Multiple sequence alignment - TraesCS3D01G092700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G092700 chr3D 100.000 2666 0 0 1 2666 46636082 46638747 0.000000e+00 4924
1 TraesCS3D01G092700 chr3D 97.765 1387 22 9 1 1383 46924242 46925623 0.000000e+00 2381
2 TraesCS3D01G092700 chr3D 94.860 1284 44 6 1401 2666 46959718 46960997 0.000000e+00 1986
3 TraesCS3D01G092700 chr3D 94.603 1297 34 13 1390 2666 46926093 46927373 0.000000e+00 1975
4 TraesCS3D01G092700 chr3D 96.938 849 22 3 367 1213 46958449 46959295 0.000000e+00 1421
5 TraesCS3D01G092700 chr3D 88.889 153 14 2 332 481 445112567 445112415 4.530000e-43 185
6 TraesCS3D01G092700 chr3A 92.598 716 50 2 665 1380 58311425 58312137 0.000000e+00 1026
7 TraesCS3D01G092700 chr3A 92.190 717 54 2 665 1380 58467631 58468346 0.000000e+00 1013
8 TraesCS3D01G092700 chr3A 92.083 720 53 3 665 1383 58549361 58550077 0.000000e+00 1011
9 TraesCS3D01G092700 chr3A 83.288 730 69 18 1384 2062 58468402 58469129 8.100000e-175 623
10 TraesCS3D01G092700 chr3A 83.450 713 74 14 1384 2053 58550130 58550841 8.100000e-175 623
11 TraesCS3D01G092700 chr3A 87.316 339 21 5 332 668 58679574 58679892 4.190000e-98 368
12 TraesCS3D01G092700 chr3A 83.673 392 42 7 1686 2058 58312333 58312721 1.520000e-92 350
13 TraesCS3D01G092700 chr3A 85.657 251 24 11 4 245 743027135 743026888 1.220000e-63 254
14 TraesCS3D01G092700 chr3A 90.511 137 12 1 1384 1519 58312193 58312329 2.110000e-41 180
15 TraesCS3D01G092700 chr5D 84.661 339 33 16 4 328 548866186 548866519 1.190000e-83 320
16 TraesCS3D01G092700 chr5D 89.404 151 12 3 332 478 123507770 123507920 1.260000e-43 187
17 TraesCS3D01G092700 chr1D 95.238 189 8 1 440 627 290125504 290125316 5.580000e-77 298
18 TraesCS3D01G092700 chr4D 94.709 189 9 1 440 627 393006551 393006363 2.600000e-75 292
19 TraesCS3D01G092700 chr6B 88.646 229 16 4 2438 2666 545595326 545595544 1.220000e-68 270
20 TraesCS3D01G092700 chr4A 81.790 324 38 19 19 330 155595786 155595472 4.410000e-63 252
21 TraesCS3D01G092700 chr4A 75.517 290 44 19 39 309 734071100 734070819 1.680000e-22 117
22 TraesCS3D01G092700 chr7A 86.580 231 21 3 2440 2666 652487195 652487419 2.050000e-61 246
23 TraesCS3D01G092700 chr7A 81.230 309 32 21 33 327 241741077 241741373 2.670000e-55 226
24 TraesCS3D01G092700 chr7A 87.919 149 15 2 336 481 260871680 260871532 3.530000e-39 172
25 TraesCS3D01G092700 chr7A 85.714 154 19 2 331 481 102564225 102564072 2.750000e-35 159
26 TraesCS3D01G092700 chr7B 81.395 301 37 15 26 317 448652236 448652526 7.420000e-56 228
27 TraesCS3D01G092700 chr6A 79.070 344 54 16 4 335 613941197 613941534 1.240000e-53 220
28 TraesCS3D01G092700 chr6A 88.356 146 14 2 336 478 272070134 272070279 3.530000e-39 172
29 TraesCS3D01G092700 chr5A 80.836 287 40 14 5 280 652672786 652673068 7.480000e-51 211
30 TraesCS3D01G092700 chr5A 83.628 226 24 13 120 335 621476787 621477009 1.620000e-47 200
31 TraesCS3D01G092700 chr4B 80.228 263 39 11 56 309 68982486 68982744 4.530000e-43 185
32 TraesCS3D01G092700 chr3B 88.535 157 13 4 325 478 565242191 565242345 4.530000e-43 185
33 TraesCS3D01G092700 chr7D 86.842 152 15 4 331 478 171625555 171625705 5.900000e-37 165
34 TraesCS3D01G092700 chr2B 86.000 150 18 2 332 478 401142546 401142397 9.880000e-35 158


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G092700 chr3D 46636082 46638747 2665 False 4924.000000 4924 100.000000 1 2666 1 chr3D.!!$F1 2665
