGGACATTTAGACTGACCCAAATTAT 58.590 34.615 0.00 0.00 0.00 1.28
2290 2517 6.785076 TGGACATTTAGACTGACCCAAATTA 58.215 36.000 0.00 0.00 0.00 1.40
2291 2518 5.640147 TGGACATTTAGACTGACCCAAATT 58.360 37.500 0.00 0.00 0.00 1.82
2292 2519 5.255397 TGGACATTTAGACTGACCCAAAT 57.745 39.130 0.00 0.00 0.00 2.32
2293 2520 4.651778 CTGGACATTTAGACTGACCCAAA 58.348 43.478 0.00 0.00 0.00 3.28
2294 2521 3.559171 GCTGGACATTTAGACTGACCCAA 60.559 47.826 0.00 0.00 0.00 4.12
2295 2522 2.027192 GCTGGACATTTAGACTGACCCA 60.027 50.000 0.00 0.00 0.00 4.51
2296 2523 2.633488 GCTGGACATTTAGACTGACCC 58.367 52.381 0.00 0.00 0.00 4.46
2297 2524 2.094182 TCGCTGGACATTTAGACTGACC 60.094 50.000 0.00 0.00 0.00 4.02
2298 2525 3.182967 CTCGCTGGACATTTAGACTGAC 58.817 50.000 0.00 0.00 0.00 3.51
2299 2526 2.417379 GCTCGCTGGACATTTAGACTGA 60.417 50.000 0.00 0.00 0.00 3.41
2300 2527 1.929836 GCTCGCTGGACATTTAGACTG 59.070 52.381 0.00 0.00 0.00 3.51
2301 2528 1.550524 TGCTCGCTGGACATTTAGACT 59.449 47.619 0.00 0.00 0.00 3.24
2302 2529 2.010145 TGCTCGCTGGACATTTAGAC 57.990 50.000 0.00 0.00 0.00 2.59
2303 2530 2.760634 TTGCTCGCTGGACATTTAGA 57.239 45.000 0.00 0.00 0.00 2.10
2304 2531 6.974932 ATATATTGCTCGCTGGACATTTAG 57.025 37.500 0.00 0.00 0.00 1.85
2305 2532 7.443879 TCAAATATATTGCTCGCTGGACATTTA 59.556 33.333 0.00 0.00 0.00 1.40
2306 2533 6.262944 TCAAATATATTGCTCGCTGGACATTT 59.737 34.615 0.00 0.00 0.00 2.32
2307 2534 5.764686 TCAAATATATTGCTCGCTGGACATT 59.235 36.000 0.00 0.00 0.00 2.71
2308 2535 5.308014 TCAAATATATTGCTCGCTGGACAT 58.692 37.500 0.00 0.00 0.00 3.06
2309 2536 4.702831 TCAAATATATTGCTCGCTGGACA 58.297 39.130 0.00 0.00 0.00 4.02
2310 2537 5.869753 ATCAAATATATTGCTCGCTGGAC 57.130 39.130 0.00 0.00 0.00 4.02
2311 2538 5.582269 GCTATCAAATATATTGCTCGCTGGA 59.418 40.000 0.00 0.00 0.00 3.86
2312 2539 5.220739 GGCTATCAAATATATTGCTCGCTGG 60.221 44.000 0.00 0.00 0.00 4.85
2313 2540 5.220739 GGGCTATCAAATATATTGCTCGCTG 60.221 44.000 0.00 0.00 0.00 5.18
2314 2541 4.878397 GGGCTATCAAATATATTGCTCGCT 59.122 41.667 0.00 0.00 0.00 4.93
2315 2542 4.878397 AGGGCTATCAAATATATTGCTCGC 59.122 41.667 0.00 0.00 31.86 5.03
2316 2543 6.595326 TGAAGGGCTATCAAATATATTGCTCG 59.405 38.462 0.00 0.00 31.86 5.03
2317 2544 7.826252 TCTGAAGGGCTATCAAATATATTGCTC 59.174 37.037 0.00 0.00 0.00 4.26
2318 2545 7.609532 GTCTGAAGGGCTATCAAATATATTGCT 59.390 37.037 0.00 0.00 0.00 3.91
2319 2546 7.413438 CGTCTGAAGGGCTATCAAATATATTGC 60.413 40.741 0.00 0.00 0.00 3.56
2320 2547 7.604164 ACGTCTGAAGGGCTATCAAATATATTG 59.396 37.037 0.00 0.00 0.00 1.90
2321 2548 7.680730 ACGTCTGAAGGGCTATCAAATATATT 58.319 34.615 0.00 0.00 0.00 1.28
2322 2549 7.246171 ACGTCTGAAGGGCTATCAAATATAT 57.754 36.000 0.00 0.00 0.00 0.86
2323 2550 6.665992 ACGTCTGAAGGGCTATCAAATATA 57.334 37.500 0.00 0.00 0.00 0.86
2324 2551 5.552870 ACGTCTGAAGGGCTATCAAATAT 57.447 39.130 0.00 0.00 0.00 1.28
