Multiple sequence alignment - TraesCS3B01G010400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G010400 chr3B 100.000 3672 0 0 1 3672 4784695 4788366 0.000000e+00 6782.0
1 TraesCS3B01G010400 chr3B 99.619 3675 10 2 1 3672 3897769 3901442 0.000000e+00 6706.0
2 TraesCS3B01G010400 chr3B 100.000 43 0 0 3238 3280 3900965 3901007 3.040000e-11 80.5
3 TraesCS3B01G010400 chr3A 90.062 3059 161 51 261 3237 7275872 7272875 0.000000e+00 3832.0
4 TraesCS3B01G010400 chr3A 92.807 431 21 7 3244 3672 7272911 7272489 1.870000e-172 616.0
5 TraesCS3B01G010400 chr3A 83.478 115 3 4 26 124 7276023 7275909 3.900000e-15 93.5
6 TraesCS3B01G010400 chr3A 100.000 28 0 0 2 29 7276130 7276103 7.000000e-03 52.8
7 TraesCS3B01G010400 chr3D 86.318 2273 172 67 599 2778 1748171 1750397 0.000000e+00 2346.0
8 TraesCS3B01G010400 chr3D 81.167 600 43 37 2 542 1747585 1748173 5.670000e-113 418.0
9 TraesCS3B01G010400 chr3D 85.165 182 17 7 3486 3667 1751026 1751197 1.050000e-40 178.0
10 TraesCS3B01G010400 chr6D 94.286 70 4 0 2164 2233 362635200 362635269 1.390000e-19 108.0
11 TraesCS3B01G010400 chr6D 94.286 70 4 0 2164 2233 362888789 362888858 1.390000e-19 108.0
12 TraesCS3B01G010400 chr6D 92.857 70 5 0 2164 2233 362954662 362954731 6.490000e-18 102.0
13 TraesCS3B01G010400 chr6A 94.286 70 4 0 2164 2233 502929856 502929925 1.390000e-19 108.0
14 TraesCS3B01G010400 chr6A 94.286 70 4 0 2164 2233 503249528 503249597 1.390000e-19 108.0
15 TraesCS3B01G010400 chr6B 92.857 70 5 0 2164 2233 544092875 544092944 6.490000e-18 102.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G010400 chr3B 4784695 4788366 3671 False 6782.000000 6782 100.000000 1 3672 1 chr3B.!!$F1 3671
1 TraesCS3B01G010400 chr3B 3897769 3901442 3673 False 3393.250000 6706 99.809500 1 3672 2 chr3B.!!$F2 3671
2 TraesCS3B01G010400 chr3A 7272489 7276130 3641 True 1148.575000 3832 91.586750 2 3672 4 chr3A.!!$R1 3670
3 TraesCS3B01G010400 chr3D 1747585 1751197 3612 False 980.666667 2346 84.216667 2 3667 3 chr3D.!!$F1 3665

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1605 1784 1.08437 GCCGATGTCGTCCCAGAAAG 61.084 60.0 1.44 0.0 37.74 2.62 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2946 3276 1.311859 TGCACTCAAGCCTCTTTGTG 58.688 50.0 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1605 1784 1.084370 GCCGATGTCGTCCCAGAAAG 61.084 60.000 1.44 0.0 37.74 2.62
2946 3276 5.239087 ACCACATGGAAAACAAATGAATTGC 59.761 36.000 4.53 0.0 39.62 3.56
3210 3572 7.678194 TTTTTACAAGTTTGAGATGAAAGCG 57.322 32.000 0.00 0.0 0.00 4.68
3498 3927 1.359848 GCAAACATCGGAGATCGTGT 58.640 50.000 0.00 0.0 45.12 4.49
3614 4043 1.484240 ACTCCTTAGGATGCTGCTGAC 59.516 52.381 0.00 0.0 0.00 3.51
3641 4070 2.208431 GCCATCATGTCTCAGTACAGC 58.792 52.381 0.00 0.0 31.70 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1605 1784 1.077930 TTGATGCTGCTCTCCTGGC 60.078 57.895 0.00 0.00 0.00 4.85
2946 3276 1.311859 TGCACTCAAGCCTCTTTGTG 58.688 50.000 0.00 0.00 0.00 3.33
3190 3552 4.385825 ACCGCTTTCATCTCAAACTTGTA 58.614 39.130 0.00 0.00 0.00 2.41
3210 3572 4.086199 TGACGCGGAATTGATTTTAACC 57.914 40.909 12.47 0.00 0.00 2.85
3498 3927 5.036117 AGAGAAGAAAACACAAGTAGCCA 57.964 39.130 0.00 0.00 0.00 4.75
3614 4043 2.737252 CTGAGACATGATGGCATCATCG 59.263 50.000 34.13 28.87 46.62 3.84
3641 4070 1.933853 GATGAGAAATTCGTGTCCCCG 59.066 52.381 0.00 0.00 0.00 5.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.