Multiple sequence alignment - TraesCS5B01G212700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G212700 chr5B 100.000 3791 0 0 1 3791 383465354 383461564 0.000000e+00 7001.0
1 TraesCS5B01G212700 chr5B 99.210 3799 19 8 1 3791 386331970 386328175 0.000000e+00 6839.0
2 TraesCS5B01G212700 chr5B 95.455 44 2 0 2192 2235 383463120 383463077 1.890000e-08 71.3
3 TraesCS5B01G212700 chr5B 95.455 44 2 0 2235 2278 383463163 383463120 1.890000e-08 71.3
4 TraesCS5B01G212700 chr5B 95.455 44 2 0 2192 2235 386329734 386329691 1.890000e-08 71.3
5 TraesCS5B01G212700 chr5B 95.455 44 2 0 2235 2278 386329777 386329734 1.890000e-08 71.3
6 TraesCS5B01G212700 chr5A 93.218 2197 90 23 1 2166 426549959 426552127 0.000000e+00 3177.0
7 TraesCS5B01G212700 chr5A 90.592 1031 37 23 2602 3601 426552332 426553333 0.000000e+00 1312.0
8 TraesCS5B01G212700 chr5A 86.975 238 29 2 1237 1472 397510156 397510393 2.250000e-67 267.0
9 TraesCS5B01G212700 chr5A 83.936 249 37 3 1220 1466 211625147 211625394 6.330000e-58 235.0
10 TraesCS5B01G212700 chr5D 90.973 1285 60 26 2541 3791 330310528 330309266 0.000000e+00 1679.0
11 TraesCS5B01G212700 chr5D 89.796 1323 64 25 1 1302 330313571 330312299 0.000000e+00 1629.0
12 TraesCS5B01G212700 chr5D 95.541 942 33 8 1300 2235 330312255 330311317 0.000000e+00 1498.0
13 TraesCS5B01G212700 chr5D 95.960 198 3 3 2235 2430 330311359 330311165 2.200000e-82 316.0
14 TraesCS5B01G212700 chr3D 86.166 253 32 3 1220 1470 335673346 335673095 1.740000e-68 270.0
15 TraesCS5B01G212700 chr2D 84.249 273 36 6 1220 1488 43432476 43432207 3.760000e-65 259.0
16 TraesCS5B01G212700 chr2D 83.908 261 37 5 1220 1476 43503795 43503536 1.050000e-60 244.0
17 TraesCS5B01G212700 chr1D 84.959 246 31 6 1233 1474 96115833 96116076 1.050000e-60 244.0
18 TraesCS5B01G212700 chr1D 80.567 247 37 6 2273 2514 261894196 261893956 3.010000e-41 180.0
19 TraesCS5B01G212700 chr6A 85.068 221 19 10 2256 2467 592346281 592346496 2.970000e-51 213.0
20 TraesCS5B01G212700 chr3B 81.588 277 29 16 2272 2530 396725429 396725701 3.840000e-50 209.0
21 TraesCS5B01G212700 chr3B 84.500 200 22 7 2274 2467 606379561 606379365 5.000000e-44 189.0
22 TraesCS5B01G212700 chr7D 81.890 254 34 8 2286 2533 188941174 188941421 1.790000e-48 204.0
23 TraesCS5B01G212700 chr7A 82.906 234 26 9 2283 2511 55425078 55425302 8.310000e-47 198.0
24 TraesCS5B01G212700 chr2B 80.827 266 37 12 2275 2533 688373931 688373673 2.990000e-46 196.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G212700 chr5B 383461564 383465354 3790 True 2381.2 7001 96.970000 1 3791 3 chr5B.!!$R1 3790
1 TraesCS5B01G212700 chr5B 386328175 386331970 3795 True 2327.2 6839 96.706667 1 3791 3 chr5B.!!$R2 3790
2 TraesCS5B01G212700 chr5A 426549959 426553333 3374 False 2244.5 3177 91.905000 1 3601 2 chr5A.!!$F3 3600
3 TraesCS5B01G212700 chr5D 330309266 330313571 4305 True 1280.5 1679 93.067500 1 3791 4 chr5D.!!$R1 3790

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1117 1147 2.337532 GCTTGCTGGTTGCCACTG 59.662 61.111 0.00 0.00 42.00 3.66 F
2585 3349 2.993008 GCATGTGCTCCTGGGAGA 59.007 61.111 19.64 0.12 44.53 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2632 3397 2.330216 AGCTATAGTTAGTGCCTGGGG 58.670 52.381 0.84 0.0 0.0 4.96 R
3442 4242 9.826574 TGTCCCAAATGTTACTATTATACAGAC 57.173 33.333 0.00 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1117 1147 2.337532 GCTTGCTGGTTGCCACTG 59.662 61.111 0.00 0.00 42.00 3.66
1419 1501 4.044946 TGGATTGTCATGGTTTGATGGA 57.955 40.909 0.00 0.00 36.54 3.41
1500 1583 3.244078 ACAAATGCCTAGTGTCAGAACGA 60.244 43.478 0.00 0.00 0.00 3.85
1628 1715 3.837355 AGCCCTATTTGATTTAGCTGGG 58.163 45.455 0.00 0.00 36.63 4.45
1714 1801 9.209175 GTTACCATCAGTAATGAATCAGGTATC 57.791 37.037 13.94 11.06 42.81 2.24
2585 3349 2.993008 GCATGTGCTCCTGGGAGA 59.007 61.111 19.64 0.12 44.53 3.71
3442 4242 8.839343 TCATGTGTAGATTGCCATGTTTTATAG 58.161 33.333 0.00 0.00 36.81 1.31
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1117 1147 4.062991 ACGAACAGTTAACATGGAAGGTC 58.937 43.478 8.61 0.0 0.00 3.85
1419 1501 3.496870 GGGGCAGATCCAATTAATCTCGT 60.497 47.826 0.62 0.0 36.21 4.18
1628 1715 1.750778 TCGTACTCCCGTATCAAACCC 59.249 52.381 0.00 0.0 0.00 4.11
2632 3397 2.330216 AGCTATAGTTAGTGCCTGGGG 58.670 52.381 0.84 0.0 0.00 4.96
2633 3398 5.952947 AGTATAGCTATAGTTAGTGCCTGGG 59.047 44.000 13.86 0.0 0.00 4.45
3442 4242 9.826574 TGTCCCAAATGTTACTATTATACAGAC 57.173 33.333 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.