2325 2552 5.353394 AACGTCTGAAGGGCTATCAAATA 57.647 39.130 0.00 0.00 0.00 1.40
2326 2553 3.914426 ACGTCTGAAGGGCTATCAAAT 57.086 42.857 0.00 0.00 0.00 2.32
2327 2554 3.695830 AACGTCTGAAGGGCTATCAAA 57.304 42.857 0.00 0.00 0.00 2.69
2328 2555 4.222145 AGTTAACGTCTGAAGGGCTATCAA 59.778 41.667 0.00 0.00 0.00 2.57
2329 2556 3.767673 AGTTAACGTCTGAAGGGCTATCA 59.232 43.478 0.00 0.00 0.00 2.15
2330 2557 4.113354 CAGTTAACGTCTGAAGGGCTATC 58.887 47.826 0.00 0.00 35.20 2.08
2331 2558 3.514309 ACAGTTAACGTCTGAAGGGCTAT 59.486 43.478 9.51 0.00 36.81 2.97
2332 2559 2.895404 ACAGTTAACGTCTGAAGGGCTA 59.105 45.455 9.51 0.00 36.81 3.93
2333 2560 1.692519 ACAGTTAACGTCTGAAGGGCT 59.307 47.619 9.51 0.00 36.81 5.19
2334 2561 2.067013 GACAGTTAACGTCTGAAGGGC 58.933 52.381 17.61 0.00 36.81 5.19
2335 2562 3.380479 TGACAGTTAACGTCTGAAGGG 57.620 47.619 22.20 2.64 36.81 3.95
2336 2563 4.307432 ACATGACAGTTAACGTCTGAAGG 58.693 43.478 22.20 12.28 36.81 3.46
2337 2564 7.582435 AATACATGACAGTTAACGTCTGAAG 57.418 36.000 22.20 14.92 36.81 3.02
2338 2565 7.870954 AGAAATACATGACAGTTAACGTCTGAA 59.129 33.333 22.20 10.03 36.81 3.02
2339 2566 7.328493 CAGAAATACATGACAGTTAACGTCTGA 59.672 37.037 22.20 10.53 36.81 3.27
2340 2567 7.116376 ACAGAAATACATGACAGTTAACGTCTG 59.884 37.037 22.20 19.54 38.68 3.51
2341 2568 7.152645 ACAGAAATACATGACAGTTAACGTCT 58.847 34.615 22.20 11.33 34.37 4.18
2342 2569 7.347508 ACAGAAATACATGACAGTTAACGTC 57.652 36.000 17.88 17.88 0.00 4.34
2343 2570 7.724305 AACAGAAATACATGACAGTTAACGT 57.276 32.000 0.00 1.35 0.00 3.99
2344 2571 8.495949 AGAAACAGAAATACATGACAGTTAACG 58.504 33.333 0.00 0.00 0.00 3.18
2345 2572 9.599322 CAGAAACAGAAATACATGACAGTTAAC 57.401 33.333 0.00 0.00 0.00 2.01
2346 2573 8.289618 GCAGAAACAGAAATACATGACAGTTAA 58.710 33.333 0.00 0.00 0.00 2.01
2347 2574 7.661437 AGCAGAAACAGAAATACATGACAGTTA 59.339 33.333 0.00 0.00 0.00 2.24
2348 2575 6.488006 AGCAGAAACAGAAATACATGACAGTT 59.512 34.615 0.00 0.00 0.00 3.16
2349 2576 6.000219 AGCAGAAACAGAAATACATGACAGT 59.000 36.000 0.00 0.00 0.00 3.55
2350 2577 6.492007 AGCAGAAACAGAAATACATGACAG 57.508 37.500 0.00 0.00 0.00 3.51
2351 2578 6.262944 ACAAGCAGAAACAGAAATACATGACA 59.737 34.615 0.00 0.00 0.00 3.58
2352 2579 6.672147 ACAAGCAGAAACAGAAATACATGAC 58.328 36.000 0.00 0.00 0.00 3.06
2353 2580 6.882610 ACAAGCAGAAACAGAAATACATGA 57.117 33.333 0.00 0.00 0.00 3.07
2354 2581 7.810658 ACTACAAGCAGAAACAGAAATACATG 58.189 34.615 0.00 0.00 0.00 3.21
2355 2582 7.986085 ACTACAAGCAGAAACAGAAATACAT 57.014 32.000 0.00 0.00 0.00 2.29
2356 2583 7.282224 ACAACTACAAGCAGAAACAGAAATACA 59.718 33.333 0.00 0.00 0.00 2.29
2357 2584 7.639945 ACAACTACAAGCAGAAACAGAAATAC 58.360 34.615 0.00 0.00 0.00 1.89
2358 2585 7.801716 ACAACTACAAGCAGAAACAGAAATA 57.198 32.000 0.00 0.00 0.00 1.40
2359 2586 6.699575 ACAACTACAAGCAGAAACAGAAAT 57.300 33.333 0.00 0.00 0.00 2.17
