Multiple sequence alignment - TraesCS3B01G188100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G188100 chr3B 100.000 2255 0 0 1 2255 201537588 201535334 0 4165
1 TraesCS3B01G188100 chr6D 98.848 2256 25 1 1 2255 389255237 389252982 0 4021
2 TraesCS3B01G188100 chr6D 98.715 2256 28 1 1 2255 389250442 389248187 0 4004
3 TraesCS3B01G188100 chr3A 98.670 2256 28 2 1 2255 66007064 66009318 0 3999
4 TraesCS3B01G188100 chr3D 98.582 2256 30 2 1 2255 589265455 589267709 0 3988


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G188100 chr3B 201535334 201537588 2254 True 4165.0 4165 100.0000 1 2255 1 chr3B.!!$R1 2254
1 TraesCS3B01G188100 chr6D 389248187 389255237 7050 True 4012.5 4021 98.7815 1 2255 2 chr6D.!!$R1 2254
2 TraesCS3B01G188100 chr3A 66007064 66009318 2254 False 3999.0 3999 98.6700 1 2255 1 chr3A.!!$F1 2254
3 TraesCS3B01G188100 chr3D 589265455 589267709 2254 False 3988.0 3988 98.5820 1 2255 1 chr3D.!!$F1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
355 356 0.036306 CCAAGGGCAGGTTCTTACGT 59.964 55.0 0.0 0.0 0.0 3.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1496 1497 4.41154 AGGATTGTACCATGAGAGAAGCAT 59.588 41.667 0.0 0.0 0.0 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 114 2.262915 CTCCGTCAGGCTTTCGCT 59.737 61.111 3.05 0.00 37.47 4.93
279 280 0.749454 CCTCCTTGGGCGGATTTCTG 60.749 60.000 0.00 0.00 31.43 3.02
355 356 0.036306 CCAAGGGCAGGTTCTTACGT 59.964 55.000 0.00 0.00 0.00 3.57
367 368 3.243839 GGTTCTTACGTGTTACTCACCCA 60.244 47.826 0.00 0.00 43.51 4.51
371 372 4.525487 TCTTACGTGTTACTCACCCATTCT 59.475 41.667 0.00 0.00 43.51 2.40
441 442 0.463295 CAGCGTTCATCCTGAGCCAT 60.463 55.000 0.00 0.00 0.00 4.40
637 638 3.117738 CCCACAAGCCTCTTATCCATTCT 60.118 47.826 0.00 0.00 0.00 2.40
708 709 3.394606 GGGTTTAGGGATAATCAGGCTCA 59.605 47.826 0.00 0.00 0.00 4.26
768 769 2.979678 GCTGAGTTATATCCCTTCCCCA 59.020 50.000 0.00 0.00 0.00 4.96
861 862 4.023963 GGGCTTTCTTTCCGCACTATTATC 60.024 45.833 0.00 0.00 0.00 1.75
968 969 7.066887 TCGCACATGGTTTCATAAAATCTGTAT 59.933 33.333 0.00 0.00 31.33 2.29
1038 1039 8.459911 TGTTCAGGATGTTCTATTCGATACTA 57.540 34.615 0.00 0.00 37.40 1.82
1222 1223 1.160137 CCACGCCCTTTTCTTGAGAG 58.840 55.000 0.00 0.00 0.00 3.20
1496 1497 1.344065 TTGAAGCGGGTTGACCTCTA 58.656 50.000 0.00 0.00 36.97 2.43
1548 1549 4.491409 GCCCCCTTTCTCCTCGGC 62.491 72.222 0.00 0.00 0.00 5.54
1790 1792 9.231297 TGCAATCGATCGGATCATATAGATATA 57.769 33.333 16.41 0.00 37.00 0.86
1890 1892 2.178912 TTTGAAGAGTGCCTAACCGG 57.821 50.000 0.00 0.00 0.00 5.28
2209 7007 7.041712 GGATTGATACCGAGAAAGATTTCTTCC 60.042 40.741 9.11 5.48 46.84 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
355 356 3.007940 CAGTGGAGAATGGGTGAGTAACA 59.992 47.826 0.00 0.0 0.00 2.41
441 442 4.646492 TGAATCTCATGGAGAGTTCGATCA 59.354 41.667 2.13 0.0 42.26 2.92
482 483 6.032956 TGCTTTGTCTACGAATAAGGAAGA 57.967 37.500 0.00 0.0 0.00 2.87
708 709 2.158813 ACGTGGTGGAAGTCATCAGTTT 60.159 45.455 0.00 0.0 37.13 2.66
768 769 5.986135 CGTTAATTCTCTTTCTCGATGGGAT 59.014 40.000 0.00 0.0 0.00 3.85
861 862 9.248291 CCAATTTTTCCCATTATTTGACTATCG 57.752 33.333 0.00 0.0 0.00 2.92
1020 1021 9.656040 TCTCCTACTAGTATCGAATAGAACATC 57.344 37.037 2.33 0.0 0.00 3.06
1038 1039 2.725637 GAGTCGGGTTCTTCTCCTACT 58.274 52.381 0.00 0.0 0.00 2.57
1222 1223 4.425577 AATTTGTCCTCATGTTTCGAGC 57.574 40.909 0.00 0.0 0.00 5.03
1496 1497 4.411540 AGGATTGTACCATGAGAGAAGCAT 59.588 41.667 0.00 0.0 0.00 3.79
1790 1792 4.431416 TGACCTATGTTGTGTTGAAGGT 57.569 40.909 0.00 0.0 39.99 3.50
1890 1892 4.452455 CGGGTTAATGTGAGCTTATCCATC 59.548 45.833 0.00 0.0 0.00 3.51
2209 7007 9.196552 TGCAGATCAAATCACGTCTTATAATAG 57.803 33.333 0.00 0.0 0.00 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.