Multiple sequence alignment - TraesCS3D01G052600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G052600 chr3D 100.000 2144 0 0 1 2144 21897213 21895070 0.000000e+00 3960
1 TraesCS3D01G052600 chr2D 98.463 2147 23 3 1 2144 628285322 628283183 0.000000e+00 3773
2 TraesCS3D01G052600 chr1D 98.183 2146 37 2 1 2144 254489354 254487209 0.000000e+00 3746
3 TraesCS3D01G052600 chr1D 95.014 2146 78 13 1 2144 244408270 244406152 0.000000e+00 3343
4 TraesCS3D01G052600 chr1D 94.641 2146 86 13 1 2144 244401819 244399701 0.000000e+00 3299
5 TraesCS3D01G052600 chr1D 94.044 2149 97 12 1 2144 244423807 244421685 0.000000e+00 3230
6 TraesCS3D01G052600 chr2A 97.075 2154 52 5 1 2144 276441420 276443572 0.000000e+00 3618
7 TraesCS3D01G052600 chr2A 86.512 215 22 3 1936 2144 747297845 747298058 1.660000e-56 230
8 TraesCS3D01G052600 chr2A 97.436 78 2 0 2064 2141 112916362 112916285 1.330000e-27 134
9 TraesCS3D01G052600 chr6D 98.211 2068 29 4 1 2064 431399683 431397620 0.000000e+00 3607
10 TraesCS3D01G052600 chr3B 96.897 2159 45 7 1 2144 201506232 201504081 0.000000e+00 3596
11 TraesCS3D01G052600 chr3B 97.561 123 2 1 44 166 21016929 21017050 2.160000e-50 209
12 TraesCS3D01G052600 chr1A 97.767 1926 32 3 225 2144 554465601 554467521 0.000000e+00 3308
13 TraesCS3D01G052600 chr2B 91.608 143 4 1 87 221 482854069 482853927 7.810000e-45 191
14 TraesCS3D01G052600 chr2B 100.000 100 0 0 23 122 655916503 655916404 3.630000e-43 185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G052600 chr3D 21895070 21897213 2143 True 3960 3960 100.000 1 2144 1 chr3D.!!$R1 2143
1 TraesCS3D01G052600 chr2D 628283183 628285322 2139 True 3773 3773 98.463 1 2144 1 chr2D.!!$R1 2143
2 TraesCS3D01G052600 chr1D 254487209 254489354 2145 True 3746 3746 98.183 1 2144 1 chr1D.!!$R4 2143
3 TraesCS3D01G052600 chr1D 244406152 244408270 2118 True 3343 3343 95.014 1 2144 1 chr1D.!!$R2 2143
4 TraesCS3D01G052600 chr1D 244399701 244401819 2118 True 3299 3299 94.641 1 2144 1 chr1D.!!$R1 2143
5 TraesCS3D01G052600 chr1D 244421685 244423807 2122 True 3230 3230 94.044 1 2144 1 chr1D.!!$R3 2143
6 TraesCS3D01G052600 chr2A 276441420 276443572 2152 False 3618 3618 97.075 1 2144 1 chr2A.!!$F1 2143
7 TraesCS3D01G052600 chr6D 431397620 431399683 2063 True 3607 3607 98.211 1 2064 1 chr6D.!!$R1 2063
8 TraesCS3D01G052600 chr3B 201504081 201506232 2151 True 3596 3596 96.897 1 2144 1 chr3B.!!$R1 2143
9 TraesCS3D01G052600 chr1A 554465601 554467521 1920 False 3308 3308 97.767 225 2144 1 chr1A.!!$F1 1919

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
202 225 2.380064 ACCAGGCAAAACCAGATTGA 57.62 45.0 0.0 0.0 43.14 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1594 1629 1.822371 GGTCTGTCTCTTGGACCTCTC 59.178 57.143 0.0 0.0 44.21 3.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 132 5.410924 GGGTTTTCTATTGATGCCTTGAAC 58.589 41.667 0.00 0.00 0.00 3.18
202 225 2.380064 ACCAGGCAAAACCAGATTGA 57.620 45.000 0.00 0.00 43.14 2.57
329 352 3.517901 ACTGGTCGATCCCATCTTTTACA 59.482 43.478 0.00 0.00 33.00 2.41
1072 1096 4.448720 TGGCTGATAGGTACTGTAGCTA 57.551 45.455 24.11 24.11 41.52 3.32
1359 1383 6.685527 GGAAGTATCCTGAAAATCCTTGAC 57.314 41.667 0.00 0.00 42.93 3.18
1590 1625 3.694566 CCTCGGCTAAACCTAAGCAAAAT 59.305 43.478 0.00 0.00 41.93 1.82
1594 1629 6.848451 TCGGCTAAACCTAAGCAAAATAAAG 58.152 36.000 0.00 0.00 41.93 1.85
1798 1837 1.280710 TCTCGCCTTTGCCTTGGATTA 59.719 47.619 0.00 0.00 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
173 196 1.028905 TTTGCCTGGTTCCGAAACAG 58.971 50.000 17.90 17.90 37.10 3.16
725 748 5.361571 TGGATGAACTGCATTGCTGATATTT 59.638 36.000 20.66 5.78 37.34 1.40
1072 1096 5.228945 ACTAAACCAATCACAGCAGTACT 57.771 39.130 0.00 0.00 0.00 2.73
1076 1100 4.393062 CACCTACTAAACCAATCACAGCAG 59.607 45.833 0.00 0.00 0.00 4.24
1233 1257 7.830940 TCGCGTTATAAGAGTAAAAATTCCA 57.169 32.000 5.77 0.00 0.00 3.53
1590 1625 4.767928 GTCTGTCTCTTGGACCTCTCTTTA 59.232 45.833 0.00 0.00 43.89 1.85
1594 1629 1.822371 GGTCTGTCTCTTGGACCTCTC 59.178 57.143 0.00 0.00 44.21 3.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.