2360 2587 6.509418 AACAACTACAAGCAGAAACAGAAA 57.491 33.333 0.00 0.00 0.00 2.52
2361 2588 6.509418 AAACAACTACAAGCAGAAACAGAA 57.491 33.333 0.00 0.00 0.00 3.02
2362 2589 6.509418 AAAACAACTACAAGCAGAAACAGA 57.491 33.333 0.00 0.00 0.00 3.41
2363 2590 6.806249 TCAAAAACAACTACAAGCAGAAACAG 59.194 34.615 0.00 0.00 0.00 3.16
2364 2591 6.682746 TCAAAAACAACTACAAGCAGAAACA 58.317 32.000 0.00 0.00 0.00 2.83
2365 2592 7.575332 TTCAAAAACAACTACAAGCAGAAAC 57.425 32.000 0.00 0.00 0.00 2.78
2366 2593 9.862371 TTATTCAAAAACAACTACAAGCAGAAA 57.138 25.926 0.00 0.00 0.00 2.52
2367 2594 9.862371 TTTATTCAAAAACAACTACAAGCAGAA 57.138 25.926 0.00 0.00 0.00 3.02
2368 2595 9.515020 CTTTATTCAAAAACAACTACAAGCAGA 57.485 29.630 0.00 0.00 0.00 4.26
2369 2596 9.515020 TCTTTATTCAAAAACAACTACAAGCAG 57.485 29.630 0.00 0.00 0.00 4.24
2370 2597 9.862371 TTCTTTATTCAAAAACAACTACAAGCA 57.138 25.926 0.00 0.00 0.00 3.91
2395 2622 9.449719 GGTCAATTCTTCCGGATGTAATATATT 57.550 33.333 16.29 2.97 0.00 1.28
2396 2623 8.602424 TGGTCAATTCTTCCGGATGTAATATAT 58.398 33.333 16.29 1.11 0.00 0.86
2397 2624 7.969004 TGGTCAATTCTTCCGGATGTAATATA 58.031 34.615 16.29 5.42 0.00 0.86
2398 2625 6.837312 TGGTCAATTCTTCCGGATGTAATAT 58.163 36.000 16.29 4.70 0.00 1.28
2399 2626 6.241882 TGGTCAATTCTTCCGGATGTAATA 57.758 37.500 16.29 0.00 0.00 0.98
2400 2627 5.110814 TGGTCAATTCTTCCGGATGTAAT 57.889 39.130 16.29 11.67 0.00 1.89
2401 2628 4.561500 TGGTCAATTCTTCCGGATGTAA 57.438 40.909 16.29 10.10 0.00 2.41
2402 2629 4.408921 AGATGGTCAATTCTTCCGGATGTA 59.591 41.667 16.29 8.11 0.00 2.29
2403 2630 3.200825 AGATGGTCAATTCTTCCGGATGT 59.799 43.478 16.29 0.00 0.00 3.06
2404 2631 3.813443 AGATGGTCAATTCTTCCGGATG 58.187 45.455 4.15 8.29 0.00 3.51
2405 2632 4.510167 AAGATGGTCAATTCTTCCGGAT 57.490 40.909 4.15 0.00 0.00 4.18
2406 2633 4.009675 CAAAGATGGTCAATTCTTCCGGA 58.990 43.478 0.00 0.00 31.09 5.14
2407 2634 4.009675 TCAAAGATGGTCAATTCTTCCGG 58.990 43.478 0.00 0.00 31.09 5.14
2408 2635 4.142600 GGTCAAAGATGGTCAATTCTTCCG 60.143 45.833 0.00 0.00 31.09 4.30
2409 2636 4.766891 TGGTCAAAGATGGTCAATTCTTCC 59.233 41.667 0.00 0.00 31.09 3.46
2410 2637 5.964958 TGGTCAAAGATGGTCAATTCTTC 57.035 39.130 0.00 0.00 31.09 2.87
2411 2638 6.923199 ATTGGTCAAAGATGGTCAATTCTT 57.077 33.333 0.00 0.00 33.69 2.52
2412 2639 6.923199 AATTGGTCAAAGATGGTCAATTCT 57.077 33.333 0.00 0.00 36.13 2.40
2413 2640 9.657419 AAATAATTGGTCAAAGATGGTCAATTC 57.343 29.630 0.00 0.00 38.80 2.17
2414 2641 9.439500 CAAATAATTGGTCAAAGATGGTCAATT 57.561 29.630 0.00 0.00 39.90 2.32
2431 2658 6.207417 CCTCATACTACAGCCCCAAATAATTG 59.793 42.308 0.00 0.00 36.25 2.32
2432 2659 6.126185 ACCTCATACTACAGCCCCAAATAATT 60.126 38.462 0.00 0.00 0.00 1.40
2433 2660 5.372661 ACCTCATACTACAGCCCCAAATAAT 59.627 40.000 0.00 0.00 0.00 1.28
2434 2661 4.724798 ACCTCATACTACAGCCCCAAATAA 59.275 41.667 0.00 0.00 0.00 1.40
