Multiple sequence alignment - TraesCS5B01G052800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G052800 chr5B 100.000 2174 0 0 1 2174 57515132 57517305 0.000000e+00 4015
1 TraesCS5B01G052800 chr3B 99.301 1573 9 2 1 1572 101924869 101923298 0.000000e+00 2843
2 TraesCS5B01G052800 chr3B 85.606 396 40 10 1568 1948 758424431 758424038 1.210000e-107 399
3 TraesCS5B01G052800 chr3A 99.175 1575 10 2 1 1572 105556964 105558538 0.000000e+00 2833
4 TraesCS5B01G052800 chr3A 93.904 607 35 2 1568 2174 102546499 102547103 0.000000e+00 915
5 TraesCS5B01G052800 chr3A 87.356 609 41 16 1568 2174 569414738 569415312 0.000000e+00 665
6 TraesCS5B01G052800 chr7B 98.729 1573 15 3 1 1572 662755042 662756610 0.000000e+00 2789
7 TraesCS5B01G052800 chr7B 83.538 407 43 15 1568 1956 72308290 72307890 2.050000e-95 359
8 TraesCS5B01G052800 chr1B 98.601 1573 17 4 1 1572 633716964 633715396 0.000000e+00 2778
9 TraesCS5B01G052800 chr1B 87.245 392 38 4 1568 1948 671227807 671228197 9.210000e-119 436
10 TraesCS5B01G052800 chr5D 97.915 1583 18 4 1 1572 6253283 6254861 0.000000e+00 2726
11 TraesCS5B01G052800 chr5D 97.971 1577 22 5 1 1572 503339433 503337862 0.000000e+00 2726
12 TraesCS5B01G052800 chr5D 97.337 1577 29 5 1 1572 503313495 503311927 0.000000e+00 2667
13 TraesCS5B01G052800 chr1D 97.778 1575 19 8 1 1572 254459401 254457840 0.000000e+00 2700
14 TraesCS5B01G052800 chr1D 97.464 1577 28 7 1 1572 51831967 51833536 0.000000e+00 2680
15 TraesCS5B01G052800 chr1D 80.513 390 39 21 1568 1948 475155679 475155318 4.600000e-67 265
16 TraesCS5B01G052800 chr1A 84.776 624 60 22 1568 2174 1674853 1675458 5.170000e-166 593
17 TraesCS5B01G052800 chr1A 91.232 422 24 7 1763 2174 51332585 51333003 1.460000e-156 562
18 TraesCS5B01G052800 chr6B 95.378 238 11 0 1568 1805 715857858 715857621 1.580000e-101 379
19 TraesCS5B01G052800 chr3D 94.979 239 12 0 1568 1806 573446586 573446824 2.040000e-100 375
20 TraesCS5B01G052800 chr3D 93.117 247 17 0 1568 1814 500826792 500827038 1.590000e-96 363
21 TraesCS5B01G052800 chr2B 95.690 232 10 0 1568 1799 798980817 798981048 7.330000e-100 374
22 TraesCS5B01G052800 chr2A 86.880 343 31 8 1568 1899 754608722 754608383 2.640000e-99 372
23 TraesCS5B01G052800 chr4A 93.902 246 13 2 1568 1811 739048300 739048545 9.480000e-99 370
24 TraesCS5B01G052800 chrUn 94.561 239 12 1 1568 1805 371906650 371906412 3.410000e-98 368
25 TraesCS5B01G052800 chr6A 94.538 238 13 0 1568 1805 500097266 500097029 3.410000e-98 368
26 TraesCS5B01G052800 chr6A 91.000 200 16 2 1934 2133 610376681 610376878 3.560000e-68 268
27 TraesCS5B01G052800 chr7D 86.842 228 23 4 1934 2156 45595077 45595302 4.630000e-62 248


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G052800 chr5B 57515132 57517305 2173 False 4015 4015 100.000 1 2174 1 chr5B.!!$F1 2173
1 TraesCS5B01G052800 chr3B 101923298 101924869 1571 True 2843 2843 99.301 1 1572 1 chr3B.!!$R1 1571
2 TraesCS5B01G052800 chr3A 105556964 105558538 1574 False 2833 2833 99.175 1 1572 1 chr3A.!!$F2 1571
