Multiple sequence alignment - TraesCS1D01G450500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G450500 chr1D 100.000 2624 0 0 1 2624 492809163 492806540 0.000000e+00 4846
1 TraesCS1D01G450500 chr1D 92.571 175 5 3 2438 2612 254452811 254452977 7.250000e-61 244
2 TraesCS1D01G450500 chrUn 99.694 2286 6 1 340 2624 304220960 304223245 0.000000e+00 4181
3 TraesCS1D01G450500 chrUn 99.332 1497 10 0 1128 2624 249172873 249174369 0.000000e+00 2710
4 TraesCS1D01G450500 chrUn 98.931 1497 15 1 1128 2624 11485557 11487052 0.000000e+00 2675
5 TraesCS1D01G450500 chrUn 98.287 467 7 1 1 467 11485091 11485556 0.000000e+00 817
6 TraesCS1D01G450500 chrUn 97.826 368 6 2 100 467 249172507 249172872 3.680000e-178 634
7 TraesCS1D01G450500 chrUn 100.000 67 0 0 1 67 11519408 11519474 9.860000e-25 124
8 TraesCS1D01G450500 chrUn 100.000 67 0 0 1 67 249172430 249172496 9.860000e-25 124
9 TraesCS1D01G450500 chr1A 88.978 871 46 20 922 1752 591299149 591298289 0.000000e+00 1031
10 TraesCS1D01G450500 chr1A 90.801 337 13 5 2145 2475 591297826 591297502 4.010000e-118 435
11 TraesCS1D01G450500 chr1A 92.941 255 10 1 1815 2061 591298077 591297823 5.340000e-97 364
12 TraesCS1D01G450500 chr5D 92.614 176 5 3 2438 2613 503309681 503309848 2.020000e-61 246
13 TraesCS1D01G450500 chr1B 92.614 176 5 3 2438 2613 633712976 633713143 2.020000e-61 246
14 TraesCS1D01G450500 chr1B 89.011 91 6 1 2058 2148 129511240 129511154 2.760000e-20 110
15 TraesCS1D01G450500 chr7A 92.571 175 5 3 2438 2612 537845955 537846121 7.250000e-61 244
16 TraesCS1D01G450500 chr4D 92.135 178 6 3 2438 2615 315434338 315434507 7.250000e-61 244
17 TraesCS1D01G450500 chr4A 92.571 175 5 3 2438 2612 309450391 309450225 7.250000e-61 244
18 TraesCS1D01G450500 chr4A 86.000 100 9 5 2053 2152 500855876 500855782 4.620000e-18 102
19 TraesCS1D01G450500 chr3A 82.812 192 25 5 488 676 660435971 660436157 5.810000e-37 165
20 TraesCS1D01G450500 chr6B 89.362 94 6 1 2057 2150 458503571 458503482 5.930000e-22 115
21 TraesCS1D01G450500 chr5A 88.506 87 4 3 2063 2148 612022789 612022708 1.660000e-17 100
22 TraesCS1D01G450500 chr3B 87.640 89 7 2 2063 2151 797643323 797643239 1.660000e-17 100
23 TraesCS1D01G450500 chr5B 86.813 91 8 1 2059 2149 51965411 51965497 5.980000e-17 99


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G450500 chr1D 492806540 492809163 2623 True 4846 4846 100.000000 1 2624 1 chr1D.!!$R1 2623
1 TraesCS1D01G450500 chrUn 304220960 304223245 2285 False 4181 4181 99.694000 340 2624 1 chrUn.!!$F2 2284
2 TraesCS1D01G450500 chrUn 11485091 11487052 1961 False 1746 2675 98.609000 1 2624 2 chrUn.!!$F3 2623
3 TraesCS1D01G450500 chrUn 249172430 249174369 1939 False 1156 2710 99.052667 1 2624 3 chrUn.!!$F4 2623
4 TraesCS1D01G450500 chr1A 591297502 591299149 1647 True 610 1031 90.906667 922 2475 3 chr1A.!!$R1 1553

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
207 208 0.179936 CACTGGAGGAGGAGGAATGC 59.82 60.0 0.0 0.0 0.0 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1992 2183 9.114952 TGTTATGTGAGTGTAGAACATTTTTCA 57.885 29.63 0.0 0.0 36.08 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 0.469892 CCTCACAGCCCAAAACCCTT 60.470 55.000 0.00 0.00 0.00 3.95
126 127 2.565841 GGGAAGCACTATAGCCACAAG 58.434 52.381 0.00 0.00 34.23 3.16
170 171 0.969894 CTCTCCAAACAGACCGGTCT 59.030 55.000 31.69 31.69 41.37 3.85
207 208 0.179936 CACTGGAGGAGGAGGAATGC 59.820 60.000 0.00 0.00 0.00 3.56
233 234 1.627834 AGGAACAAAGCAGAGGAGGAG 59.372 52.381 0.00 0.00 0.00 3.69
252 253 1.644786 GGACGCACCAAAATCGGGAG 61.645 60.000 0.00 0.00 38.79 4.30
1992 2183 4.929479 TCTACTTTACCATGTGGGCAAAT 58.071 39.130 3.77 0.00 42.05 2.32
2527 2732 6.653526 TTGTCAGTTTGTCCATCATGATTT 57.346 33.333 5.16 0.00 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 0.109532 TTGGGCGGTGATTTCAGTGA 59.890 50.000 0.00 0.0 0.00 3.41
126 127 1.555075 TCAGGTCTGTATGGTGGAAGC 59.445 52.381 0.00 0.0 0.00 3.86
170 171 3.851128 TTGTCCGCACCACCGACA 61.851 61.111 0.00 0.0 0.00 4.35
207 208 0.603707 TCTGCTTTGTTCCTCCGCTG 60.604 55.000 0.00 0.0 0.00 5.18
233 234 1.644786 CTCCCGATTTTGGTGCGTCC 61.645 60.000 0.00 0.0 0.00 4.79
308 309 3.680786 CGTCACCGGAGCTCACCA 61.681 66.667 17.19 0.0 0.00 4.17
1992 2183 9.114952 TGTTATGTGAGTGTAGAACATTTTTCA 57.885 29.630 0.00 0.0 36.08 2.69
2527 2732 2.673775 TGCCAATGTCTCTTCCCAAA 57.326 45.000 0.00 0.0 0.00 3.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.