2435 2662 4.303794 ACCTCATACTACAGCCCCAAATA 58.696 43.478 0.00 0.00 0.00 1.40
2436 2663 3.123273 ACCTCATACTACAGCCCCAAAT 58.877 45.455 0.00 0.00 0.00 2.32
2437 2664 2.557869 ACCTCATACTACAGCCCCAAA 58.442 47.619 0.00 0.00 0.00 3.28
2438 2665 2.238646 CAACCTCATACTACAGCCCCAA 59.761 50.000 0.00 0.00 0.00 4.12
2439 2666 1.837439 CAACCTCATACTACAGCCCCA 59.163 52.381 0.00 0.00 0.00 4.96
2440 2667 1.475213 GCAACCTCATACTACAGCCCC 60.475 57.143 0.00 0.00 0.00 5.80
2441 2668 1.486726 AGCAACCTCATACTACAGCCC 59.513 52.381 0.00 0.00 0.00 5.19
2442 2669 2.990066 AGCAACCTCATACTACAGCC 57.010 50.000 0.00 0.00 0.00 4.85
2443 2670 5.360591 ACATAAGCAACCTCATACTACAGC 58.639 41.667 0.00 0.00 0.00 4.40
2444 2671 8.360390 TGATACATAAGCAACCTCATACTACAG 58.640 37.037 0.00 0.00 0.00 2.74
2445 2672 8.245195 TGATACATAAGCAACCTCATACTACA 57.755 34.615 0.00 0.00 0.00 2.74
2446 2673 9.712305 AATGATACATAAGCAACCTCATACTAC 57.288 33.333 0.00 0.00 0.00 2.73
2448 2675 9.712305 GTAATGATACATAAGCAACCTCATACT 57.288 33.333 0.00 0.00 32.02 2.12
2449 2676 9.489084 TGTAATGATACATAAGCAACCTCATAC 57.511 33.333 0.00 0.00 37.11 2.39
2451 2678 8.978874 TTGTAATGATACATAAGCAACCTCAT 57.021 30.769 0.00 0.00 41.51 2.90
2452 2679 8.978874 ATTGTAATGATACATAAGCAACCTCA 57.021 30.769 0.00 0.00 41.51 3.86
2453 2680 9.669353 CAATTGTAATGATACATAAGCAACCTC 57.331 33.333 0.00 0.00 41.51 3.85
2454 2681 9.189156 ACAATTGTAATGATACATAAGCAACCT 57.811 29.630 9.97 0.00 41.51 3.50
2455 2682 9.450807 GACAATTGTAATGATACATAAGCAACC 57.549 33.333 11.95 0.00 41.51 3.77
2463 2690 8.522003 TGCACAAAGACAATTGTAATGATACAT 58.478 29.630 11.95 0.00 41.44 2.29
2464 2691 7.880105 TGCACAAAGACAATTGTAATGATACA 58.120 30.769 11.95 3.24 41.44 2.29
2465 2692 8.741101 TTGCACAAAGACAATTGTAATGATAC 57.259 30.769 11.95 0.00 41.44 2.24
2466 2693 9.926158 AATTGCACAAAGACAATTGTAATGATA 57.074 25.926 11.95 1.36 43.11 2.15
2467 2694 8.836268 AATTGCACAAAGACAATTGTAATGAT 57.164 26.923 11.95 0.00 43.11 2.45
2468 2695 9.926158 ATAATTGCACAAAGACAATTGTAATGA 57.074 25.926 11.95 0.00 44.14 2.57
2472 2699 9.853555 CCTAATAATTGCACAAAGACAATTGTA 57.146 29.630 11.95 0.00 44.14 2.41
2473 2700 7.331687 GCCTAATAATTGCACAAAGACAATTGT 59.668 33.333 11.78 11.78 44.14 2.71
2474 2701 7.546667 AGCCTAATAATTGCACAAAGACAATTG 59.453 33.333 3.24 3.24 44.14 2.32
2475 2702 7.614494 AGCCTAATAATTGCACAAAGACAATT 58.386 30.769 6.26 6.26 45.73 2.32
2476 2703 7.174107 AGCCTAATAATTGCACAAAGACAAT 57.826 32.000 0.00 0.00 38.11 2.71
2477 2704 6.588719 AGCCTAATAATTGCACAAAGACAA 57.411 33.333 0.00 0.00 0.00 3.18
2478 2705 6.389091 CAAGCCTAATAATTGCACAAAGACA 58.611 36.000 0.00 0.00 0.00 3.41
2479 2706 5.289434 GCAAGCCTAATAATTGCACAAAGAC 59.711 40.000 4.38 0.00 46.64 3.01
2480 2707 5.410067 GCAAGCCTAATAATTGCACAAAGA 58.590 37.500 4.38 0.00 46.64 2.52
