Multiple sequence alignment - TraesCS4D01G276800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G276800 chr4D 100.000 2906 0 0 1 2906 448521289 448518384 0.000000e+00 5367.0
1 TraesCS4D01G276800 chr4D 99.582 2394 10 0 1 2394 390849804 390852197 0.000000e+00 4366.0
2 TraesCS4D01G276800 chr4D 98.799 583 6 1 2325 2906 390852198 390852780 0.000000e+00 1037.0
3 TraesCS4D01G276800 chr7D 82.443 524 59 11 1 516 70716599 70716101 7.440000e-116 427.0
4 TraesCS4D01G276800 chr7D 83.914 373 51 5 1 366 541956864 541957234 5.960000e-92 348.0
5 TraesCS4D01G276800 chr2D 95.181 249 12 0 2033 2281 644766355 644766603 7.550000e-106 394.0
6 TraesCS4D01G276800 chr2D 90.452 199 17 2 2325 2522 644766910 644767107 7.990000e-66 261.0
7 TraesCS4D01G276800 chrUn 84.267 375 46 11 1 366 366259016 366258646 1.280000e-93 353.0
8 TraesCS4D01G276800 chrUn 84.267 375 46 11 1 366 446016487 446016117 1.280000e-93 353.0
9 TraesCS4D01G276800 chr7A 84.000 375 47 11 1 366 5775353 5774983 5.960000e-92 348.0
10 TraesCS4D01G276800 chr3D 83.914 373 51 5 1 366 520690068 520689698 5.960000e-92 348.0
11 TraesCS4D01G276800 chr3A 94.144 222 12 1 2033 2253 743495667 743495888 1.290000e-88 337.0
12 TraesCS4D01G276800 chr3A 94.792 96 3 2 2428 2522 743497052 743497146 6.490000e-32 148.0
13 TraesCS4D01G276800 chr3A 96.774 62 2 0 2339 2400 743496991 743497052 1.420000e-18 104.0
14 TraesCS4D01G276800 chr3A 86.364 88 12 0 1061 1148 43124567 43124654 2.380000e-16 97.1
15 TraesCS4D01G276800 chr3A 100.000 36 0 0 2246 2281 743496157 743496192 1.870000e-07 67.6
16 TraesCS4D01G276800 chr2A 78.417 278 49 9 1494 1767 756208397 756208127 1.380000e-38 171.0
17 TraesCS4D01G276800 chr6A 80.808 198 38 0 1499 1696 42353672 42353475 3.880000e-34 156.0
18 TraesCS4D01G276800 chr6A 80.693 202 35 2 1520 1721 42640997 42640800 1.390000e-33 154.0
19 TraesCS4D01G276800 chr6A 77.130 223 41 3 1499 1721 42566052 42565840 1.410000e-23 121.0
20 TraesCS4D01G276800 chr6A 77.465 213 38 3 1499 1711 42608315 42608113 5.090000e-23 119.0
21 TraesCS4D01G276800 chr4A 79.358 218 37 6 1498 1713 544597697 544597908 2.330000e-31 147.0
22 TraesCS4D01G276800 chr4A 88.636 88 7 3 2189 2275 687132444 687132529 1.420000e-18 104.0
23 TraesCS4D01G276800 chr2B 77.576 165 31 4 987 1148 2141006 2141167 8.570000e-16 95.3
24 TraesCS4D01G276800 chr2B 77.576 165 31 4 987 1148 2160770 2160931 8.570000e-16 95.3
25 TraesCS4D01G276800 chr2B 77.576 165 31 4 987 1148 2179996 2180157 8.570000e-16 95.3
26 TraesCS4D01G276800 chr5A 82.474 97 11 6 2429 2522 576601335 576601428 2.400000e-11 80.5
27 TraesCS4D01G276800 chr5A 82.474 97 11 6 2429 2522 576602187 576602280 2.400000e-11 80.5
28 TraesCS4D01G276800 chr5B 93.333 45 2 1 2522 2565 688975402 688975446 6.720000e-07 65.8
29 TraesCS4D01G276800 chr5B 93.333 45 2 1 2522 2565 689065174 689065218 6.720000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G276800 chr4D 448518384 448521289 2905 True 5367.0 5367 100.0000 1 2906 1 chr4D.!!$R1 2905
1 TraesCS4D01G276800 chr4D 390849804 390852780 2976 False 2701.5 4366 99.1905 1 2906 2 chr4D.!!$F1 2905
2 TraesCS4D01G276800 chr2D 644766355 644767107 752 False 327.5 394 92.8165 2033 2522 2 chr2D.!!$F1 489

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
106 107 5.336451 GGACAAAAAGGTCTGAACACAAACT 60.336 40.000 0.00 0.0 37.91 2.66 F
1211 1212 7.985476 GTTGCTCAACCATGTAATAAGTATGT 58.015 34.615 1.45 0.0 35.36 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1322 1323 0.721718 GCCGAGTTGGTTCTGAATCG 59.278 55.0 0.00 3.95 41.21 3.34 R
2427 2748 2.078849 AGGCATTTGTAAAAAGCGCC 57.921 45.0 2.29 11.94 35.53 6.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 5.336451 GGACAAAAAGGTCTGAACACAAACT 60.336 40.000 0.00 0.0 37.91 2.66
1211 1212 7.985476 GTTGCTCAACCATGTAATAAGTATGT 58.015 34.615 1.45 0.0 35.36 2.29
1805 1806 3.916172 CGTCAGCCATCTCAAAACATTTG 59.084 43.478 0.00 0.0 0.00 2.32
1971 1972 7.807977 ACTTTTGCTGTCTTTCTTCATTAGA 57.192 32.000 0.00 0.0 0.00 2.10
2427 2748 0.172578 TGCCGTCGTGATAGTCCTTG 59.827 55.000 0.00 0.0 0.00 3.61
2573 2896 7.095695 TGTTTAATGCCTCCTAATTGCTAAC 57.904 36.000 0.00 0.0 0.00 2.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 2.319025 TACAGACCATCCACAGGTGA 57.681 50.000 0.00 0.00 40.09 4.02
1322 1323 0.721718 GCCGAGTTGGTTCTGAATCG 59.278 55.000 0.00 3.95 41.21 3.34
1747 1748 7.151976 GGCTATTACAAACCTGACAAATGTTT 58.848 34.615 0.00 0.00 32.70 2.83
1996 1997 8.015087 CGTATGACAGATACATTTGTGTTTGTT 58.985 33.333 5.36 0.00 35.31 2.83
2427 2748 2.078849 AGGCATTTGTAAAAAGCGCC 57.921 45.000 2.29 11.94 35.53 6.53
2573 2896 2.350388 GCCAACATTCACTACAACACGG 60.350 50.000 0.00 0.00 0.00 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.