Multiple sequence alignment - TraesCS2A01G315200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G315200 chr2A 100.000 2489 0 0 1 2489 540844929 540842441 0.000000e+00 4597.0
1 TraesCS2A01G315200 chr2A 97.550 2490 53 7 1 2489 480011161 480013643 0.000000e+00 4253.0
2 TraesCS2A01G315200 chr3A 92.301 1104 74 9 600 1695 681540595 681541695 0.000000e+00 1557.0
3 TraesCS2A01G315200 chr3A 86.534 453 57 4 2039 2489 681541951 681542401 1.720000e-136 496.0
4 TraesCS2A01G315200 chr6D 94.823 792 32 8 1699 2489 389944499 389943716 0.000000e+00 1227.0
5 TraesCS2A01G315200 chr6D 87.255 102 7 5 1699 1797 389944349 389944251 7.280000e-21 111.0
6 TraesCS2A01G315200 chr1D 94.318 792 37 7 1699 2489 478878108 478877324 0.000000e+00 1206.0
7 TraesCS2A01G315200 chr1D 86.538 260 19 13 1699 1952 478878261 478878012 3.150000e-69 272.0
8 TraesCS2A01G315200 chr1D 80.795 151 26 2 2231 2381 360283560 360283707 5.630000e-22 115.0
9 TraesCS2A01G315200 chr1D 87.255 102 7 5 1699 1797 478877958 478877860 7.280000e-21 111.0
10 TraesCS2A01G315200 chr1B 89.125 800 68 16 1701 2489 406090274 406089483 0.000000e+00 977.0
11 TraesCS2A01G315200 chr1B 85.899 695 69 19 1796 2489 231603536 231602870 0.000000e+00 713.0
12 TraesCS2A01G315200 chr1B 83.178 107 8 5 1699 1800 406090119 406090018 3.410000e-14 89.8
13 TraesCS2A01G315200 chr4B 84.244 933 125 21 513 1437 621622480 621621562 0.000000e+00 889.0
14 TraesCS2A01G315200 chr4D 84.239 920 129 15 523 1437 27549580 27548672 0.000000e+00 881.0
15 TraesCS2A01G315200 chr4D 88.627 466 50 3 2025 2489 450839747 450839284 4.650000e-157 564.0
16 TraesCS2A01G315200 chr5D 83.996 931 131 16 513 1437 151190691 151191609 0.000000e+00 878.0
17 TraesCS2A01G315200 chr5D 85.493 841 118 3 600 1437 396220184 396221023 0.000000e+00 874.0
18 TraesCS2A01G315200 chr2B 83.763 930 134 16 513 1437 690770336 690769419 0.000000e+00 865.0
19 TraesCS2A01G315200 chr7B 86.177 803 105 6 638 1437 165121752 165120953 0.000000e+00 863.0
20 TraesCS2A01G315200 chr3B 81.159 1104 178 26 333 1428 69451225 69452306 0.000000e+00 859.0
21 TraesCS2A01G315200 chr4A 85.000 460 59 6 1971 2424 16001940 16002395 2.260000e-125 459.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G315200 chr2A 540842441 540844929 2488 True 4597.000000 4597 100.000000 1 2489 1 chr2A.!!$R1 2488
1 TraesCS2A01G315200 chr2A 480011161 480013643 2482 False 4253.000000 4253 97.550000 1 2489 1 chr2A.!!$F1 2488
2 TraesCS2A01G315200 chr3A 681540595 681542401 1806 False 1026.500000 1557 89.417500 600 2489 2 chr3A.!!$F1 1889
3 TraesCS2A01G315200 chr6D 389943716 389944499 783 True 669.000000 1227 91.039000 1699 2489 2 chr6D.!!$R1 790
4 TraesCS2A01G315200 chr1D 478877324 478878261 937 True 529.666667 1206 89.370333 1699 2489 3 chr1D.!!$R1 790
5 TraesCS2A01G315200 chr1B 231602870 231603536 666 True 713.000000 713 85.899000 1796 2489 1 chr1B.!!$R1 693
6 TraesCS2A01G315200 chr1B 406089483 406090274 791 True 533.400000 977 86.151500 1699 2489 2 chr1B.!!$R2 790
7 TraesCS2A01G315200 chr4B 621621562 621622480 918 True 889.000000 889 84.244000 513 1437 1 chr4B.!!$R1 924
8 TraesCS2A01G315200 chr4D 27548672 27549580 908 True 881.000000 881 84.239000 523 1437 1 chr4D.!!$R1 914
9 TraesCS2A01G315200 chr5D 151190691 151191609 918 False 878.000000 878 83.996000 513 1437 1 chr5D.!!$F1 924