2481 2708 5.707411 GCAAGCCTAATAATTGCACAAAG 57.293 39.130 4.38 0.00 46.64 2.77
2488 2715 3.701040 ACCCTGTGCAAGCCTAATAATTG 59.299 43.478 0.00 0.00 0.00 2.32
2489 2716 3.981212 ACCCTGTGCAAGCCTAATAATT 58.019 40.909 0.00 0.00 0.00 1.40
2490 2717 3.669939 ACCCTGTGCAAGCCTAATAAT 57.330 42.857 0.00 0.00 0.00 1.28
2491 2718 3.449746 AACCCTGTGCAAGCCTAATAA 57.550 42.857 0.00 0.00 0.00 1.40
2492 2719 3.449746 AAACCCTGTGCAAGCCTAATA 57.550 42.857 0.00 0.00 0.00 0.98
2493 2720 2.309136 AAACCCTGTGCAAGCCTAAT 57.691 45.000 0.00 0.00 0.00 1.73
2494 2721 1.960689 GAAAACCCTGTGCAAGCCTAA 59.039 47.619 0.00 0.00 0.00 2.69
2495 2722 1.133637 TGAAAACCCTGTGCAAGCCTA 60.134 47.619 0.00 0.00 0.00 3.93
2496 2723 0.396974 TGAAAACCCTGTGCAAGCCT 60.397 50.000 0.00 0.00 0.00 4.58
2497 2724 0.463620 TTGAAAACCCTGTGCAAGCC 59.536 50.000 0.00 0.00 0.00 4.35
2498 2725 2.307934 TTTGAAAACCCTGTGCAAGC 57.692 45.000 0.00 0.00 0.00 4.01
2499 2726 3.002553 GCATTTTGAAAACCCTGTGCAAG 59.997 43.478 7.96 0.00 0.00 4.01
2500 2727 2.941720 GCATTTTGAAAACCCTGTGCAA 59.058 40.909 7.96 0.00 0.00 4.08
2501 2728 2.093288 TGCATTTTGAAAACCCTGTGCA 60.093 40.909 10.71 10.71 38.83 4.57
2502 2729 2.559440 TGCATTTTGAAAACCCTGTGC 58.441 42.857 6.31 6.31 0.00 4.57
2503 2730 4.190772 ACTTGCATTTTGAAAACCCTGTG 58.809 39.130 0.00 0.00 0.00 3.66
2504 2731 4.486125 ACTTGCATTTTGAAAACCCTGT 57.514 36.364 0.00 0.00 0.00 4.00
2505 2732 6.917217 TTAACTTGCATTTTGAAAACCCTG 57.083 33.333 0.00 0.00 0.00 4.45
2506 2733 6.710295 GGATTAACTTGCATTTTGAAAACCCT 59.290 34.615 0.00 0.00 0.00 4.34
2507 2734 6.347321 CGGATTAACTTGCATTTTGAAAACCC 60.347 38.462 0.00 0.00 0.00 4.11
2508 2735 6.589454 CGGATTAACTTGCATTTTGAAAACC 58.411 36.000 0.00 0.00 0.00 3.27
2509 2736 6.070829 GCGGATTAACTTGCATTTTGAAAAC 58.929 36.000 0.00 0.00 0.00 2.43
2510 2737 5.178438 GGCGGATTAACTTGCATTTTGAAAA 59.822 36.000 0.00 0.00 0.00 2.29
2511 2738 4.688413 GGCGGATTAACTTGCATTTTGAAA 59.312 37.500 0.00 0.00 0.00 2.69
2512 2739 4.241681 GGCGGATTAACTTGCATTTTGAA 58.758 39.130 0.00 0.00 0.00 2.69
2513 2740 3.256879 TGGCGGATTAACTTGCATTTTGA 59.743 39.130 0.00 0.00 0.00 2.69
2514 2741 3.367630 GTGGCGGATTAACTTGCATTTTG 59.632 43.478 0.00 0.00 0.00 2.44
2515 2742 3.006323 TGTGGCGGATTAACTTGCATTTT 59.994 39.130 0.00 0.00 0.00 1.82
2516 2743 2.560542 TGTGGCGGATTAACTTGCATTT 59.439 40.909 0.00 0.00 0.00 2.32
2517 2744 2.166829 TGTGGCGGATTAACTTGCATT 58.833 42.857 0.00 0.00 0.00 3.56
2518 2745 1.832883 TGTGGCGGATTAACTTGCAT 58.167 45.000 0.00 0.00 0.00 3.96
2519 2746 1.610363 TTGTGGCGGATTAACTTGCA 58.390 45.000 0.00 0.00 0.00 4.08
2520 2747 2.287909 TGTTTGTGGCGGATTAACTTGC 60.288 45.455 0.00 0.00 0.00 4.01
2521 2748 3.243234 TGTGTTTGTGGCGGATTAACTTG 60.243 43.478 0.00 0.00 0.00 3.16
2522 2749 2.952978 TGTGTTTGTGGCGGATTAACTT 59.047 40.909 0.00 0.00 0.00 2.66
2523 2750 2.577700 TGTGTTTGTGGCGGATTAACT 58.422 42.857 0.00 0.00 0.00 2.24
