Multiple sequence alignment - TraesCS3D01G443700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G443700 chr3D 100.000 2521 0 0 1 2521 553045593 553048113 0.000000e+00 4656.0
1 TraesCS3D01G443700 chr3D 78.456 803 120 32 535 1307 553178329 553179108 2.270000e-130 475.0
2 TraesCS3D01G443700 chr3D 98.851 261 3 0 2261 2521 553086785 553087045 1.370000e-127 466.0
3 TraesCS3D01G443700 chr3D 86.207 203 22 5 436 636 553178443 553178641 5.460000e-52 215.0
4 TraesCS3D01G443700 chr3D 93.056 72 5 0 436 507 553178591 553178662 3.430000e-19 106.0
5 TraesCS3D01G443700 chrUn 99.245 1855 14 0 240 2094 367930185 367928331 0.000000e+00 3349.0
6 TraesCS3D01G443700 chrUn 99.140 1046 9 0 1476 2521 360907621 360906576 0.000000e+00 1882.0
7 TraesCS3D01G443700 chrUn 97.897 1046 11 2 1476 2521 361453510 361452476 0.000000e+00 1799.0
8 TraesCS3D01G443700 chrUn 98.739 238 3 0 1 238 476538004 476538241 8.340000e-115 424.0
9 TraesCS3D01G443700 chrUn 100.000 56 0 0 2466 2521 427518606 427518661 1.230000e-18 104.0
10 TraesCS3D01G443700 chr3B 94.737 1672 74 6 5 1671 733901265 733902927 0.000000e+00 2588.0
11 TraesCS3D01G443700 chr3B 95.469 640 27 2 1883 2521 733902987 733903625 0.000000e+00 1020.0
12 TraesCS3D01G443700 chr3A 90.022 1383 109 11 815 2187 689473711 689475074 0.000000e+00 1762.0
13 TraesCS3D01G443700 chr3A 78.622 566 88 19 406 955 689389736 689390284 6.680000e-91 344.0
14 TraesCS3D01G443700 chr3A 87.192 203 20 5 436 636 689389981 689390179 2.520000e-55 226.0
15 TraesCS3D01G443700 chr3A 80.412 291 40 12 436 724 689389917 689390192 3.290000e-49 206.0
16 TraesCS3D01G443700 chr7D 85.714 98 11 3 2367 2462 523082328 523082232 1.600000e-17 100.0
17 TraesCS3D01G443700 chr7A 85.567 97 10 3 2367 2462 603348373 603348466 5.740000e-17 99.0
18 TraesCS3D01G443700 chr5D 95.833 48 2 0 2365 2412 336765994 336766041 7.480000e-11 78.7
19 TraesCS3D01G443700 chr2D 81.053 95 17 1 2369 2462 114519997 114519903 9.670000e-10 75.0
20 TraesCS3D01G443700 chr2A 81.522 92 16 1 2372 2462 115715582 115715491 9.670000e-10 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G443700 chr3D 553045593 553048113 2520 False 4656.000000 4656 100.000000 1 2521 1 chr3D.!!$F1 2520
1 TraesCS3D01G443700 chr3D 553178329 553179108 779 False 265.333333 475 85.906333 436 1307 3 chr3D.!!$F3 871
2 TraesCS3D01G443700 chrUn 367928331 367930185 1854 True 3349.000000 3349 99.245000 240 2094 1 chrUn.!!$R3 1854
3 TraesCS3D01G443700 chrUn 360906576 360907621 1045 True 1882.000000 1882 99.140000 1476 2521 1 chrUn.!!$R1 1045
4 TraesCS3D01G443700 chrUn 361452476 361453510 1034 True 1799.000000 1799 97.897000 1476 2521 1 chrUn.!!$R2 1045
5 TraesCS3D01G443700 chr3B 733901265 733903625 2360 False 1804.000000 2588 95.103000 5 2521 2 chr3B.!!$F1 2516
6 TraesCS3D01G443700 chr3A 689473711 689475074 1363 False 1762.000000 1762 90.022000 815 2187 1 chr3A.!!$F1 1372
7 TraesCS3D01G443700 chr3A 689389736 689390284 548 False 258.666667 344 82.075333 406 955 3 chr3A.!!$F2 549

