Multiple sequence alignment - TraesCS2B01G269500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G269500 chr2B 100.000 2309 0 0 1 2309 366016864 366014556 0 4265
1 TraesCS2B01G269500 chr2D 97.187 2346 28 8 1 2309 296370310 296372654 0 3932
2 TraesCS2B01G269500 chr2A 96.218 1613 27 13 729 2309 367650682 367652292 0 2610
3 TraesCS2B01G269500 chr2A 96.991 698 21 0 1 698 367649983 367650680 0 1173


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G269500 chr2B 366014556 366016864 2308 True 4265.0 4265 100.0000 1 2309 1 chr2B.!!$R1 2308
1 TraesCS2B01G269500 chr2D 296370310 296372654 2344 False 3932.0 3932 97.1870 1 2309 1 chr2D.!!$F1 2308
2 TraesCS2B01G269500 chr2A 367649983 367652292 2309 False 1891.5 2610 96.6045 1 2309 2 chr2A.!!$F1 2308

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
151 152 1.560505 GCATGAAAATGGGACCTGGT 58.439 50.000 0.0 0.0 0.00 4.00 F
1038 1045 3.214328 GAGAGGAAGAACAAGGCAACAA 58.786 45.455 0.0 0.0 41.41 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1192 1202 4.742649 AGCGCGTCCTCCTCTCCA 62.743 66.667 8.43 0.0 0.0 3.86 R
2164 2205 3.631686 CACAACAGAACAAGGGTCATTCA 59.368 43.478 0.00 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 2.119495 CTACTGGGTTAGGTCATGGCT 58.881 52.381 0.00 0.0 0.00 4.75
76 77 3.371034 TGCTGTGCTAACCACTCCTATA 58.629 45.455 0.00 0.0 44.92 1.31
121 122 9.892130 AACAAAACAGGATTACATAACCAAAAA 57.108 25.926 0.00 0.0 0.00 1.94
151 152 1.560505 GCATGAAAATGGGACCTGGT 58.439 50.000 0.00 0.0 0.00 4.00
727 728 4.016444 AGAGCAGTTTTGAGTGGAAAACA 58.984 39.130 10.56 0.0 44.77 2.83
981 988 5.531634 ACATGCCAAAGAAGTACAACATTG 58.468 37.500 0.00 0.0 0.00 2.82
983 990 5.590530 TGCCAAAGAAGTACAACATTGTT 57.409 34.783 1.98 0.0 42.35 2.83
1038 1045 3.214328 GAGAGGAAGAACAAGGCAACAA 58.786 45.455 0.00 0.0 41.41 2.83
1039 1046 3.631250 AGAGGAAGAACAAGGCAACAAA 58.369 40.909 0.00 0.0 41.41 2.83
1900 1939 7.757624 GCAATTGCAATCATCCAATTTTGAATT 59.242 29.630 25.36 0.0 39.04 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 8.130469 CACAGCAATATAGCATTAAATGTCACA 58.870 33.333 0.00 0.0 36.85 3.58
76 77 3.504134 TGTTTGCTATTGCCATACGTGTT 59.496 39.130 0.00 0.0 38.71 3.32
121 122 6.096846 GTCCCATTTTCATGCCTGTTATAGTT 59.903 38.462 0.00 0.0 0.00 2.24
151 152 5.104982 TGAATCAGTGATGTATGTGGTGCTA 60.105 40.000 6.34 0.0 0.00 3.49
464 465 5.456548 TCGTCTGGTGTATAACTGTGAAA 57.543 39.130 0.00 0.0 0.00 2.69
670 671 6.108687 CACTAGCATGTTGGAAGATGAGTAA 58.891 40.000 0.00 0.0 31.83 2.24
677 678 2.302733 TCAGCACTAGCATGTTGGAAGA 59.697 45.455 0.00 0.0 45.49 2.87
727 728 3.099905 TCAATAGACAGCTAGCCACAGT 58.900 45.455 12.13 5.2 0.00 3.55
815 816 4.440145 CCCTGTGAATTGTGGGGG 57.560 61.111 0.00 0.0 36.15 5.40
1192 1202 4.742649 AGCGCGTCCTCCTCTCCA 62.743 66.667 8.43 0.0 0.00 3.86
1900 1939 7.363181 GCAGGAAGCAATGCATATTTATATCCA 60.363 37.037 8.35 0.0 44.79 3.41
2164 2205 3.631686 CACAACAGAACAAGGGTCATTCA 59.368 43.478 0.00 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.