2524 2751 3.357166 TTGTGTTTGTGGCGGATTAAC 57.643 42.857 0.00 0.00 0.00 2.01
2525 2752 5.906113 ATATTGTGTTTGTGGCGGATTAA 57.094 34.783 0.00 0.00 0.00 1.40
2526 2753 7.575414 ATTATATTGTGTTTGTGGCGGATTA 57.425 32.000 0.00 0.00 0.00 1.75
2527 2754 5.906113 TTATATTGTGTTTGTGGCGGATT 57.094 34.783 0.00 0.00 0.00 3.01
2528 2755 6.272318 CAATTATATTGTGTTTGTGGCGGAT 58.728 36.000 0.00 0.00 0.00 4.18
2529 2756 5.645624 CAATTATATTGTGTTTGTGGCGGA 58.354 37.500 0.00 0.00 0.00 5.54
2530 2757 4.267452 GCAATTATATTGTGTTTGTGGCGG 59.733 41.667 0.00 0.00 0.00 6.13
2531 2758 5.004630 CAGCAATTATATTGTGTTTGTGGCG 59.995 40.000 0.00 0.00 0.00 5.69
2532 2759 5.291614 CCAGCAATTATATTGTGTTTGTGGC 59.708 40.000 0.00 0.00 0.00 5.01
2533 2760 5.291614 GCCAGCAATTATATTGTGTTTGTGG 59.708 40.000 0.00 0.00 0.00 4.17
2534 2761 6.101332 AGCCAGCAATTATATTGTGTTTGTG 58.899 36.000 0.00 0.00 0.00 3.33
2535 2762 6.284891 AGCCAGCAATTATATTGTGTTTGT 57.715 33.333 0.00 0.00 0.00 2.83
2536 2763 7.975616 AGTAAGCCAGCAATTATATTGTGTTTG 59.024 33.333 0.00 0.00 0.00 2.93
2537 2764 8.066612 AGTAAGCCAGCAATTATATTGTGTTT 57.933 30.769 0.00 0.00 0.00 2.83
2538 2765 7.645058 AGTAAGCCAGCAATTATATTGTGTT 57.355 32.000 0.00 0.00 0.00 3.32
2539 2766 7.122650 ACAAGTAAGCCAGCAATTATATTGTGT 59.877 33.333 0.00 0.00 29.71 3.72
2540 2767 7.433131 CACAAGTAAGCCAGCAATTATATTGTG 59.567 37.037 12.71 12.71 36.37 3.33
2541 2768 7.122650 ACACAAGTAAGCCAGCAATTATATTGT 59.877 33.333 0.00 0.00 30.31 2.71
2542 2769 7.483307 ACACAAGTAAGCCAGCAATTATATTG 58.517 34.615 0.00 0.00 0.00 1.90
2543 2770 7.645058 ACACAAGTAAGCCAGCAATTATATT 57.355 32.000 0.00 0.00 0.00 1.28
2544 2771 7.122650 ACAACACAAGTAAGCCAGCAATTATAT 59.877 33.333 0.00 0.00 0.00 0.86
2545 2772 6.432783 ACAACACAAGTAAGCCAGCAATTATA 59.567 34.615 0.00 0.00 0.00 0.98
2546 2773 5.243730 ACAACACAAGTAAGCCAGCAATTAT 59.756 36.000 0.00 0.00 0.00 1.28
2547 2774 4.582656 ACAACACAAGTAAGCCAGCAATTA 59.417 37.500 0.00 0.00 0.00 1.40
2548 2775 3.384467 ACAACACAAGTAAGCCAGCAATT 59.616 39.130 0.00 0.00 0.00 2.32
2549 2776 2.958355 ACAACACAAGTAAGCCAGCAAT 59.042 40.909 0.00 0.00 0.00 3.56
2550 2777 2.374184 ACAACACAAGTAAGCCAGCAA 58.626 42.857 0.00 0.00 0.00 3.91
2551 2778 2.051334 ACAACACAAGTAAGCCAGCA 57.949 45.000 0.00 0.00 0.00 4.41
2552 2779 2.287608 GGAACAACACAAGTAAGCCAGC 60.288 50.000 0.00 0.00 0.00 4.85
2553 2780 3.003689 CAGGAACAACACAAGTAAGCCAG 59.996 47.826 0.00 0.00 0.00 4.85
2554 2781 2.948979 CAGGAACAACACAAGTAAGCCA 59.051 45.455 0.00 0.00 0.00 4.75
2555 2782 2.949644 ACAGGAACAACACAAGTAAGCC 59.050 45.455 0.00 0.00 0.00 4.35
2556 2783 3.243068 CCACAGGAACAACACAAGTAAGC 60.243 47.826 0.00 0.00 0.00 3.09
2557 2784 3.945285 ACCACAGGAACAACACAAGTAAG 59.055 43.478 0.00 0.00 0.00 2.34
2558 2785 3.958018 ACCACAGGAACAACACAAGTAA 58.042 40.909 0.00 0.00 0.00 2.24
