Multiple sequence alignment - TraesCS2D01G284300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G284300 chr2D 100.000 2405 0 0 1 2405 359398347 359400751 0 4442
1 TraesCS2D01G284300 chr2A 97.176 2408 56 9 1 2401 483602762 483600360 0 4060
2 TraesCS2D01G284300 chr2B 96.892 2413 57 10 1 2401 427247842 427245436 0 4024


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G284300 chr2D 359398347 359400751 2404 False 4442 4442 100.000 1 2405 1 chr2D.!!$F1 2404
1 TraesCS2D01G284300 chr2A 483600360 483602762 2402 True 4060 4060 97.176 1 2401 1 chr2A.!!$R1 2400
2 TraesCS2D01G284300 chr2B 427245436 427247842 2406 True 4024 4024 96.892 1 2401 1 chr2B.!!$R1 2400

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
304 308 4.459337 CCCTAAAGAAAAGGACACATCACC 59.541 45.833 0.0 0.0 36.08 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1858 1876 1.333177 ATCCCGGTCTCTCTATGTGC 58.667 55.0 0.0 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 302 6.710597 AGTTTTCCCTAAAGAAAAGGACAC 57.289 37.500 0.00 0.00 44.23 3.67
299 303 6.192044 AGTTTTCCCTAAAGAAAAGGACACA 58.808 36.000 0.00 0.00 44.23 3.72
304 308 4.459337 CCCTAAAGAAAAGGACACATCACC 59.541 45.833 0.00 0.00 36.08 4.02
320 324 9.865321 GACACATCACCTAGTTTTATTAGTACA 57.135 33.333 0.00 0.00 0.00 2.90
563 571 6.554334 TGTGAAATAGGCTTGACTTTGTAC 57.446 37.500 0.00 0.00 0.00 2.90
611 619 7.699391 CAGAACATATACGGTTTAACTTCGAGA 59.301 37.037 1.20 0.00 0.00 4.04
1047 1063 1.068417 GTGGTACATGCCGGCGATA 59.932 57.895 23.90 11.15 44.52 2.92
1683 1701 7.358263 AGAGATCTAGTGTTCATCTCCCTTTA 58.642 38.462 12.48 0.00 42.46 1.85
1746 1764 5.850557 TGTGTGTTCATCCTTTGACATTT 57.149 34.783 0.00 0.00 32.84 2.32
1753 1771 7.492344 GTGTTCATCCTTTGACATTTTTGTCTT 59.508 33.333 7.55 0.00 39.41 3.01
1768 1786 4.335082 TTGTCTTGTGTGTTCTTTCGTG 57.665 40.909 0.00 0.00 0.00 4.35
1787 1805 1.977854 TGGTTAGTGGTCAGATGCTGT 59.022 47.619 0.00 0.00 32.61 4.40
1899 1917 7.867909 GGGATACAACTCCTTTTCTTTGAAAAG 59.132 37.037 19.86 19.86 36.22 2.27
2216 2234 6.222389 GCATCATATACTCATATCCTCTGCC 58.778 44.000 0.00 0.00 0.00 4.85
2401 2419 7.672122 AGTTAAATCTTACTCCCTCCGTAAT 57.328 36.000 0.00 0.00 0.00 1.89
2402 2420 8.087303 AGTTAAATCTTACTCCCTCCGTAATT 57.913 34.615 0.00 0.00 0.00 1.40
2403 2421 9.205513 AGTTAAATCTTACTCCCTCCGTAATTA 57.794 33.333 0.00 0.00 0.00 1.40
2404 2422 9.822185 GTTAAATCTTACTCCCTCCGTAATTAA 57.178 33.333 0.00 0.00 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
261 265 5.127491 AGGGAAAACTACGTCATGTTTTGA 58.873 37.500 22.60 0.00 43.61 2.69
320 324 5.585047 GTGAAAGTCGCACCCTAGAAATATT 59.415 40.000 0.00 0.00 0.00 1.28
469 473 7.275888 ACAGAATGAATTGCAGTCAAACTTA 57.724 32.000 6.29 0.00 43.75 2.24
563 571 1.838112 TAAAGAGGCCACAGCAATGG 58.162 50.000 5.01 1.90 42.56 3.16
845 861 5.136828 AGAGGCGCATGTATATATAGAGCT 58.863 41.667 10.83 0.00 0.00 4.09
1192 1208 2.343758 GAGGTCCAGCTCGTGCAA 59.656 61.111 12.58 0.00 42.74 4.08
1414 1430 3.184379 CAGTAACGGTGTCACTGACAATG 59.816 47.826 18.86 11.12 44.49 2.82
1683 1701 6.358974 ACAAGGCAAGCCAAATAACTAATT 57.641 33.333 14.40 0.00 38.92 1.40
1746 1764 4.378978 CCACGAAAGAACACACAAGACAAA 60.379 41.667 0.00 0.00 0.00 2.83
1753 1771 3.619483 CACTAACCACGAAAGAACACACA 59.381 43.478 0.00 0.00 0.00 3.72
1768 1786 2.234908 AGACAGCATCTGACCACTAACC 59.765 50.000 0.29 0.00 35.81 2.85
1787 1805 3.565307 ACAGGCAACCAAAATCTGAAGA 58.435 40.909 0.00 0.00 37.17 2.87
1855 1873 2.158519 TCCCGGTCTCTCTATGTGCATA 60.159 50.000 0.00 0.00 0.00 3.14
1858 1876 1.333177 ATCCCGGTCTCTCTATGTGC 58.667 55.000 0.00 0.00 0.00 4.57
2107 2125 7.042187 AGCTATCTCGAACAAAGCATAAAGATG 60.042 37.037 10.26 0.00 35.63 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.