Multiple sequence alignment - TraesCS2D01G488000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G488000 chr2D 100.000 3593 0 0 1 3593 587651028 587647436 0.000000e+00 6636.0
1 TraesCS2D01G488000 chr2D 98.874 2576 11 3 1018 3593 644637041 644634484 0.000000e+00 4580.0
2 TraesCS2D01G488000 chr2D 99.101 556 4 1 1 556 644638002 644637448 0.000000e+00 998.0
3 TraesCS2D01G488000 chr2D 98.837 344 4 0 678 1021 644637413 644637070 6.590000e-172 614.0
4 TraesCS2D01G488000 chr2B 87.764 1561 101 40 1495 3040 710101502 710100017 0.000000e+00 1742.0
5 TraesCS2D01G488000 chr2B 93.269 936 32 14 1731 2661 710045817 710044908 0.000000e+00 1351.0
6 TraesCS2D01G488000 chr2B 88.608 1027 67 26 624 1606 710046941 710045921 0.000000e+00 1203.0
7 TraesCS2D01G488000 chr2B 86.808 614 26 13 3009 3593 710042611 710042024 5.060000e-178 634.0
8 TraesCS2D01G488000 chr2B 85.820 543 45 18 1 536 710102907 710102390 6.780000e-152 547.0
9 TraesCS2D01G488000 chr2B 86.481 466 41 16 562 1021 710102398 710101949 3.220000e-135 492.0
10 TraesCS2D01G488000 chr2B 81.619 457 52 13 1021 1452 710101913 710101464 2.050000e-92 350.0
11 TraesCS2D01G488000 chr2B 94.059 202 12 0 2659 2860 710044781 710044580 1.250000e-79 307.0
12 TraesCS2D01G488000 chr2B 89.474 171 12 2 3280 3450 710099814 710099650 1.010000e-50 211.0
13 TraesCS2D01G488000 chr2B 95.082 122 3 3 2861 2980 710042726 710042606 4.740000e-44 189.0
14 TraesCS2D01G488000 chr2B 87.755 98 10 2 548 644 710061376 710061280 2.930000e-21 113.0
15 TraesCS2D01G488000 chr2A 85.472 1177 78 36 1495 2653 722320831 722319730 0.000000e+00 1140.0
16 TraesCS2D01G488000 chr2A 85.962 520 35 21 524 1021 722321760 722321257 4.110000e-144 521.0
17 TraesCS2D01G488000 chr2A 83.430 519 68 7 1018 1533 722321224 722320721 1.950000e-127 466.0
18 TraesCS2D01G488000 chr2A 76.812 552 58 34 2946 3450 722319349 722318821 2.770000e-61 246.0
19 TraesCS2D01G488000 chr2A 81.716 268 16 11 72 314 722492022 722491763 3.660000e-45 193.0
20 TraesCS2D01G488000 chr2A 97.959 49 1 0 1 49 722492072 722492024 6.390000e-13 86.1
21 TraesCS2D01G488000 chr6B 87.500 376 32 10 1626 1997 153228714 153229078 1.540000e-113 420.0
22 TraesCS2D01G488000 chr6B 84.173 139 10 5 2031 2168 153229034 153229161 1.350000e-24 124.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G488000 chr2D 587647436 587651028 3592 True 6636.00 6636 100.000000 1 3593 1 chr2D.!!$R1 3592
1 TraesCS2D01G488000 chr2D 644634484 644638002 3518 True 2064.00 4580 98.937333 1 3593 3 chr2D.!!$R2 3592
2 TraesCS2D01G488000 chr2B 710042024 710046941 4917 True 736.80 1351 91.565200 624 3593 5 chr2B.!!$R2 2969
3 TraesCS2D01G488000 chr2B 710099650 710102907 3257 True 668.40 1742 86.231600 1 3450 5 chr2B.!!$R3 3449
4 TraesCS2D01G488000 chr2A 722318821 722321760 2939 True 593.25 1140 82.919000 524 3450 4 chr2A.!!$R1 2926

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
975 1024 1.697432 CTCCCGCTCCCATATAAACCA 59.303 52.381 0.0 0.0 0.0 3.67 F
1783 2042 6.732154 CGCAAGGTATGAATGAATTGAATCT 58.268 36.000 0.0 0.0 0.0 2.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1838 2101 2.690881 TGCCGATTACCAGGGCCT 60.691 61.111 0.00 0.0 46.31 5.19 R
2697 3130 2.821378 TGGACGGTCGAGAACAAGAATA 59.179 45.455 1.43 0.0 0.00 1.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
645 666 7.792508 GCGTTCTCATAAAATTCGAATTCGTAT 59.207 33.333 25.93 19.68 40.80 3.06
647 668 9.582223 GTTCTCATAAAATTCGAATTCGTATCC 57.418 33.333 25.93 3.79 40.80 2.59
975 1024 1.697432 CTCCCGCTCCCATATAAACCA 59.303 52.381 0.00 0.00 0.00 3.67
1783 2042 6.732154 CGCAAGGTATGAATGAATTGAATCT 58.268 36.000 0.00 0.00 0.00 2.40
2340 2608 0.727398 GATCAACCTGCAGTTACGGC 59.273 55.000 13.81 0.00 36.18 5.68
2697 3130 5.772672 CCTTCTACTAGGTAGAGCATGTCAT 59.227 44.000 7.35 0.00 44.46 3.06
2974 5264 1.981256 ATCGTCCAGGCTTGTGTTTT 58.019 45.000 0.00 0.00 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
663 684 3.838903 AGGTTTCTGGATTTCCTACGTCT 59.161 43.478 0.00 0.00 36.82 4.18
664 685 4.182339 GAGGTTTCTGGATTTCCTACGTC 58.818 47.826 0.00 0.09 36.82 4.34
975 1024 4.716977 GTCGACCAGGGGAGGGGT 62.717 72.222 3.51 0.00 40.96 4.95
1783 2042 8.114331 AGCACAGAATGAATGAATGAAAACTA 57.886 30.769 0.00 0.00 39.69 2.24
1838 2101 2.690881 TGCCGATTACCAGGGCCT 60.691 61.111 0.00 0.00 46.31 5.19
2478 2759 7.613585 TGTTTATAGTTCGTCCCATGACTTTA 58.386 34.615 0.00 0.00 39.47 1.85
2479 2760 6.469410 TGTTTATAGTTCGTCCCATGACTTT 58.531 36.000 0.00 0.00 39.47 2.66
2697 3130 2.821378 TGGACGGTCGAGAACAAGAATA 59.179 45.455 1.43 0.00 0.00 1.75
3375 5755 7.951591 AGATAGAAGATCTAGGCTTCAAAGAC 58.048 38.462 20.81 11.44 43.19 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.