2559 2786 3.637911 ACCACAGGAACAACACAAGTA 57.362 42.857 0.00 0.00 0.00 2.24
2560 2787 2.507407 ACCACAGGAACAACACAAGT 57.493 45.000 0.00 0.00 0.00 3.16
2561 2788 3.945285 ACTAACCACAGGAACAACACAAG 59.055 43.478 0.00 0.00 0.00 3.16
2562 2789 3.958018 ACTAACCACAGGAACAACACAA 58.042 40.909 0.00 0.00 0.00 3.33
2563 2790 3.637911 ACTAACCACAGGAACAACACA 57.362 42.857 0.00 0.00 0.00 3.72
2564 2791 4.083484 GCATACTAACCACAGGAACAACAC 60.083 45.833 0.00 0.00 0.00 3.32
2565 2792 4.069304 GCATACTAACCACAGGAACAACA 58.931 43.478 0.00 0.00 0.00 3.33
2566 2793 4.069304 TGCATACTAACCACAGGAACAAC 58.931 43.478 0.00 0.00 0.00 3.32
2567 2794 4.359434 TGCATACTAACCACAGGAACAA 57.641 40.909 0.00 0.00 0.00 2.83
2568 2795 4.069304 GTTGCATACTAACCACAGGAACA 58.931 43.478 0.00 0.00 0.00 3.18
2569 2796 4.069304 TGTTGCATACTAACCACAGGAAC 58.931 43.478 0.00 0.00 0.00 3.62
2570 2797 4.359434 TGTTGCATACTAACCACAGGAA 57.641 40.909 0.00 0.00 0.00 3.36
2571 2798 4.260985 CATGTTGCATACTAACCACAGGA 58.739 43.478 0.00 0.00 0.00 3.86
2572 2799 3.181497 GCATGTTGCATACTAACCACAGG 60.181 47.826 0.00 0.00 44.26 4.00
2573 2800 4.019919 GCATGTTGCATACTAACCACAG 57.980 45.455 0.00 0.00 44.26 3.66
2586 2813 0.179181 CGGTGACATCTGCATGTTGC 60.179 55.000 0.00 0.00 43.79 4.17
2587 2814 1.159285 ACGGTGACATCTGCATGTTG 58.841 50.000 0.00 0.00 43.79 3.33
2588 2815 1.896220 AACGGTGACATCTGCATGTT 58.104 45.000 0.00 0.00 43.79 2.71
2589 2816 1.896220 AAACGGTGACATCTGCATGT 58.104 45.000 0.00 0.00 46.64 3.21
2590 2817 2.226200 TGAAAACGGTGACATCTGCATG 59.774 45.455 0.00 0.00 35.92 4.06
2591 2818 2.503331 TGAAAACGGTGACATCTGCAT 58.497 42.857 0.00 0.00 0.00 3.96
2592 2819 1.960417 TGAAAACGGTGACATCTGCA 58.040 45.000 0.00 0.00 0.00 4.41
2593 2820 3.559238 AATGAAAACGGTGACATCTGC 57.441 42.857 0.00 0.00 0.00 4.26
2613 2840 7.442364 GCATGATCAGTAGTAGAGGCATAAAAA 59.558 37.037 0.09 0.00 0.00 1.94
2614 2841 6.931281 GCATGATCAGTAGTAGAGGCATAAAA 59.069 38.462 0.09 0.00 0.00 1.52
2615 2842 6.268617 AGCATGATCAGTAGTAGAGGCATAAA 59.731 38.462 0.09 0.00 0.00 1.40
2616 2843 5.777223 AGCATGATCAGTAGTAGAGGCATAA 59.223 40.000 0.09 0.00 0.00 1.90
2617 2844 5.328565 AGCATGATCAGTAGTAGAGGCATA 58.671 41.667 0.09 0.00 0.00 3.14
2618 2845 4.158786 AGCATGATCAGTAGTAGAGGCAT 58.841 43.478 0.09 0.00 0.00 4.40
2619 2846 3.570540 AGCATGATCAGTAGTAGAGGCA 58.429 45.455 0.09 0.00 0.00 4.75
2620 2847 4.157656 CCTAGCATGATCAGTAGTAGAGGC 59.842 50.000 0.09 0.00 0.00 4.70
2621 2848 5.565509 TCCTAGCATGATCAGTAGTAGAGG 58.434 45.833 0.09 1.83 0.00 3.69
2622 2849 6.714810 AGTTCCTAGCATGATCAGTAGTAGAG 59.285 42.308 0.09 0.00 0.00 2.43
2623 2850 6.606069 AGTTCCTAGCATGATCAGTAGTAGA 58.394 40.000 0.09 0.00 0.00 2.59
2624 2851 6.892658 AGTTCCTAGCATGATCAGTAGTAG 57.107 41.667 0.09 0.00 0.00 2.57
2625 2852 6.833933 TCAAGTTCCTAGCATGATCAGTAGTA 59.166 38.462 0.09 0.00 0.00 1.82
