Multiple sequence alignment - TraesCS2D01G048200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G048200 chr2D 100.000 2374 0 0 1 2374 17632454 17630081 0.000000e+00 4385.0
1 TraesCS2D01G048200 chr2D 99.243 2379 11 3 1 2374 17606702 17604326 0.000000e+00 4287.0
2 TraesCS2D01G048200 chr2D 99.375 320 2 0 2055 2374 342543887 342543568 4.400000e-162 580.0
3 TraesCS2D01G048200 chr2D 99.062 320 3 0 2055 2374 290464387 290464706 2.050000e-160 575.0
4 TraesCS2D01G048200 chr2D 98.182 330 4 2 2045 2374 426566410 426566083 2.050000e-160 575.0
5 TraesCS2D01G048200 chr2A 98.111 2065 33 5 1 2060 19028921 19026858 0.000000e+00 3592.0
6 TraesCS2D01G048200 chr2B 93.261 1558 73 14 532 2059 29555805 29557360 0.000000e+00 2266.0
7 TraesCS2D01G048200 chr2B 97.400 423 10 1 1 423 29555364 29555785 0.000000e+00 719.0
8 TraesCS2D01G048200 chr2B 80.122 327 23 25 54 372 29319609 29319901 3.090000e-49 206.0
9 TraesCS2D01G048200 chr2B 80.122 327 23 23 54 372 29350728 29351020 3.090000e-49 206.0
10 TraesCS2D01G048200 chr2B 79.817 327 24 25 54 372 29264372 29264664 1.440000e-47 200.0
11 TraesCS2D01G048200 chr7D 99.065 321 3 0 2054 2374 116630126 116629806 5.690000e-161 577.0
12 TraesCS2D01G048200 chr7D 99.062 320 3 0 2055 2374 115485973 115486292 2.050000e-160 575.0
13 TraesCS2D01G048200 chr7D 99.062 320 3 0 2055 2374 540353205 540352886 2.050000e-160 575.0
14 TraesCS2D01G048200 chr6D 99.062 320 3 0 2055 2374 85150270 85150589 2.050000e-160 575.0
15 TraesCS2D01G048200 chr1D 99.062 320 3 0 2055 2374 28594702 28594383 2.050000e-160 575.0
16 TraesCS2D01G048200 chr7B 94.382 89 5 0 1967 2055 740974046 740974134 1.140000e-28 137.0
17 TraesCS2D01G048200 chr5B 95.349 86 4 0 1970 2055 558416261 558416176 1.140000e-28 137.0
18 TraesCS2D01G048200 chrUn 94.318 88 5 0 1968 2055 108826718 108826805 4.120000e-28 135.0
19 TraesCS2D01G048200 chrUn 87.273 55 5 2 1746 1798 349704839 349704893 7.090000e-06 62.1
20 TraesCS2D01G048200 chrUn 87.273 55 5 2 1746 1798 469497315 469497261 7.090000e-06 62.1
21 TraesCS2D01G048200 chr6B 94.382 89 4 1 1967 2055 132122627 132122714 4.120000e-28 135.0
22 TraesCS2D01G048200 chr7A 89.623 106 8 3 1950 2054 708020642 708020745 5.320000e-27 132.0
23 TraesCS2D01G048200 chr4B 89.524 105 8 3 1952 2055 594695156 594695258 1.910000e-26 130.0
24 TraesCS2D01G048200 chr4A 79.012 162 30 4 1635 1792 596481582 596481743 8.970000e-20 108.0
25 TraesCS2D01G048200 chr6A 76.263 198 36 9 1606 1799 559170278 559170088 6.990000e-16 95.3
26 TraesCS2D01G048200 chr3D 82.353 68 8 3 1655 1722 523333331 523333394 3.300000e-04 56.5
27 TraesCS2D01G048200 chr3B 75.940 133 19 10 1655 1785 642216801 642216680 3.300000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G048200 chr2D 17630081 17632454 2373 True 4385.0 4385 100.0000 1 2374 1 chr2D.!!$R2 2373
1 TraesCS2D01G048200 chr2D 17604326 17606702 2376 True 4287.0 4287 99.2430 1 2374 1 chr2D.!!$R1 2373
2 TraesCS2D01G048200 chr2A 19026858 19028921 2063 True 3592.0 3592 98.1110 1 2060 1 chr2A.!!$R1 2059
3 TraesCS2D01G048200 chr2B 29555364 29557360 1996 False 1492.5 2266 95.3305 1 2059 2 chr2B.!!$F4 2058

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
781 784 0.798159 TGCATGTCATCAGCGTTGTC 59.202 50.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1774 1781 6.817765 AAGAAACGGATTTGCTAATTCTCA 57.182 33.333 0.0 0.0 0.0 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
226 227 4.848357 AGACTTGGATGGTATGTTTGGAG 58.152 43.478 0.00 0.00 0.00 3.86
392 393 9.978336 AGAACTACTTTCCAGTACTAGTAGAAT 57.022 33.333 26.55 18.24 41.53 2.40
781 784 0.798159 TGCATGTCATCAGCGTTGTC 59.202 50.000 0.00 0.00 0.00 3.18
1216 1220 1.967319 TGTTTGTCTTCAGAGGTGGC 58.033 50.000 0.00 0.00 0.00 5.01
1774 1781 7.782049 TGGACATTGTTAATTCTCGTCTAGAT 58.218 34.615 0.00 0.00 33.05 1.98
1906 1942 2.543777 TGTCCAACTAGTCAAGCCAC 57.456 50.000 0.00 0.00 0.00 5.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
226 227 9.745880 TTAGTACAGCAATAAGTAGCTTGATAC 57.254 33.333 0.00 0.00 39.5 2.24
781 784 0.443869 GCTTGTATGTGCACGACCAG 59.556 55.000 13.13 14.21 0.0 4.00
1303 1307 4.323477 CGGTGAACCCCTCCGCAA 62.323 66.667 0.00 0.00 43.7 4.85
1774 1781 6.817765 AAGAAACGGATTTGCTAATTCTCA 57.182 33.333 0.00 0.00 0.0 3.27
1906 1942 8.511604 TTCTTGGGCTAAATCTTCTCAATTAG 57.488 34.615 0.00 0.00 0.0 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.