Multiple sequence alignment - TraesCS1D01G130000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G130000 chr1D 100.000 2775 0 0 1 2775 143333638 143336412 0.000000e+00 5125.0
1 TraesCS1D01G130000 chr1D 81.408 952 119 34 592 1519 385546651 385547568 0.000000e+00 725.0
2 TraesCS1D01G130000 chr1D 86.438 553 65 8 48 593 385545950 385546499 5.120000e-167 597.0
3 TraesCS1D01G130000 chr1D 86.134 238 31 2 1569 1805 385547579 385547815 3.550000e-64 255.0
4 TraesCS1D01G130000 chr1D 92.857 42 2 1 1851 1892 385547901 385547941 2.980000e-05 60.2
5 TraesCS1D01G130000 chr3D 97.807 2782 43 13 1 2774 121717843 121720614 0.000000e+00 4783.0
6 TraesCS1D01G130000 chr7D 95.708 862 28 9 1916 2774 521915033 521914178 0.000000e+00 1378.0
7 TraesCS1D01G130000 chr7D 96.885 642 14 4 1210 1851 521915910 521915275 0.000000e+00 1070.0
8 TraesCS1D01G130000 chr7D 97.866 328 7 0 362 689 521916276 521915949 4.010000e-158 568.0
9 TraesCS1D01G130000 chr7D 98.387 248 3 1 46 293 521916740 521916494 4.240000e-118 435.0
10 TraesCS1D01G130000 chr4B 87.435 955 86 22 872 1805 625306387 625305446 0.000000e+00 1068.0
11 TraesCS1D01G130000 chr4B 85.730 932 89 24 1857 2774 625305358 625304457 0.000000e+00 944.0
12 TraesCS1D01G130000 chr4B 89.273 550 53 6 47 593 625307325 625306779 0.000000e+00 684.0
13 TraesCS1D01G130000 chr4B 88.608 237 21 5 592 827 625306615 625306384 1.630000e-72 283.0
14 TraesCS1D01G130000 chr5D 90.991 555 41 4 46 593 499755180 499755732 0.000000e+00 739.0
15 TraesCS1D01G130000 chr1A 84.109 258 33 7 1548 1805 485236061 485236310 2.760000e-60 243.0
16 TraesCS1D01G130000 chr1A 86.813 182 19 5 1339 1519 485235887 485236064 6.060000e-47 198.0
17 TraesCS1D01G130000 chr7B 74.524 420 88 15 606 1021 733216837 733216433 6.150000e-37 165.0
18 TraesCS1D01G130000 chr7B 74.186 430 90 16 597 1021 712608915 712609328 2.860000e-35 159.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G130000 chr1D 143333638 143336412 2774 False 5125.00 5125 100.00000 1 2775 1 chr1D.!!$F1 2774
1 TraesCS1D01G130000 chr1D 385545950 385547941 1991 False 409.30 725 86.70925 48 1892 4 chr1D.!!$F2 1844
2 TraesCS1D01G130000 chr3D 121717843 121720614 2771 False 4783.00 4783 97.80700 1 2774 1 chr3D.!!$F1 2773
3 TraesCS1D01G130000 chr7D 521914178 521916740 2562 True 862.75 1378 97.21150 46 2774 4 chr7D.!!$R1 2728
4 TraesCS1D01G130000 chr4B 625304457 625307325 2868 True 744.75 1068 87.76150 47 2774 4 chr4B.!!$R1 2727
5 TraesCS1D01G130000 chr5D 499755180 499755732 552 False 739.00 739 90.99100 46 593 1 chr5D.!!$F1 547

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
635 954 3.515502 CAGTCTATCCCTTGGACAACTCA 59.484 47.826 0.0 0.0 32.98 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2598 3182 7.553881 AGAAAGTGAATCGAAAAGAAGACAA 57.446 32.0 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
635 954 3.515502 CAGTCTATCCCTTGGACAACTCA 59.484 47.826 0.00 0.00 32.98 3.41
756 1075 6.114089 AGCACTACTTCTTCACTACTATCGA 58.886 40.000 0.00 0.00 0.00 3.59
943 1272 6.903534 TGGACTACTGAAGAAGGAAGGATATT 59.096 38.462 0.00 0.00 0.00 1.28
1017 1346 6.100004 CCTCTACATGAAAGTGAACGTGTAT 58.900 40.000 0.00 0.00 37.69 2.29
1122 1459 3.557228 TCCCAAATTTTGCAGCTGTTT 57.443 38.095 16.64 4.42 0.00 2.83
1819 2198 9.801873 CAAATTTATTCCCGTTTCTTCACATAT 57.198 29.630 0.00 0.00 0.00 1.78
1919 2495 7.016563 AGGGGCAAAAAGAATGAAGAACTAAAT 59.983 33.333 0.00 0.00 0.00 1.40
2015 2593 5.756918 TGGGAAAATCAACGGATATACCAA 58.243 37.500 0.00 0.00 33.01 3.67
2127 2706 7.360361 TGCTTTTCTTATTCGAACCTTCTTTC 58.640 34.615 0.00 0.00 0.00 2.62
2598 3182 0.246635 CGCACTGCCTAGGTGTTACT 59.753 55.000 11.31 0.00 37.07 2.24
2773 3363 9.924650 TGGTTAGTTACTAGTTTGATCTTCTTC 57.075 33.333 0.00 0.00 0.00 2.87
2774 3364 9.924650 GGTTAGTTACTAGTTTGATCTTCTTCA 57.075 33.333 0.00 0.00 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 4.799564 AAAAAGAGCACCACAAACAGAA 57.200 36.364 0.00 0.0 0.00 3.02
635 954 2.095768 CGTTGGTGTCGAATGAATTGCT 60.096 45.455 0.00 0.0 0.00 3.91
756 1075 9.787435 TTAGTTGACCTGAAATTGTACTTACAT 57.213 29.630 0.00 0.0 35.89 2.29
943 1272 8.540507 ACTTATAAGTGCTCTCCTTCTCATTA 57.459 34.615 17.35 0.0 37.98 1.90
1017 1346 5.419155 TCGGGTTAATATCAATTTTGCACCA 59.581 36.000 0.00 0.0 0.00 4.17
1122 1459 4.391830 GCTCGTGATGTACTGATGGAAAAA 59.608 41.667 0.00 0.0 0.00 1.94
1208 1547 1.066430 GTGAAAGGGTGACTCGCCATA 60.066 52.381 10.85 0.0 35.42 2.74
1283 1622 8.413229 CCAAAATCAAGAGAAAGGACAACTAAA 58.587 33.333 0.00 0.0 0.00 1.85
2598 3182 7.553881 AGAAAGTGAATCGAAAAGAAGACAA 57.446 32.000 0.00 0.0 0.00 3.18
2673 3257 1.959226 GCGTCAACGAAGGAAGGCA 60.959 57.895 6.75 0.0 43.02 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.