2626 2853 5.658634 TCAAGTTCCTAGCATGATCAGTAGT 59.341 40.000 0.09 0.00 0.00 2.73
2627 2854 6.154203 TCAAGTTCCTAGCATGATCAGTAG 57.846 41.667 0.09 2.27 0.00 2.57
2628 2855 6.155221 ACTTCAAGTTCCTAGCATGATCAGTA 59.845 38.462 0.09 0.00 0.00 2.74
2629 2856 5.046014 ACTTCAAGTTCCTAGCATGATCAGT 60.046 40.000 0.09 0.00 0.00 3.41
2630 2857 5.293814 CACTTCAAGTTCCTAGCATGATCAG 59.706 44.000 0.09 0.00 0.00 2.90
2631 2858 5.046376 TCACTTCAAGTTCCTAGCATGATCA 60.046 40.000 0.00 0.00 0.00 2.92
2632 2859 5.423015 TCACTTCAAGTTCCTAGCATGATC 58.577 41.667 0.00 0.00 0.00 2.92
2633 2860 5.426689 TCACTTCAAGTTCCTAGCATGAT 57.573 39.130 0.00 0.00 0.00 2.45
2634 2861 4.890158 TCACTTCAAGTTCCTAGCATGA 57.110 40.909 0.00 0.00 0.00 3.07
2635 2862 5.879223 AGATTCACTTCAAGTTCCTAGCATG 59.121 40.000 0.00 0.00 0.00 4.06
2636 2863 6.059787 AGATTCACTTCAAGTTCCTAGCAT 57.940 37.500 0.00 0.00 0.00 3.79
2637 2864 5.489792 AGATTCACTTCAAGTTCCTAGCA 57.510 39.130 0.00 0.00 0.00 3.49
2638 2865 5.703130 ACAAGATTCACTTCAAGTTCCTAGC 59.297 40.000 0.00 0.00 36.61 3.42
2639 2866 6.931281 TGACAAGATTCACTTCAAGTTCCTAG 59.069 38.462 0.00 0.00 36.61 3.02
2640 2867 6.826668 TGACAAGATTCACTTCAAGTTCCTA 58.173 36.000 0.00 0.00 36.61 2.94
2641 2868 5.684704 TGACAAGATTCACTTCAAGTTCCT 58.315 37.500 0.00 0.00 36.61 3.36
2642 2869 5.561725 GCTGACAAGATTCACTTCAAGTTCC 60.562 44.000 0.00 0.00 36.61 3.62
2643 2870 5.008019 TGCTGACAAGATTCACTTCAAGTTC 59.992 40.000 0.00 0.00 36.61 3.01
2644 2871 4.883585 TGCTGACAAGATTCACTTCAAGTT 59.116 37.500 0.00 0.00 36.61 2.66
2645 2872 4.454678 TGCTGACAAGATTCACTTCAAGT 58.545 39.130 0.00 0.00 36.61 3.16
2646 2873 4.613167 GCTGCTGACAAGATTCACTTCAAG 60.613 45.833 0.00 0.00 36.61 3.02
2647 2874 3.251729 GCTGCTGACAAGATTCACTTCAA 59.748 43.478 0.00 0.00 36.61 2.69
2648 2875 2.810274 GCTGCTGACAAGATTCACTTCA 59.190 45.455 0.00 0.00 36.61 3.02
2649 2876 2.161211 GGCTGCTGACAAGATTCACTTC 59.839 50.000 0.00 0.00 36.61 3.01
2650 2877 2.157738 GGCTGCTGACAAGATTCACTT 58.842 47.619 0.00 0.00 39.70 3.16
2651 2878 1.612726 GGGCTGCTGACAAGATTCACT 60.613 52.381 0.00 0.00 0.00 3.41
2652 2879 0.807496 GGGCTGCTGACAAGATTCAC 59.193 55.000 0.00 0.00 0.00 3.18
2653 2880 0.401356 TGGGCTGCTGACAAGATTCA 59.599 50.000 0.00 0.00 0.00 2.57
2654 2881 1.538047 TTGGGCTGCTGACAAGATTC 58.462 50.000 0.00 0.00 0.00 2.52
2655 2882 2.097825 GATTGGGCTGCTGACAAGATT 58.902 47.619 0.00 0.00 0.00 2.40
2656 2883 1.005097 TGATTGGGCTGCTGACAAGAT 59.995 47.619 0.00 0.00 0.00 2.40
2657 2884 0.401356 TGATTGGGCTGCTGACAAGA 59.599 50.000 0.00 0.00 0.00 3.02
2658 2885 1.404391 GATGATTGGGCTGCTGACAAG 59.596 52.381 0.00 0.00 0.00 3.16
2672 2899 0.179073 CCTCTTCGGTGGCGATGATT 60.179 55.000 0.00 0.00 0.00 2.57
2680 2907 1.684049 AGAGCCTCCTCTTCGGTGG 60.684 63.158 0.00 0.00 46.16 4.61
2722 2949 2.270986 GGCCCAGTGCTTGAGTTGG 61.271 63.158 0.00 0.00