Multiple sequence alignment - TraesCS2B01G096400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G096400 chr2B 100.000 2928 0 0 1 2928 56716260 56713333 0 5408
1 TraesCS2B01G096400 chr2B 98.807 2934 29 4 1 2928 56686363 56683430 0 5219
2 TraesCS2B01G096400 chr2B 88.841 699 63 10 1 690 349906194 349906886 0 845
3 TraesCS2B01G096400 chr2B 86.733 701 79 10 1 690 765403086 765402389 0 767
4 TraesCS2B01G096400 chr2B 84.926 743 91 16 1 734 510376817 510377547 0 732
5 TraesCS2B01G096400 chr2D 93.008 2274 97 37 690 2928 34263695 34261449 0 3262
6 TraesCS2B01G096400 chrUn 98.846 1646 14 3 1288 2928 334252158 334250513 0 2929
7 TraesCS2B01G096400 chrUn 99.445 901 4 1 387 1286 203985789 203984889 0 1635
8 TraesCS2B01G096400 chr2A 88.738 1181 91 27 690 1846 37200490 37199328 0 1406
9 TraesCS2B01G096400 chr4D 90.935 695 48 8 1 685 337943118 337942429 0 920
10 TraesCS2B01G096400 chr3D 90.558 699 54 6 1 690 52672901 52673596 0 915
11 TraesCS2B01G096400 chr3D 87.037 702 75 10 1 692 496115062 496115757 0 778
12 TraesCS2B01G096400 chr1D 89.986 699 56 9 1 690 281246330 281247023 0 891
13 TraesCS2B01G096400 chr1D 87.120 691 74 10 10 690 268154198 268153513 0 769
14 TraesCS2B01G096400 chr6B 86.629 703 73 16 4 690 12739084 12738387 0 758


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G096400 chr2B 56713333 56716260 2927 True 5408 5408 100.000 1 2928 1 chr2B.!!$R2 2927
1 TraesCS2B01G096400 chr2B 56683430 56686363 2933 True 5219 5219 98.807 1 2928 1 chr2B.!!$R1 2927
2 TraesCS2B01G096400 chr2B 349906194 349906886 692 False 845 845 88.841 1 690 1 chr2B.!!$F1 689
3 TraesCS2B01G096400 chr2B 765402389 765403086 697 True 767 767 86.733 1 690 1 chr2B.!!$R3 689
4 TraesCS2B01G096400 chr2B 510376817 510377547 730 False 732 732 84.926 1 734 1 chr2B.!!$F2 733
5 TraesCS2B01G096400 chr2D 34261449 34263695 2246 True 3262 3262 93.008 690 2928 1 chr2D.!!$R1 2238
6 TraesCS2B01G096400 chrUn 334250513 334252158 1645 True 2929 2929 98.846 1288 2928 1 chrUn.!!$R2 1640
7 TraesCS2B01G096400 chrUn 203984889 203985789 900 True 1635 1635 99.445 387 1286 1 chrUn.!!$R1 899
8 TraesCS2B01G096400 chr2A 37199328 37200490 1162 True 1406 1406 88.738 690 1846 1 chr2A.!!$R1 1156
9 TraesCS2B01G096400 chr4D 337942429 337943118 689 True 920 920 90.935 1 685 1 chr4D.!!$R1 684
10 TraesCS2B01G096400 chr3D 52672901 52673596 695 False 915 915 90.558 1 690 1 chr3D.!!$F1 689
11 TraesCS2B01G096400 chr3D 496115062 496115757 695 False 778 778 87.037 1 692 1 chr3D.!!$F2 691
12 TraesCS2B01G096400 chr1D 281246330 281247023 693 False 891 891 89.986 1 690 1 chr1D.!!$F1 689
13 TraesCS2B01G096400 chr1D 268153513 268154198 685 True 769 769 87.120 10 690 1 chr1D.!!$R1 680
14 TraesCS2B01G096400 chr6B 12738387 12739084 697 True 758 758 86.629 4 690 1 chr6B.!!$R1 686

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
535 558 3.680786 CACTGAGTCCACCGCCGA 61.681 66.667 0.0 0.0 0.0 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2010 2099 1.043816 CTCCACGACTATGCTCCCAT 58.956 55.0 0.0 0.0 35.44 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 169 9.321590 CTTTTAAACCGTAACTCCGATTTTAAG 57.678 33.333 0.00 0.0 32.15 1.85
347 361 9.807921 CACCCACTATAACCATATAGGAAAAAT 57.192 33.333 7.55 0.0 43.56 1.82
535 558 3.680786 CACTGAGTCCACCGCCGA 61.681 66.667 0.00 0.0 0.00 5.54
2010 2099 1.814394 CAATTGCAGCTCCACTTGCTA 59.186 47.619 0.00 0.0 38.92 3.49
2052 2141 1.985116 GAGACCTCCGAACAGGCCT 60.985 63.158 0.00 0.0 40.77 5.19
2106 2195 1.613925 GGGAACTTTTGAGAGGTTGCC 59.386 52.381 0.00 0.0 42.32 4.52
2496 2591 3.544684 TGGGGACATCGATCATCAAAAG 58.455 45.455 0.00 0.0 33.40 2.27
2665 2760 3.494626 CGAGATATGCTAACGTGCCAAAT 59.505 43.478 0.00 0.0 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
361 375 5.121611 CGTTTTCAGAGGTATGCATGTGTAA 59.878 40.000 10.16 0.0 0.00 2.41
535 558 0.336737 ATCCTCCTTCTCACCCTCGT 59.663 55.000 0.00 0.0 0.00 4.18
739 764 6.921332 TGAGTTTTTCTTGTTTTCGTGTTC 57.079 33.333 0.00 0.0 0.00 3.18
2010 2099 1.043816 CTCCACGACTATGCTCCCAT 58.956 55.000 0.00 0.0 35.44 4.00
2411 2502 6.648725 CACAAAATTAAAAACCCGATGTCCAT 59.351 34.615 0.00 0.0 0.00 3.41
2412 2503 5.986135 CACAAAATTAAAAACCCGATGTCCA 59.014 36.000 0.00 0.0 0.00 4.02
2665 2760 1.568504 CTCCAGGTGCTACTAACCCA 58.431 55.000 0.00 0.0 38.57 4.51
2837 2932 8.729529 ATATGTCAACGTATAAGATGAGAACG 57.270 34.615 0.00 0.0 39.37 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.