Multiple sequence alignment - TraesCS2D01G047100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G047100 chr2D 100.000 2240 0 0 1 2240 17309691 17311930 0.000000e+00 4137.0
1 TraesCS2D01G047100 chr2D 97.636 973 22 1 1269 2240 17167897 17168869 0.000000e+00 1668.0
2 TraesCS2D01G047100 chr2D 93.347 977 40 10 138 1113 17164941 17165893 0.000000e+00 1421.0
3 TraesCS2D01G047100 chr2D 85.500 200 29 0 270 469 17208053 17208252 2.250000e-50 209.0
4 TraesCS2D01G047100 chr2D 97.143 105 3 0 1167 1271 17165886 17165990 6.360000e-41 178.0
5 TraesCS2D01G047100 chr2D 96.296 81 3 0 1 81 17164722 17164802 1.400000e-27 134.0
6 TraesCS2D01G047100 chr2B 92.850 2084 95 28 46 2093 28906330 28908395 0.000000e+00 2974.0
7 TraesCS2D01G047100 chr2B 90.744 1761 136 15 227 1970 29994192 29992442 0.000000e+00 2324.0
8 TraesCS2D01G047100 chr2B 87.542 1196 122 17 137 1312 29043746 29044934 0.000000e+00 1358.0
9 TraesCS2D01G047100 chr2B 84.937 790 66 32 1473 2238 29045210 29045970 0.000000e+00 750.0
10 TraesCS2D01G047100 chr2B 87.615 218 15 10 1265 1481 29044977 29045183 2.220000e-60 243.0
11 TraesCS2D01G047100 chr2B 83.039 283 27 5 1959 2240 29992482 29992220 1.030000e-58 237.0
12 TraesCS2D01G047100 chr2B 94.667 150 4 1 2091 2240 28920445 28920590 1.730000e-56 230.0
13 TraesCS2D01G047100 chr2B 93.827 81 5 0 1 81 28906252 28906332 3.020000e-24 122.0
14 TraesCS2D01G047100 chr2B 96.774 31 1 0 130 160 717931782 717931812 4.000000e-03 52.8
15 TraesCS2D01G047100 chr2A 95.534 1321 26 4 922 2240 18634282 18635571 0.000000e+00 2082.0
16 TraesCS2D01G047100 chr2A 87.326 718 78 10 137 847 18583677 18584388 0.000000e+00 809.0
17 TraesCS2D01G047100 chr2A 93.849 504 27 2 815 1314 18584403 18584906 0.000000e+00 756.0
18 TraesCS2D01G047100 chr2A 87.827 649 56 15 1596 2240 18585373 18586002 0.000000e+00 739.0
19 TraesCS2D01G047100 chr2A 82.022 267 27 11 1 248 18633958 18634222 8.110000e-50 207.0
20 TraesCS2D01G047100 chr2A 94.828 116 5 1 1367 1481 18585124 18585239 1.770000e-41 180.0
21 TraesCS2D01G047100 chr2A 84.153 183 29 0 270 452 18662263 18662445 6.360000e-41 178.0
22 TraesCS2D01G047100 chr2A 90.244 41 4 0 1930 1970 18585737 18585777 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G047100 chr2D 17309691 17311930 2239 False 4137.000000 4137 100.0000 1 2240 1 chr2D.!!$F2 2239
1 TraesCS2D01G047100 chr2D 17164722 17168869 4147 False 850.250000 1668 96.1055 1 2240 4 chr2D.!!$F3 2239
2 TraesCS2D01G047100 chr2B 28906252 28908395 2143 False 1548.000000 2974 93.3385 1 2093 2 chr2B.!!$F3 2092
3 TraesCS2D01G047100 chr2B 29992220 29994192 1972 True 1280.500000 2324 86.8915 227 2240 2 chr2B.!!$R1 2013