3 TraesCS5B01G052800 chr3A 102546499 102547103 604 False 915 915 93.904 1568 2174 1 chr3A.!!$F1 606
4 TraesCS5B01G052800 chr3A 569414738 569415312 574 False 665 665 87.356 1568 2174 1 chr3A.!!$F3 606
5 TraesCS5B01G052800 chr7B 662755042 662756610 1568 False 2789 2789 98.729 1 1572 1 chr7B.!!$F1 1571
6 TraesCS5B01G052800 chr1B 633715396 633716964 1568 True 2778 2778 98.601 1 1572 1 chr1B.!!$R1 1571
7 TraesCS5B01G052800 chr5D 6253283 6254861 1578 False 2726 2726 97.915 1 1572 1 chr5D.!!$F1 1571
8 TraesCS5B01G052800 chr5D 503337862 503339433 1571 True 2726 2726 97.971 1 1572 1 chr5D.!!$R2 1571
9 TraesCS5B01G052800 chr5D 503311927 503313495 1568 True 2667 2667 97.337 1 1572 1 chr5D.!!$R1 1571
10 TraesCS5B01G052800 chr1D 254457840 254459401 1561 True 2700 2700 97.778 1 1572 1 chr1D.!!$R1 1571
11 TraesCS5B01G052800 chr1D 51831967 51833536 1569 False 2680 2680 97.464 1 1572 1 chr1D.!!$F1 1571
12 TraesCS5B01G052800 chr1A 1674853 1675458 605 False 593 593 84.776 1568 2174 1 chr1A.!!$F1 606

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1006 1026 8.062065 TGTAAATAATCCAAGAAACATGACCC 57.938 34.615 0.0 0.0 0.0 4.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1997 2031 1.434555 TCGAATCGATTTGCCGTGTT 58.565 45.0 18.96 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1006 1026 8.062065 TGTAAATAATCCAAGAAACATGACCC 57.938 34.615 0.00 0.0 0.00 4.46
1371 1391 6.884836 ACATAGTTCCAATAAAGAGAACCCAC 59.115 38.462 0.00 0.0 40.61 4.61
1620 1642 2.045926 GCCAGTGTTCAGGGCGAT 60.046 61.111 0.00 0.0 38.04 4.58
1634 1656 0.032952 GGCGATCGGGTGCAGTATTA 59.967 55.000 18.30 0.0 0.00 0.98
1723 1745 2.519377 AACAAATCTCGGTGTCGTGA 57.481 45.000 0.00 0.0 41.99 4.35
1726 1748 1.927174 CAAATCTCGGTGTCGTGATCC 59.073 52.381 4.27 0.0 45.23 3.36
1744 1766 1.425066 TCCTGTGATTGCTTGGTCCTT 59.575 47.619 0.00 0.0 0.00 3.36
2114 2155 1.258445 AATCTGACCGGAAGCGACCT 61.258 55.000 9.46 0.0 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1006 1026 5.578073 AGTCCCCTTAGTAATCCCTATACG 58.422 45.833 0.00 0.0 0.00 3.06
1363 1383 2.478292 AGAATATGGTCCGTGGGTTCT 58.522 47.619 0.00 0.0 0.00 3.01
1371 1391 4.281941 TCAGATGGAGAAGAATATGGTCCG 59.718 45.833 0.00 0.0 0.00 4.79
1606 1628 2.579201 CCGATCGCCCTGAACACT 59.421 61.111 10.32 0.0 0.00 3.55
1620 1642 1.271379 CCGCTATAATACTGCACCCGA 59.729 52.381 0.00 0.0 0.00 5.14
1628 1650 2.295349 CCCGTGACACCGCTATAATACT 59.705 50.000 0.00 0.0 0.00 2.12
1634 1656 2.363276 TCCCCGTGACACCGCTAT 60.363 61.111 0.00 0.0 0.00 2.97
1723 1745 1.637553 AGGACCAAGCAATCACAGGAT 59.362 47.619 0.00 0.0 34.43 3.24
1726 1748 1.542915 CCAAGGACCAAGCAATCACAG 59.457 52.381 0.00 0.0 0.00 3.66
1744 1766 0.317160 GGCATACCGTCGATCATCCA 59.683 55.000 0.00 0.0 0.00 3.41
1983 2017 2.435234 TGTTCCCGCGTGCCATAC 60.435 61.111 4.92 0.0 0.00 2.39
1997 2031 1.434555 TCGAATCGATTTGCCGTGTT 58.565 45.000 18.96 0.0 0.00 3.32
2065 2106 2.749044 CTGACTGCCGCCTTGCAT 60.749 61.111 0.00 0.0 41.16 3.96
2069 2110 2.866085 GATCTGCTGACTGCCGCCTT 62.866 60.000 1.50 0.0 42.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.