Multiple sequence alignment - TraesCS1D01G170500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G170500 chr1D 100.000 2120 0 0 1 2120 244408638 244406519 0.000000e+00 3916.0
1 TraesCS1D01G170500 chr1D 98.680 2121 25 3 1 2120 244402187 244400069 0.000000e+00 3759.0
2 TraesCS1D01G170500 chr1D 97.171 1909 49 4 215 2120 244423961 244422055 0.000000e+00 3221.0
3 TraesCS1D01G170500 chr1D 95.813 1887 66 7 246 2120 254489477 254487592 0.000000e+00 3035.0
4 TraesCS1D01G170500 chr2D 96.552 1885 54 7 244 2120 628285447 628283566 0.000000e+00 3110.0
5 TraesCS1D01G170500 chr2D 97.727 220 2 3 1 219 454348660 454348443 1.990000e-100 375.0
6 TraesCS1D01G170500 chr6D 95.822 1891 60 9 244 2120 431399808 431397923 0.000000e+00 3037.0
7 TraesCS1D01G170500 chr6D 97.285 221 4 2 1 219 265530429 265530209 7.140000e-100 374.0
8 TraesCS1D01G170500 chr6D 100.000 33 0 0 215 247 135672687 135672719 6.320000e-06 62.1
9 TraesCS1D01G170500 chr3D 95.599 1886 69 9 244 2118 21897337 21895455 0.000000e+00 3011.0
10 TraesCS1D01G170500 chr3D 98.157 217 3 1 1 216 577883861 577883645 5.520000e-101 377.0
11 TraesCS1D01G170500 chr3D 100.000 31 0 0 215 245 296380011 296379981 8.170000e-05 58.4
12 TraesCS1D01G170500 chr3B 95.153 1898 69 10 244 2120 201506357 201504462 0.000000e+00 2974.0
13 TraesCS1D01G170500 chr2A 95.008 1883 84 7 244 2120 335826057 335824179 0.000000e+00 2948.0
14 TraesCS1D01G170500 chr5A 94.480 1884 82 7 244 2120 684325366 684323498 0.000000e+00 2883.0
15 TraesCS1D01G170500 chr1A 95.925 1644 58 6 244 1882 256026389 256028028 0.000000e+00 2656.0
16 TraesCS1D01G170500 chr7B 98.190 221 3 1 1 220 526388428 526388648 3.300000e-103 385.0
17 TraesCS1D01G170500 chr4B 97.309 223 4 2 1 221 647700310 647700532 5.520000e-101 377.0
18 TraesCS1D01G170500 chr4D 97.297 222 5 1 1 221 30362621 30362842 1.990000e-100 375.0
19 TraesCS1D01G170500 chr6B 97.285 221 5 1 1 220 26901301 26901081 7.140000e-100 374.0
20 TraesCS1D01G170500 chr6B 100.000 33 0 0 215 247 558520078 558520110 6.320000e-06 62.1
21 TraesCS1D01G170500 chr7D 94.850 233 11 1 1 233 634501858 634501627 1.550000e-96 363.0
22 TraesCS1D01G170500 chr7A 100.000 34 0 0 215 248 190688279 190688312 1.760000e-06 63.9
23 TraesCS1D01G170500 chr3A 100.000 30 0 0 216 245 296254735 296254764 2.940000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G170500 chr1D 244406519 244408638 2119 True 3916 3916 100.000 1 2120 1 chr1D.!!$R2 2119
1 TraesCS1D01G170500 chr1D 244400069 244402187 2118 True 3759 3759 98.680 1 2120 1 chr1D.!!$R1 2119
2 TraesCS1D01G170500 chr1D 244422055 244423961 1906 True 3221 3221 97.171 215 2120 1 chr1D.!!$R3 1905
3 TraesCS1D01G170500 chr1D 254487592 254489477 1885 True 3035 3035 95.813 246 2120 1 chr1D.!!$R4 1874
4 TraesCS1D01G170500 chr2D 628283566 628285447 1881 True 3110 3110 96.552 244 2120 1 chr2D.!!$R2 1876
5 TraesCS1D01G170500 chr6D 431397923 431399808 1885 True 3037 3037 95.822 244 2120 1 chr6D.!!$R2 1876
6 TraesCS1D01G170500 chr3D 21895455 21897337 1882 True 3011 3011 95.599 244 2118 1 chr3D.!!$R1 1874
7 TraesCS1D01G170500 chr3B 201504462 201506357 1895 True 2974 2974 95.153 244 2120 1 chr3B.!!$R1 1876
8 TraesCS1D01G170500 chr2A 335824179 335826057 1878 True 2948 2948 95.008 244 2120 1 chr2A.!!$R1 1876
9 TraesCS1D01G170500 chr5A 684323498 684325366 1868 True 2883 2883 94.480 244 2120 1 chr5A.!!$R1 1876
10 TraesCS1D01G170500 chr1A 256026389 256028028 1639 False 2656 2656 95.925 244 1882 1 chr1A.!!$F1 1638

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
39 40 2.878406 ACAGTTTGACCAGATTTGACCG 59.122 45.455 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1337 1361 2.743664 TCAATTGGTCATGCAAGAGACG 59.256 45.455 5.42 0.0 35.63 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 3.631686 TGACCACAGTTTGACCAGATTTG 59.368 43.478 0.0 0.0 0.00 2.32
39 40 2.878406 ACAGTTTGACCAGATTTGACCG 59.122 45.455 0.0 0.0 0.00 4.79
270 271 9.588096 AAGAAAGTTAGACCTAATCCAACAAAT 57.412 29.630 0.0 0.0 0.00 2.32
1332 1356 7.310634 ACCATCCTTATAACTACCCATGACTA 58.689 38.462 0.0 0.0 0.00 2.59
1500 1524 5.634118 TCATATTCTGGATTGGGTTCATCC 58.366 41.667 0.0 0.0 35.12 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 2.752354 TGGTCAAACTGTGGTCAAACTG 59.248 45.455 0.00 0.00 0.00 3.16
139 140 4.709250 GGGGCTTTTAAGATCTAGAGTGG 58.291 47.826 0.00 0.00 0.00 4.00
533 554 6.591750 TTTGCCTGGTTCCGAAAAATAATA 57.408 33.333 0.00 0.00 0.00 0.98
539 560 1.137282 GGTTTTGCCTGGTTCCGAAAA 59.863 47.619 0.00 0.00 0.00 2.29
1332 1356 3.411446 TGGTCATGCAAGAGACGAAAAT 58.589 40.909 10.08 0.00 35.63 1.82
1337 1361 2.743664 TCAATTGGTCATGCAAGAGACG 59.256 45.455 5.42 0.00 35.63 4.18
1433 1457 5.951747 ACTAAACCAATCACAGCAATACCAT 59.048 36.000 0.00 0.00 0.00 3.55
1500 1524 6.310764 TCTAGTCCCTCCGATTACTATAGG 57.689 45.833 4.43 0.00 0.00 2.57
1781 1811 7.941919 AGTAAACTCTTCCATTGAAGGTTTTC 58.058 34.615 20.69 17.58 46.61 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.