4 TraesCS2D01G047100 chr2B 29043746 29045970 2224 False 783.666667 1358 86.6980 137 2238 3 chr2B.!!$F4 2101
5 TraesCS2D01G047100 chr2A 18633958 18635571 1613 False 1144.500000 2082 88.7780 1 2240 2 chr2A.!!$F3 2239
6 TraesCS2D01G047100 chr2A 18583677 18586002 2325 False 507.740000 809 90.8148 137 2240 5 chr2A.!!$F2 2103

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
295 430 0.530288 TGTCGATCGGCAGTTCATCA 59.470 50.000 20.25 0.0 0.00 3.07 F
318 453 1.383109 TCGATCACCAGGGAGGCAT 60.383 57.895 0.00 0.0 43.14 4.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1233 1444 4.019051 TGCATATATCAGGCTGCTTATGGT 60.019 41.667 21.74 10.02 34.2 3.55 R
2024 4383 4.361451 AGTGCTTTCAGTGAAGTTGTTG 57.639 40.909 5.56 0.00 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
295 430 0.530288 TGTCGATCGGCAGTTCATCA 59.470 50.000 20.25 0.00 0.00 3.07
318 453 1.383109 TCGATCACCAGGGAGGCAT 60.383 57.895 0.00 0.00 43.14 4.40
472 609 7.518161 TCACAACTCATGCTTTAAAGATTACG 58.482 34.615 19.48 6.12 0.00 3.18
528 665 6.100004 TCTTTCTCATAGTCAACTTTAGCCG 58.900 40.000 0.00 0.00 0.00 5.52
537 674 8.665685 CATAGTCAACTTTAGCCGAACTTATTT 58.334 33.333 0.00 0.00 0.00 1.40
542 679 8.313292 TCAACTTTAGCCGAACTTATTTACCTA 58.687 33.333 0.00 0.00 0.00 3.08
825 1025 4.750098 CCCACAATATAGTAAAGAGGCACG 59.250 45.833 0.00 0.00 0.00 5.34
912 1112 7.670559 ACCTATCTCTCTGCCTATAAATAACGT 59.329 37.037 0.00 0.00 0.00 3.99
1233 1444 1.890876 TTGCTAGCGAAGAAGCCAAA 58.109 45.000 10.77 0.00 37.27 3.28
1931 4289 1.407979 CTCCTCAAAGGGCATGCATTC 59.592 52.381 21.36 8.41 35.59 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
318 453 5.619132 TTCTGAATCATAGATGCCTGTCA 57.381 39.130 0.00 0.00 0.00 3.58
472 609 7.573283 GCTGTCAAAGGTTATTTCAGTTAGGTC 60.573 40.741 0.00 0.00 0.00 3.85
486 623 6.064717 AGAAAGAACATAGCTGTCAAAGGTT 58.935 36.000 0.00 0.00 37.85 3.50
528 665 5.763698 GGGAGCATGGTAGGTAAATAAGTTC 59.236 44.000 0.00 0.00 0.00 3.01
537 674 2.528134 GCAGGGAGCATGGTAGGTA 58.472 57.895 0.00 0.00 44.79 3.08
620 760 7.978099 AATTTAGTGGAGAAGGGCATTATTT 57.022 32.000 0.00 0.00 0.00 1.40
825 1025 4.577875 TGATTTCCATTTGACAATTGGCC 58.422 39.130 19.86 0.00 0.00 5.36
912 1112 2.872858 CGAGACACGAGATCTGGTGATA 59.127 50.000 35.59 0.00 45.77 2.15
1233 1444 4.019051 TGCATATATCAGGCTGCTTATGGT 60.019 41.667 21.74 10.02 34.20 3.55
1471 3760 5.480422 TCATCAGCTTGGTAGTACTCAAGAA 59.520 40.000 22.22 10.78 41.94 2.52
1931 4289 5.240623 TGGTGTGGTTTCAGCTTACATAAAG 59.759 40.000 0.00 0.00 38.32 1.85
2024 4383 4.361451 AGTGCTTTCAGTGAAGTTGTTG 57.639 40.909 5.56 0.00 0.00 3.33
2153 4516 7.360113 ACACTAATGACTTGAAACCCATTTT 57.640 32.000 0.00 0.00 32.28 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.