Multiple sequence alignment - TraesCS3A01G329500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G329500 chr3A 100.000 2543 0 0 1 2543 574507720 574510262 0.000000e+00 4697.0
1 TraesCS3A01G329500 chr3A 99.481 2120 11 0 1 2120 65005481 65007600 0.000000e+00 3855.0
2 TraesCS3A01G329500 chr3A 100.000 428 0 0 2116 2543 65018302 65018729 0.000000e+00 791.0
3 TraesCS3A01G329500 chr3A 96.970 33 1 0 143 175 722498428 722498460 3.530000e-04 56.5
4 TraesCS3A01G329500 chr3D 97.459 2558 36 12 2 2543 54002589 54005133 0.000000e+00 4337.0
5 TraesCS3A01G329500 chr3D 81.550 542 88 8 1024 1554 608195048 608195588 1.080000e-118 436.0
6 TraesCS3A01G329500 chr3B 97.591 1453 34 1 258 1709 84455490 84456942 0.000000e+00 2488.0
7 TraesCS3A01G329500 chr3B 91.889 826 24 17 1750 2543 84456933 84457747 0.000000e+00 1114.0
8 TraesCS3A01G329500 chr4A 86.626 329 30 7 2081 2404 702000198 702000517 4.030000e-93 351.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G329500 chr3A 574507720 574510262 2542 False 4697 4697 100.000 1 2543 1 chr3A.!!$F3 2542
1 TraesCS3A01G329500 chr3A 65005481 65007600 2119 False 3855 3855 99.481 1 2120 1 chr3A.!!$F1 2119
2 TraesCS3A01G329500 chr3D 54002589 54005133 2544 False 4337 4337 97.459 2 2543 1 chr3D.!!$F1 2541
3 TraesCS3A01G329500 chr3D 608195048 608195588 540 False 436 436 81.550 1024 1554 1 chr3D.!!$F2 530
4 TraesCS3A01G329500 chr3B 84455490 84457747 2257 False 1801 2488 94.740 258 2543 2 chr3B.!!$F1 2285

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
153 157 4.524802 TTCCTGTGGAATTGAGGCATAT 57.475 40.909 0.0 0.0 36.71 1.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2025 2055 0.038166 ATGCAATGTTGGACCCTCGT 59.962 50.0 0.0 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 157 4.524802 TTCCTGTGGAATTGAGGCATAT 57.475 40.909 0.0 0.0 36.71 1.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
659 663 1.629043 AGCCCTCGTCAAGACAGTAA 58.371 50.000 0.72 0.0 0.00 2.24
666 670 2.961526 TTAGCTTAGCCCTCGTCAAG 57.038 50.000 0.00 0.0 0.00 3.02
1201 1222 3.050275 GGCCGAACCTGCTGTGAC 61.050 66.667 0.00 0.0 34.51 3.67
2025 2055 0.038166 ATGCAATGTTGGACCCTCGT 59.962 50.000 0.00 0.0 0.00 4.18
2086 2116 6.183360 CCAGCTGTAACTTGGAACTAATCATG 60.183 42.308 13.81 0.0 33.76 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.