Multiple sequence alignment - TraesCS5A01G175000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G175000 chr5A 100.000 1790 0 0 545 2334 368111507 368113296 0.000000e+00 3306.0
1 TraesCS5A01G175000 chr5A 100.000 46 0 0 1 46 368110963 368111008 4.130000e-13 86.1
2 TraesCS5A01G175000 chr3D 93.352 1820 79 29 545 2333 140534549 140532741 0.000000e+00 2652.0
3 TraesCS5A01G175000 chr3D 100.000 45 0 0 2 46 140534880 140534836 1.490000e-12 84.2
4 TraesCS5A01G175000 chr1A 96.003 1576 49 12 764 2334 488390608 488392174 0.000000e+00 2549.0
5 TraesCS5A01G175000 chr1A 95.184 1578 64 11 761 2334 318093346 318091777 0.000000e+00 2483.0
6 TraesCS5A01G175000 chr1A 95.117 1577 60 15 764 2334 488338730 488340295 0.000000e+00 2470.0
7 TraesCS5A01G175000 chr1A 90.135 446 37 7 1893 2334 518189888 518189446 7.230000e-160 573.0
8 TraesCS5A01G175000 chr1A 88.360 189 10 2 545 722 488338558 488338745 1.400000e-52 217.0
9 TraesCS5A01G175000 chr1A 100.000 46 0 0 1 46 318094049 318094004 4.130000e-13 86.1
10 TraesCS5A01G175000 chr1A 97.872 47 0 1 1 46 488338222 488338268 1.920000e-11 80.5
11 TraesCS5A01G175000 chr1A 97.872 47 0 1 1 46 488390100 488390146 1.920000e-11 80.5
12 TraesCS5A01G175000 chr2D 87.703 984 88 23 778 1737 591129119 591128145 0.000000e+00 1116.0
13 TraesCS5A01G175000 chr2D 90.000 210 13 7 1739 1946 591128199 591127996 4.950000e-67 265.0
14 TraesCS5A01G175000 chr2D 95.652 46 2 0 1 46 225601537 225601492 8.940000e-10 75.0
15 TraesCS5A01G175000 chr2B 89.013 446 42 7 1893 2334 550757511 550757069 1.580000e-151 545.0
16 TraesCS5A01G175000 chr5B 88.789 446 41 8 1893 2334 159727610 159728050 2.640000e-149 538.0
17 TraesCS5A01G175000 chrUn 88.539 445 43 7 1893 2334 236695904 236696343 1.230000e-147 532.0
18 TraesCS5A01G175000 chr6D 93.168 322 14 6 2018 2334 441413054 441413372 1.260000e-127 466.0
19 TraesCS5A01G175000 chr1B 85.000 260 31 6 778 1033 606147585 606147840 8.280000e-65 257.0
20 TraesCS5A01G175000 chr1B 91.275 149 12 1 886 1034 226904530 226904677 3.930000e-48 202.0
21 TraesCS5A01G175000 chr3B 84.030 263 34 7 778 1036 131313867 131313609 1.790000e-61 246.0
22 TraesCS5A01G175000 chr6B 83.772 228 29 6 778 1001 173435651 173435874 2.350000e-50 209.0
23 TraesCS5A01G175000 chr4A 97.826 46 1 0 1 46 245402280 245402235 1.920000e-11 80.5
24 TraesCS5A01G175000 chr7D 100.000 40 0 0 6 45 287727527 287727488 8.940000e-10 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G175000 chr5A 368110963 368113296 2333 False 1696.05 3306 100.0000 1 2334 2 chr5A.!!$F1 2333
1 TraesCS5A01G175000 chr3D 140532741 140534880 2139 True 1368.10 2652 96.6760 2 2333 2 chr3D.!!$R1 2331
2 TraesCS5A01G175000 chr1A 488390100 488392174 2074 False 1314.75 2549 96.9375 1 2334 2 chr1A.!!$F2 2333
3 TraesCS5A01G175000 chr1A 318091777 318094049 2272 True 1284.55 2483 97.5920 1 2334 2 chr1A.!!$R2 2333
4 TraesCS5A01G175000 chr1A 488338222 488340295 2073 False 922.50 2470 93.7830 1 2334 3 chr1A.!!$F1 2333
5 TraesCS5A01G175000 chr2D 591127996 591129119 1123 True 690.50 1116 88.8515 778 1946 2 chr2D.!!$R2 1168

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
871 912 1.06909 GACGACCTCAACAGCACCA 59.931 57.895 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2103 2171 1.137086 CGAGTGGACCTTTCATCGGAT 59.863 52.381 0.0 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
838 878 1.746615 GGCGACCACATCTGTGCAT 60.747 57.895 4.77 0.0 44.34 3.96
871 912 1.069090 GACGACCTCAACAGCACCA 59.931 57.895 0.00 0.0 0.00 4.17
963 1004 3.299760 TACACGTCCATCCCCCGGA 62.300 63.158 0.73 0.0 35.55 5.14
1215 1273 2.808598 GGTCACCGGAGCTCATCTA 58.191 57.895 17.19 0.0 38.50 1.98
1430 1490 1.070758 CCAGGCAACACGCTATATCCT 59.929 52.381 0.00 0.0 41.91 3.24
1881 1947 3.005684 TGGCTCATCCACACAATTCAAAC 59.994 43.478 0.00 0.0 40.72 2.93
1957 2025 1.241990 TGTCGCGGCTCACTTACTCT 61.242 55.000 13.81 0.0 0.00 3.24
2064 2132 2.092968 TGAAGTTCACTTGACTGCCTGT 60.093 45.455 0.08 0.0 36.11 4.00
2103 2171 2.812358 TGAAGCAGTGCGTTCTTCTA 57.188 45.000 20.56 6.1 37.63 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
552 554 3.006728 CAGGTCGGGGCAGGGTTA 61.007 66.667 0.00 0.0 0.00 2.85
743 782 4.437587 ATGCAGGACAGGGGCAGC 62.438 66.667 0.00 0.0 41.40 5.25
810 849 3.690280 TGGTCGCCGACTGCATGA 61.690 61.111 17.76 0.0 41.33 3.07
892 933 2.982488 AGGAGGAAGAAGCAAAGGAGAA 59.018 45.455 0.00 0.0 0.00 2.87
963 1004 4.299547 TGAACTGCACGCGAGCCT 62.300 61.111 25.39 10.2 0.00 4.58
1215 1273 4.973168 TGCATACTGAAGAACAAAGGAGT 58.027 39.130 0.00 0.0 0.00 3.85
1730 1794 6.872920 ACATTTGTTTCTGTTTTGAGGCTAA 58.127 32.000 0.00 0.0 0.00 3.09
1789 1855 3.973206 TTTAGACCGCATTCTTGAGGA 57.027 42.857 2.66 0.0 44.95 3.71
2064 2132 1.658686 AACGGAAAACCGCACTGCAA 61.659 50.000 8.59 0.0 36.58 4.08
2103 2171 1.137086 CGAGTGGACCTTTCATCGGAT 59.863 52.381 0.00 0.0 0.00 4.18
2164 2232 7.920682 GTGAACCTCATGAGTTTTTGTTGTATT 59.079 33.333 21.11 0.0 0.00 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.