Multiple sequence alignment - TraesCS3A01G262600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G262600 chr3A 100.000 3288 0 0 1 3288 485591794 485595081 0.000000e+00 6072
1 TraesCS3A01G262600 chr3A 99.574 3288 13 1 1 3288 485676416 485679702 0.000000e+00 5993
2 TraesCS3A01G262600 chr3B 96.608 2683 55 14 620 3285 474399216 474401879 0.000000e+00 4418
3 TraesCS3A01G262600 chr3B 88.789 446 47 3 190 635 474398748 474399190 8.020000e-151 544
4 TraesCS3A01G262600 chr3B 85.417 192 23 1 9 200 474397660 474397846 9.310000e-46 195
5 TraesCS3A01G262600 chr3D 93.854 2766 92 23 525 3279 364253355 364256053 0.000000e+00 4095
6 TraesCS3A01G262600 chr3D 88.994 527 50 7 1 527 364252773 364253291 0.000000e+00 645
7 TraesCS3A01G262600 chr3D 83.389 301 39 8 1356 1650 29688787 29688492 5.410000e-68 268
8 TraesCS3A01G262600 chr4B 87.895 380 39 7 1356 1733 3864761 3864387 1.080000e-119 440
9 TraesCS3A01G262600 chr1D 87.952 332 33 6 1400 1729 75937053 75936727 5.150000e-103 385
10 TraesCS3A01G262600 chr1D 84.906 212 25 3 1084 1289 457143654 457143864 1.200000e-49 207
11 TraesCS3A01G262600 chr7D 86.486 296 33 6 1356 1650 595979833 595979544 5.290000e-83 318
12 TraesCS3A01G262600 chr5D 86.316 285 33 5 1367 1650 529531954 529531675 4.120000e-79 305
13 TraesCS3A01G262600 chr1B 83.190 232 32 6 1063 1288 626704831 626705061 4.300000e-49 206
14 TraesCS3A01G262600 chr1A 85.024 207 25 2 1089 1289 549838002 549838208 4.300000e-49 206


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G262600 chr3A 485591794 485595081 3287 False 6072 6072 100.000000 1 3288 1 chr3A.!!$F1 3287
1 TraesCS3A01G262600 chr3A 485676416 485679702 3286 False 5993 5993 99.574000 1 3288 1 chr3A.!!$F2 3287
2 TraesCS3A01G262600 chr3B 474397660 474401879 4219 False 1719 4418 90.271333 9 3285 3 chr3B.!!$F1 3276
3 TraesCS3A01G262600 chr3D 364252773 364256053 3280 False 2370 4095 91.424000 1 3279 2 chr3D.!!$F1 3278

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
606 1586 4.466015 AGAACAAACAACTGGGACAACAAT 59.534 37.500 0.0 0.0 38.7 2.71 F
1820 2850 3.805207 AGAGCACAACGGAACTTTTACT 58.195 40.909 0.0 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1820 2850 2.552599 AGCTCTATCCGACTCGATCA 57.447 50.000 0.0 0.0 0.0 2.92 R
2889 3923 4.030216 TGCACCTATCCTTACTGACATCA 58.970 43.478 0.0 0.0 0.0 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
479 1393 6.433847 TGAAAATAGTCTCTTTCAGGTGGA 57.566 37.500 6.11 0.0 36.79 4.02
606 1586 4.466015 AGAACAAACAACTGGGACAACAAT 59.534 37.500 0.00 0.0 38.70 2.71
1820 2850 3.805207 AGAGCACAACGGAACTTTTACT 58.195 40.909 0.00 0.0 0.00 2.24
1901 2931 4.041815 GGTCAGGTCCTTCCTAGACTTTTT 59.958 45.833 6.33 0.0 46.24 1.94
3104 4159 3.323403 TGCATTTTTGAAATCCCGGACTT 59.677 39.130 0.73 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
479 1393 5.749462 CAGGAAGTCTGAAATAGAATGGGT 58.251 41.667 0.00 0.00 46.18 4.51
606 1586 2.880443 ACCTAGGTTGAGGACACGTTA 58.120 47.619 9.21 0.00 39.15 3.18
1043 2069 4.120331 GCAACAGCGGCATCACCC 62.120 66.667 1.45 0.00 33.26 4.61
1820 2850 2.552599 AGCTCTATCCGACTCGATCA 57.447 50.000 0.00 0.00 0.00 2.92
1901 2931 5.303078 TGCAGGGTAACAAGATTTAAGCAAA 59.697 36.000 0.00 0.00 39.74 3.68
2050 3080 6.995511 AAGAAGTTTACAACAGCACTAACA 57.004 33.333 0.00 0.00 0.00 2.41
2873 3907 7.458397 ACTGACATCAAGGTAATAACAGGAAA 58.542 34.615 0.00 0.00 0.00 3.13
2874 3908 7.016153 ACTGACATCAAGGTAATAACAGGAA 57.984 36.000 0.00 0.00 0.00 3.36
2875 3909 6.620877 ACTGACATCAAGGTAATAACAGGA 57.379 37.500 0.00 0.00 0.00 3.86
2876 3910 7.495934 CCTTACTGACATCAAGGTAATAACAGG 59.504 40.741 0.00 0.00 35.18 4.00
2877 3911 8.258007 TCCTTACTGACATCAAGGTAATAACAG 58.742 37.037 12.58 0.00 39.89 3.16
2878 3912 8.141298 TCCTTACTGACATCAAGGTAATAACA 57.859 34.615 12.58 0.00 39.89 2.41
2881 3915 9.090103 CCTATCCTTACTGACATCAAGGTAATA 57.910 37.037 12.58 6.07 39.89 0.98
2882 3916 7.569111 ACCTATCCTTACTGACATCAAGGTAAT 59.431 37.037 12.58 5.43 39.89 1.89
2883 3917 6.901300 ACCTATCCTTACTGACATCAAGGTAA 59.099 38.462 12.58 1.10 39.89 2.85
2884 3918 6.323996 CACCTATCCTTACTGACATCAAGGTA 59.676 42.308 12.58 6.37 39.89 3.08
2885 3919 5.129485 CACCTATCCTTACTGACATCAAGGT 59.871 44.000 12.58 0.00 39.89 3.50
2886 3920 5.605534 CACCTATCCTTACTGACATCAAGG 58.394 45.833 8.34 8.34 40.23 3.61
2887 3921 5.053145 GCACCTATCCTTACTGACATCAAG 58.947 45.833 0.00 0.00 0.00 3.02
2888 3922 4.469586 TGCACCTATCCTTACTGACATCAA 59.530 41.667 0.00 0.00 0.00 2.57
2889 3923 4.030216 TGCACCTATCCTTACTGACATCA 58.970 43.478 0.00 0.00 0.00 3.07
2890 3924 4.672587 TGCACCTATCCTTACTGACATC 57.327 45.455 0.00 0.00 0.00 3.06
2891 3925 5.186198 GTTTGCACCTATCCTTACTGACAT 58.814 41.667 0.00 0.00 0.00 3.06
2892 3926 4.041075 TGTTTGCACCTATCCTTACTGACA 59.959 41.667 0.00 0.00 0.00 3.58
2893 3927 4.575885 TGTTTGCACCTATCCTTACTGAC 58.424 43.478 0.00 0.00 0.00 3.51
3104 4159 6.650807 GGTAAACACTTCTGATCAGAACATGA 59.349 38.462 32.63 18.22 42.06 3.07
3222 4289 7.895975 TGCATCAAATATCCTTAGAGAATCG 57.104 36.000 0.00 0.00 42.67 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.