Multiple sequence alignment - TraesCS2A01G518500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G518500 chr2A 100.000 2668 0 0 1 2668 742132843 742135510 0.000000e+00 4927
1 TraesCS2A01G518500 chr2A 91.209 91 1 6 338 423 726910964 726911052 1.680000e-22 117
2 TraesCS2A01G518500 chr2D 97.609 2677 53 7 1 2668 609434203 609436877 0.000000e+00 4578
3 TraesCS2A01G518500 chr2D 91.209 91 1 6 338 423 272795807 272795895 1.680000e-22 117
4 TraesCS2A01G518500 chr2B 96.991 1296 26 2 1385 2668 743730360 743731654 0.000000e+00 2165
5 TraesCS2A01G518500 chr2B 95.212 1086 22 10 271 1351 743729302 743730362 0.000000e+00 1690
6 TraesCS2A01G518500 chr2B 97.854 233 5 0 1 233 743729072 743729304 1.150000e-108 403
7 TraesCS2A01G518500 chr6A 92.222 90 1 6 338 423 445904256 445904343 3.610000e-24 122
8 TraesCS2A01G518500 chr5D 91.111 90 2 6 338 423 329122020 329122107 1.680000e-22 117
9 TraesCS2A01G518500 chr3B 91.209 91 1 6 338 423 201525096 201525008 1.680000e-22 117
10 TraesCS2A01G518500 chrUn 90.217 92 1 7 338 423 23290066 23290155 2.170000e-21 113
11 TraesCS2A01G518500 chrUn 90.217 92 1 7 338 423 93411545 93411634 2.170000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G518500 chr2A 742132843 742135510 2667 False 4927.000000 4927 100.000000 1 2668 1 chr2A.!!$F2 2667
1 TraesCS2A01G518500 chr2D 609434203 609436877 2674 False 4578.000000 4578 97.609000 1 2668 1 chr2D.!!$F2 2667
2 TraesCS2A01G518500 chr2B 743729072 743731654 2582 False 1419.333333 2165 96.685667 1 2668 3 chr2B.!!$F1 2667

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
525 526 1.985159 ACTGGTGAGAATGCCCACTTA 59.015 47.619 0.0 0.0 33.99 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1710 1719 1.915141 AGCCACCATGTCTTCAAAGG 58.085 50.0 0.0 0.0 0.0 3.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 6.154363 AGTGGAAATGACAGAACAAAAGGAAA 59.846 34.615 0.00 0.00 0.00 3.13
41 42 9.883142 AATGACAGAACAAAAGGAAATGTTAAA 57.117 25.926 0.00 0.00 39.73 1.52
241 242 4.139859 TCGGTTACAAACAGAAACAGGA 57.860 40.909 0.00 0.00 32.68 3.86
310 311 7.924412 AGACAACTAAAGACACGTCTAAATCAA 59.076 33.333 0.00 0.00 39.39 2.57
334 335 2.847327 TGGCTGCTAGGAATAGATGC 57.153 50.000 0.00 0.00 0.00 3.91
525 526 1.985159 ACTGGTGAGAATGCCCACTTA 59.015 47.619 0.00 0.00 33.99 2.24
950 957 8.730093 TTACCATATAAGTAGGACCTTGCATA 57.270 34.615 0.00 0.00 0.00 3.14
1041 1050 3.205282 CCATAGGTTTCATCCTCCCCTTT 59.795 47.826 0.00 0.00 38.86 3.11
1081 1090 1.490910 CCCAATCTACTGGTTCCCCTC 59.509 57.143 0.00 0.00 34.33 4.30
1083 1092 2.482494 CAATCTACTGGTTCCCCTCCT 58.518 52.381 0.00 0.00 0.00 3.69
1138 1147 4.254709 ACGCCTGCAAGCAGACCA 62.255 61.111 22.76 0.00 46.30 4.02
1372 1381 2.159366 GCTAGCTCTGACGTACATGTGT 60.159 50.000 9.11 0.00 0.00 3.72
1373 1382 2.354109 AGCTCTGACGTACATGTGTG 57.646 50.000 9.11 2.88 0.00 3.82
1710 1719 4.396166 GGTGGTATATGACTGCCATATTGC 59.604 45.833 1.76 0.00 43.97 3.56
1832 1854 1.477700 ACCATGCTGCGCAACATATTT 59.522 42.857 24.66 10.06 43.62 1.40
1960 1982 2.955660 GGTTTCACCTGTTCCAACATCA 59.044 45.455 0.00 0.00 38.41 3.07
1977 1999 6.347563 CCAACATCATGCACCAACAATAAAAC 60.348 38.462 0.00 0.00 0.00 2.43
1980 2002 6.015180 ACATCATGCACCAACAATAAAACTCT 60.015 34.615 0.00 0.00 0.00 3.24
2475 2497 3.193267 GTGCAATAAAGCCAGATTGGTCA 59.807 43.478 0.00 0.00 40.46 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 7.037438 CCAAGATGCTATGCAGTTTTTAACAT 58.963 34.615 0.0 0.00 43.65 2.71
41 42 4.080356 TCCTACCAAGATGCTATGCAGTTT 60.080 41.667 0.0 0.00 43.65 2.66
153 154 4.500477 GCACTCCGCATAAATGAAAATGAC 59.500 41.667 0.0 0.00 41.79 3.06
241 242 5.564550 AGGAAACTTCATGCTGATACTTGT 58.435 37.500 0.0 0.00 37.44 3.16
268 269 5.360591 AGTTGTCTTGTGGAGAAAGTGTAG 58.639 41.667 0.0 0.00 35.79 2.74
310 311 5.628666 GCATCTATTCCTAGCAGCCATACAT 60.629 44.000 0.0 0.00 0.00 2.29
525 526 6.757897 TTGTCAGAACTTCTCAAAACATGT 57.242 33.333 0.0 0.00 0.00 3.21
950 957 1.192146 TGCTCAAGTTAGACGGGGCT 61.192 55.000 0.0 0.00 0.00 5.19
1041 1050 0.462581 GCAATGCGATGGTGAGGAGA 60.463 55.000 0.0 0.00 0.00 3.71
1331 1340 2.125106 CTTACCGCTCCCCACAGC 60.125 66.667 0.0 0.00 35.90 4.40
1372 1381 4.261405 CGTTAAAGTTGCCTTTGGTGATCA 60.261 41.667 0.0 0.00 41.03 2.92
1373 1382 4.023536 TCGTTAAAGTTGCCTTTGGTGATC 60.024 41.667 0.0 0.00 41.03 2.92
1710 1719 1.915141 AGCCACCATGTCTTCAAAGG 58.085 50.000 0.0 0.00 0.00 3.11
1832 1854 4.995487 ACTGAGTATGACGACGATAGCATA 59.005 41.667 0.0 1.39 42.67 3.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.