10 TraesCS2A01G315200 chr5D 396220184 396221023 839 False 874.000000 874 85.493000 600 1437 1 chr5D.!!$F2 837
11 TraesCS2A01G315200 chr2B 690769419 690770336 917 True 865.000000 865 83.763000 513 1437 1 chr2B.!!$R1 924
12 TraesCS2A01G315200 chr7B 165120953 165121752 799 True 863.000000 863 86.177000 638 1437 1 chr7B.!!$R1 799
13 TraesCS2A01G315200 chr3B 69451225 69452306 1081 False 859.000000 859 81.159000 333 1428 1 chr3B.!!$F1 1095

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
660 666 0.038983 AAATGCGTTTTACGGGTGGC 60.039 50.0 0.0 0.0 42.82 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2130 2326 0.179009 AGCTGCCTTGTTCAAGCTCA 60.179 50.0 7.0 6.37 0.0 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 6.969473 GCTGATCCTTTGCAAAATTAGTAGAC 59.031 38.462 13.84 0.00 0.00 2.59
205 206 3.175152 GAGTCTGAGTTGCGTATCACAG 58.825 50.000 3.29 3.29 0.00 3.66
226 227 4.388773 CAGATGTAACGCACTACACATTGT 59.611 41.667 0.00 0.00 34.68 2.71
509 512 3.737032 TTCGTAGATTGGTGTCACACA 57.263 42.857 10.85 0.00 33.57 3.72
588 591 5.748630 GTGTCATTGTTGTTTCTTTTCTCCC 59.251 40.000 0.00 0.00 0.00 4.30
660 666 0.038983 AAATGCGTTTTACGGGTGGC 60.039 50.000 0.00 0.00 42.82 5.01
766 772 2.437281 CCTAATCCCATGAGCACTCAGT 59.563 50.000 6.50 0.00 43.61 3.41
833 839 3.766591 ACTTTTGATGACACCACCACAAA 59.233 39.130 0.00 0.00 0.00 2.83
958 964 2.158813 ACTCTCGAGGGTGCAAAAGAAA 60.159 45.455 19.38 0.00 0.00 2.52
960 966 3.486383 TCTCGAGGGTGCAAAAGAAAAT 58.514 40.909 13.56 0.00 0.00 1.82
1451 1459 1.492599 TCTGTGTCCACATTCAACCCA 59.507 47.619 0.00 0.00 41.01 4.51
1557 1565 7.178274 TGTTTTTGCCAACTAATCTGGTATCAT 59.822 33.333 0.00 0.00 36.24 2.45
1625 1634 1.242076 CAAGCTTTGTGGTCCTCTGG 58.758 55.000 0.00 0.00 0.00 3.86
1898 1919 2.512692 TGATGCACATAAGTTGCCCT 57.487 45.000 0.00 0.00 0.00 5.19
2153 2349 1.198637 GCTTGAACAAGGCAGCTACTG 59.801 52.381 14.95 0.00 38.80 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 7.817418 TTACTACCACTTTCTCTTTTTGCAT 57.183 32.000 0.00 0.00 0.00 3.96
92 93 9.109393 AGTGTATACATGTTTACTTGCCTAATG 57.891 33.333 21.95 0.00 0.00 1.90
109 110 7.443302 ACCTCTACTACCACTAGTGTATACA 57.557 40.000 21.18 0.08 34.79 2.29
205 206 4.921470 ACAATGTGTAGTGCGTTACATC 57.079 40.909 3.79 0.35 36.08 3.06
482 485 4.748102 TGACACCAATCTACGAAAACACTC 59.252 41.667 0.00 0.00 0.00 3.51
588 591 5.972107 AGTCAATCATCTTTCAAACCTGG 57.028 39.130 0.00 0.00 0.00 4.45
833 839 5.256474 CAATAGTTCCACCTGTTTCTCCAT 58.744 41.667 0.00 0.00 0.00 3.41
933 939 1.112113 TTGCACCCTCGAGAGTATCC 58.888 55.000 15.71 0.00 33.66 2.59
958 964 6.070538 AGTCGGAGAGCATAGGCATTATAATT 60.071 38.462 0.67 0.00 44.61 1.40
960 966 4.772624 AGTCGGAGAGCATAGGCATTATAA 59.227 41.667 0.67 0.00 44.61 0.98
1625 1634 5.389411 GGCAACTCCGTGCAAATTATTTTTC 60.389 40.000 0.00 0.00 46.81 2.29
1766 1782 5.373222 TCGATTTGTTTTCCCAGAGAAAGA 58.627 37.500 0.00 0.00 45.11 2.52
1898 1919 4.109766 CTCGACTATATTTTGCGTGGTGA 58.890 43.478 0.00 0.00 0.00 4.02
1942 2112 3.976169 ACCAACACAAACCAATGAATCG 58.024 40.909 0.00 0.00 0.00 3.34
2130 2326 0.179009 AGCTGCCTTGTTCAAGCTCA 60.179 50.000 7.00 6.37 0.00 4.26
2153 2349 6.719370 ACTGTCTCTATCATATCTCCTTCACC 59.281 42.308 0.00 0.00 0.00 4.02
2445 2641 2.103941 TCCCAAACAACCAATCAAAGCC 59.896 45.455 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.