Multiple sequence alignment - TraesCS5A01G333800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G333800 chr5A 100.000 2336 0 0 1 2336 543490261 543492596 0.000000e+00 4314
1 TraesCS5A01G333800 chr5A 97.700 2217 33 7 135 2336 543336353 543338566 0.000000e+00 3795
2 TraesCS5A01G333800 chr5A 97.087 103 1 2 1 103 543336081 543336181 3.090000e-39 172
3 TraesCS5A01G333800 chr5B 89.261 1732 104 34 215 1910 517367846 517369531 0.000000e+00 2093
4 TraesCS5A01G333800 chr5B 95.025 402 6 10 1912 2301 517369578 517369977 9.170000e-174 619
5 TraesCS5A01G333800 chr5B 88.265 196 11 6 1 186 517367655 517367848 8.400000e-55 224
6 TraesCS5A01G333800 chr5D 92.665 968 32 12 1 941 428164032 428164987 0.000000e+00 1358


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G333800 chr5A 543490261 543492596 2335 False 4314.000000 4314 100.000000 1 2336 1 chr5A.!!$F1 2335
1 TraesCS5A01G333800 chr5A 543336081 543338566 2485 False 1983.500000 3795 97.393500 1 2336 2 chr5A.!!$F2 2335
2 TraesCS5A01G333800 chr5B 517367655 517369977 2322 False 978.666667 2093 90.850333 1 2301 3 chr5B.!!$F1 2300
3 TraesCS5A01G333800 chr5D 428164032 428164987 955 False 1358.000000 1358 92.665000 1 941 1 chr5D.!!$F1 940

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
859 1045 0.89553 TAGGAGCCAAAGACCAGACG 59.104 55.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2115 2350 2.164422 TGAGATGACAAGCTCGATCGTT 59.836 45.455 15.94 0.0 41.96 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 96 2.612212 GACGTGTGACACAAAACCATCT 59.388 45.455 16.74 0.0 33.40 2.90
92 97 3.799366 ACGTGTGACACAAAACCATCTA 58.201 40.909 16.74 0.0 33.40 1.98
93 98 4.385825 ACGTGTGACACAAAACCATCTAT 58.614 39.130 16.74 0.0 33.40 1.98
156 301 1.898863 ACTGGGTAGGAGGATGCAAT 58.101 50.000 0.00 0.0 0.00 3.56
817 999 3.998099 AGCCTTCTCTTCAAAAGCAAC 57.002 42.857 0.00 0.0 0.00 4.17
859 1045 0.895530 TAGGAGCCAAAGACCAGACG 59.104 55.000 0.00 0.0 0.00 4.18
860 1046 1.376037 GGAGCCAAAGACCAGACGG 60.376 63.158 0.00 0.0 38.77 4.79
889 1075 3.981313 GGGGGAGGAGGCGAAATA 58.019 61.111 0.00 0.0 0.00 1.40
985 1171 1.381327 AAGGGGAAGATCGAGCCGA 60.381 57.895 0.00 0.0 41.13 5.54
1336 1522 5.582665 CGGAAGAACAAGAAGAAGGAATAGG 59.417 44.000 0.00 0.0 0.00 2.57
2115 2350 6.839657 TGGGTTTCCAGTTTCCTTTATAAACA 59.160 34.615 0.00 0.0 38.92 2.83
2323 2569 3.180891 AGTTTATCTTAGCTCCCACGC 57.819 47.619 0.00 0.0 0.00 5.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 2.472695 TGGATGGTCTTTTCTGGTCG 57.527 50.000 0.00 0.0 0.00 4.79
168 314 7.976135 AAATAGTAGAGCATCATAGCCTTTG 57.024 36.000 0.00 0.0 37.82 2.77
269 416 2.060383 CCGGCCATCTCAGACTCCA 61.060 63.158 2.24 0.0 0.00 3.86
622 794 1.952133 GCGTCGCAACACACACCTA 60.952 57.895 13.44 0.0 0.00 3.08
817 999 8.874816 CCTAGTTAATTTCTCTTCTCCTTTTCG 58.125 37.037 0.00 0.0 0.00 3.46
889 1075 3.276846 GGACACGTGCGTTGCCTT 61.277 61.111 17.22 0.0 0.00 4.35
985 1171 0.678048 GCCATCTTCGTCTTGGGCTT 60.678 55.000 0.00 0.0 38.37 4.35
1336 1522 1.178534 CCCCTCTCATCTCTCCTCGC 61.179 65.000 0.00 0.0 0.00 5.03
2115 2350 2.164422 TGAGATGACAAGCTCGATCGTT 59.836 45.455 15.94 0.0 41.96 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.