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
250 255 1.667236 TCTATTGATTGTGCGGGCTG 58.333 50.000 0.00 0.0 0.00 4.85 F
910 930 7.601508 TCATCTCATACATTCAATGGAATCTCG 59.398 37.037 1.58 0.0 41.78 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1496 1549 4.840716 ATTACCCGTACCCATGTAAACA 57.159 40.909 0.00 0.0 0.00 2.83 R
2362 2422 4.565166 GCATGTGCACGATTACTAGTACAA 59.435 41.667 13.13 0.0 41.59 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 8.023128 AGGACATGTGATTAAAAATCTTGTTCG 58.977 33.333 1.15 0.00 0.00 3.95
99 100 8.927675 TTTATTGTTGTGGTCCAAGTAGTAAT 57.072 30.769 0.00 0.00 32.51 1.89
112 113 5.512404 CCAAGTAGTAATGTGGGTTCACTGA 60.512 44.000 0.00 0.00 43.94 3.41
117 118 2.592102 ATGTGGGTTCACTGAAGCAT 57.408 45.000 19.91 5.19 43.94 3.79
136 137 8.833493 TGAAGCATTGTTAAGATGATGTATCTG 58.167 33.333 3.54 0.00 45.41 2.90
139 140 9.836864 AGCATTGTTAAGATGATGTATCTGTTA 57.163 29.630 3.54 0.00 45.41 2.41
158 159 8.179509 TCTGTTATAGTAAGGCTCCATTAGAC 57.820 38.462 0.00 0.00 0.00 2.59
161 162 7.286087 TGTTATAGTAAGGCTCCATTAGACGAA 59.714 37.037 0.00 0.00 38.81 3.85
250 255 1.667236 TCTATTGATTGTGCGGGCTG 58.333 50.000 0.00 0.00 0.00 4.85
910 930 7.601508 TCATCTCATACATTCAATGGAATCTCG 59.398 37.037 1.58 0.00 41.78 4.04
1496 1549 1.549203 AAGCCATGTTCGCAAGGAAT 58.451 45.000 0.00 0.00 38.17 3.01
2020 2079 9.634163 CTGTACATTTTTAGTTGGGTTTTATCC 57.366 33.333 0.00 0.00 0.00 2.59
2072 2131 8.641541 TGCTACTCAGAATTTTCTTTGGATTTT 58.358 29.630 0.00 0.00 34.74 1.82
2362 2422 7.978925 TCTTTTCCTTACTCTTCATCTTCCTT 58.021 34.615 0.00 0.00 0.00 3.36
2464 2524 8.707938 AAGATATTTTGATTGCACTTAAAGGC 57.292 30.769 0.00 0.00 0.00 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 8.198807 TCACATGTCCTGATATAGAATCACAT 57.801 34.615 0.00 0.0 0.00 3.21
41 42 7.377766 ACTGTAAATGCAATACGAACAAGAT 57.622 32.000 0.00 0.0 0.00 2.40
75 76 7.940137 ACATTACTACTTGGACCACAACAATAA 59.060 33.333 0.00 0.0 34.76 1.40
81 82 4.505918 CCCACATTACTACTTGGACCACAA 60.506 45.833 0.00 0.0 37.55 3.33
88 89 4.695455 CAGTGAACCCACATTACTACTTGG 59.305 45.833 0.00 0.0 45.54 3.61
99 100 1.955778 CAATGCTTCAGTGAACCCACA 59.044 47.619 0.08 0.0 45.54 4.17
112 113 8.743085 ACAGATACATCATCTTAACAATGCTT 57.257 30.769 0.00 0.0 41.49 3.91
136 137 7.211966 TCGTCTAATGGAGCCTTACTATAAC 57.788 40.000 0.00 0.0 0.00 1.89
139 140 6.493802 TCATTCGTCTAATGGAGCCTTACTAT 59.506 38.462 0.00 0.0 44.42 2.12
142 143 4.945246 TCATTCGTCTAATGGAGCCTTAC 58.055 43.478 0.00 0.0 44.42 2.34
158 159 6.701400 TGTATGTAACACCATCTGATCATTCG 59.299 38.462 0.00 0.0 31.43 3.34
161 162 8.985315 AATTGTATGTAACACCATCTGATCAT 57.015 30.769 0.00 0.0 38.00 2.45
1496 1549 4.840716 ATTACCCGTACCCATGTAAACA 57.159 40.909 0.00 0.0 0.00 2.83
1994 2049 9.634163 GGATAAAACCCAACTAAAAATGTACAG 57.366 33.333 0.33 0.0 0.00 2.74
2362 2422 4.565166 GCATGTGCACGATTACTAGTACAA 59.435 41.667 13.13 0.0 41.59 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.