1 TraesCS3D01G092700 chr3D 46924242 46927373 3131 False 2178.000000 2381 96.184000 1 2666 2 chr3D.!!$F2 2665
2 TraesCS3D01G092700 chr3D 46958449 46960997 2548 False 1703.500000 1986 95.899000 367 2666 2 chr3D.!!$F3 2299
3 TraesCS3D01G092700 chr3A 58467631 58469129 1498 False 818.000000 1013 87.739000 665 2062 2 chr3A.!!$F3 1397
4 TraesCS3D01G092700 chr3A 58549361 58550841 1480 False 817.000000 1011 87.766500 665 2053 2 chr3A.!!$F4 1388
5 TraesCS3D01G092700 chr3A 58311425 58312721 1296 False 518.666667 1026 88.927333 665 2058 3 chr3A.!!$F2 1393

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
472 474 6.405176 GGCTCTGCCCATAAATAGAAATATGC 60.405 42.308 0.0 0.0 44.06 3.14 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2156 2680 1.942586 GCGTAGGAAACACCAACCGAT 60.943 52.381 0.0 0.0 42.04 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 162 6.544038 AGCAAGCATTTGGAAAATGTTAAC 57.456 33.333 12.82 0.00 34.79 2.01
472 474 6.405176 GGCTCTGCCCATAAATAGAAATATGC 60.405 42.308 0.00 0.00 44.06 3.14
559 561 7.085746 TGATTTCGACATTCTACTTTACGTCA 58.914 34.615 0.00 0.00 0.00 4.35
574 576 8.080083 ACTTTACGTCACCTGTTACTAAATTG 57.920 34.615 0.00 0.00 0.00 2.32
819 823 9.461312 TGGTCAGTCTTATTAATGCTTTAACAT 57.539 29.630 6.92 0.00 30.33 2.71
1077 1083 4.532521 ACCTGCCTAGTGTTAACATCTTCT 59.467 41.667 12.26 6.63 0.00 2.85
1308 1314 5.763698 AGAATCAAGACACATCCATGCTATG 59.236 40.000 5.08 5.08 0.00 2.23
1383 1389 4.881273 GCTCATGTTACATATTGGTGTGGA 59.119 41.667 0.00 0.00 33.62 4.02
1384 1390 5.532406 GCTCATGTTACATATTGGTGTGGAT 59.468 40.000 0.00 0.00 33.62 3.41
1492 1961 3.403038 GTTCCAGATTATAGTGCGCCAT 58.597 45.455 4.18 0.00 0.00 4.40
1920 2425 1.702401 TGGCAGACCACCTATTTGTCA 59.298 47.619 0.00 0.00 42.67 3.58
1941 2446 4.124238 CAAGAACCACACTCGGTAAAAGA 58.876 43.478 0.00 0.00 38.76 2.52
1967 2472 7.233389 AGCACTTGATAGAGTCTTTAGTTCA 57.767 36.000 0.00 0.00 0.00 3.18
2030 2550 4.718940 TTGATGAGAGCTCGTGACATAA 57.281 40.909 8.37 3.92 0.00 1.90
2134 2658 0.249955 ATTTGCCGGCAATTTGGGAG 59.750 50.000 40.32 0.00 35.70 4.30
2156 2680 3.538785 TTAACCGGCGCCTTCAGCA 62.539 57.895 26.68 0.25 44.04 4.41
2294 2818 0.469144 AGTTGGCCGGTCAACCATTT 60.469 50.000 40.62 24.44 45.81 2.32
2476 3004 8.021396 GCTAGCTTTTCCTCGAAAGAAATTTTA 58.979 33.333 7.70 4.34 41.32 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
472 474 2.159476 AGCGCACATCAATGCTACTTTG 60.159 45.455 11.47 0.00 43.80 2.77
513 515 4.669768 TCAATAGGATTAAGGCCTTCCCAT 59.330 41.667 24.49 12.95 36.96 4.00
853 857 0.381801 ATGCTCGCGGGCTAATTTTG 59.618 50.000 33.56 0.00 0.00 2.44
1077 1083 8.594550 ACTTTAGAACTAGCCATCTTTCTTGTA 58.405 33.333 0.00 0.00 30.89 2.41
1308 1314 3.092081 GTGCGTGAATTTCTGGCAC 57.908 52.632 21.06 21.06 45.82 5.01
1388 1447 8.313292 AGCTTGGAAATTACATCAAAATGCTAA 58.687 29.630 0.00 0.00 36.26 3.09
1492 1961 3.162666 ACGATTAGTGTTCTGGAGGTGA 58.837 45.455 0.00 0.00 0.00 4.02
1920 2425 4.411256 TCTTTTACCGAGTGTGGTTCTT 57.589 40.909 0.00 0.00 43.56 2.52
1941 2446 8.150945 TGAACTAAAGACTCTATCAAGTGCTTT 58.849 33.333 0.00 0.00 34.27 3.51
1967 2472 6.091441 GTGTTATTTTTCTCACAGCTCTCGAT 59.909 38.462 0.00 0.00 0.00 3.59
2030 2550 3.014304 TGGCTCCTAGTTGTCGAGTAT 57.986 47.619 0.00 0.00 0.00 2.12
2134 2658 2.436115 AAGGCGCCGGTTAAGAGC 60.436 61.111 23.20 0.00 0.00 4.09
2156 2680 1.942586 GCGTAGGAAACACCAACCGAT 60.943 52.381 0.00 0.00 42.04 4.18
2476 3004 6.094061 GTGTCACTCTTCGAAGCTAACTATT 58.906 40.000 20.56 0.00 0.00 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.