Multiple sequence alignment - TraesCS2D01G343600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G343600 chr2D 100.000 2315 0 0 1 2315 439955166 439957480 0.000000e+00 4276
1 TraesCS2D01G343600 chr2D 99.197 1121 9 0 1195 2315 439670166 439669046 0.000000e+00 2021
2 TraesCS2D01G343600 chr2D 98.029 1167 15 4 1 1166 439671323 439670164 0.000000e+00 2021
3 TraesCS2D01G343600 chr2B 98.359 2316 26 7 1 2315 517704750 517702446 0.000000e+00 4056
4 TraesCS2D01G343600 chr2A 98.273 2316 33 2 1 2315 583157382 583159691 0.000000e+00 4048
5 TraesCS2D01G343600 chrUn 93.421 76 5 0 1064 1139 29234857 29234782 1.880000e-21 113
6 TraesCS2D01G343600 chr5A 91.026 78 7 0 1064 1141 708431971 708432048 3.150000e-19 106


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G343600 chr2D 439955166 439957480 2314 False 4276 4276 100.000 1 2315 1 chr2D.!!$F1 2314
1 TraesCS2D01G343600 chr2D 439669046 439671323 2277 True 2021 2021 98.613 1 2315 2 chr2D.!!$R1 2314
2 TraesCS2D01G343600 chr2B 517702446 517704750 2304 True 4056 4056 98.359 1 2315 1 chr2B.!!$R1 2314
3 TraesCS2D01G343600 chr2A 583157382 583159691 2309 False 4048 4048 98.273 1 2315 1 chr2A.!!$F1 2314

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
290 292 1.066143 CGTCAGCCCCAAATACTCAGT 60.066 52.381 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2154 2156 1.743394 GCCCCTTTCCATCGTAAACAG 59.257 52.381 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 7.101054 ACTAGTTTGTATCGATTTGTGGCTAA 58.899 34.615 1.71 0.0 0.00 3.09
290 292 1.066143 CGTCAGCCCCAAATACTCAGT 60.066 52.381 0.00 0.0 0.00 3.41
1250 1252 0.034896 GCAGAGTCCCGTTCCTTTCA 59.965 55.000 0.00 0.0 0.00 2.69
1783 1785 5.070847 AGCCTTAGCCAATTCCAAATAATGG 59.929 40.000 0.00 0.0 45.88 3.16
2060 2062 6.039159 TGCTATTTTCAACAGTCACATGAACA 59.961 34.615 0.00 0.0 33.13 3.18
2105 2107 2.001361 GCCACACATGCTGCCATCTC 62.001 60.000 0.00 0.0 0.00 2.75
2154 2156 1.133790 CCTTGGCATCTACAGCAAAGC 59.866 52.381 0.00 0.0 40.84 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
452 454 2.078392 GCGTCGGAGGTAATTTTTGGA 58.922 47.619 0.00 0.0 0.00 3.53
482 484 4.838152 CCGGATGGGTCACAGGCG 62.838 72.222 0.00 0.0 0.00 5.52
486 488 0.474614 TTTTGTCCGGATGGGTCACA 59.525 50.000 7.81 0.0 33.39 3.58
1250 1252 3.883744 CTGAGGAAACGCACGGGCT 62.884 63.158 8.62 0.0 35.75 5.19
1783 1785 7.453034 GTTTTAGTTTGCCTGTTTTGAACTTC 58.547 34.615 0.00 0.0 33.13 3.01
2154 2156 1.743394 GCCCCTTTCCATCGTAAACAG 59.257 52.381 0.00 0.0 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.