Multiple sequence alignment - TraesCS1D01G070700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G070700 chr1D 100.000 2174 0 0 1 2174 51831966 51834139 0 4015
1 TraesCS1D01G070700 chr1D 96.785 2177 41 7 1 2174 254459402 254457252 0 3605
2 TraesCS1D01G070700 chr3A 97.622 2187 35 9 1 2174 105556963 105559145 0 3735
3 TraesCS1D01G070700 chr5D 97.617 2182 39 8 1 2173 503339434 503337257 0 3729
4 TraesCS1D01G070700 chr5D 97.341 2181 46 7 1 2174 503313496 503311321 0 3696
5 TraesCS1D01G070700 chr5D 97.299 2184 34 6 1 2174 6253282 6255450 0 3683
6 TraesCS1D01G070700 chr1B 97.522 2179 44 6 1 2174 633716965 633714792 0 3716
7 TraesCS1D01G070700 chr3B 97.878 2121 32 8 1 2112 101924870 101922754 0 3655
8 TraesCS1D01G070700 chr7B 97.447 2037 42 6 1 2032 662755041 662757072 0 3465
9 TraesCS1D01G070700 chr1A 97.419 2015 39 7 169 2174 554482083 554480073 0 3421


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G070700 chr1D 51831966 51834139 2173 False 4015 4015 100.000 1 2174 1 chr1D.!!$F1 2173
1 TraesCS1D01G070700 chr1D 254457252 254459402 2150 True 3605 3605 96.785 1 2174 1 chr1D.!!$R1 2173
2 TraesCS1D01G070700 chr3A 105556963 105559145 2182 False 3735 3735 97.622 1 2174 1 chr3A.!!$F1 2173
3 TraesCS1D01G070700 chr5D 503337257 503339434 2177 True 3729 3729 97.617 1 2173 1 chr5D.!!$R2 2172
4 TraesCS1D01G070700 chr5D 503311321 503313496 2175 True 3696 3696 97.341 1 2174 1 chr5D.!!$R1 2173
5 TraesCS1D01G070700 chr5D 6253282 6255450 2168 False 3683 3683 97.299 1 2174 1 chr5D.!!$F1 2173
6 TraesCS1D01G070700 chr1B 633714792 633716965 2173 True 3716 3716 97.522 1 2174 1 chr1B.!!$R1 2173
7 TraesCS1D01G070700 chr3B 101922754 101924870 2116 True 3655 3655 97.878 1 2112 1 chr3B.!!$R1 2111
8 TraesCS1D01G070700 chr7B 662755041 662757072 2031 False 3465 3465 97.447 1 2032 1 chr7B.!!$F1 2031
9 TraesCS1D01G070700 chr1A 554480073 554482083 2010 True 3421 3421 97.419 169 2174 1 chr1A.!!$R1 2005

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
129 135 3.734902 GCAAATAAAAGCGCTAGTGCCAT 60.735 43.478 24.25 11.37 35.36 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2124 2187 1.675714 GCCAGACATTGTGATCGTCCA 60.676 52.381 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 135 3.734902 GCAAATAAAAGCGCTAGTGCCAT 60.735 43.478 24.25 11.37 35.36 4.40
351 357 4.536090 TGGATTCATGGTGAGTAGTTCCTT 59.464 41.667 0.00 0.00 0.00 3.36
495 502 7.156000 TGTGAATTGTCCGAACTACATAGAAA 58.844 34.615 0.00 0.00 0.00 2.52
941 965 5.367937 CCTCCATGGATTCACCTATATAGGG 59.632 48.000 28.62 18.70 42.52 3.53
1062 1086 7.226720 ACAAGAACAACAACGACTAATTCATCT 59.773 33.333 0.00 0.00 0.00 2.90
1219 1243 3.963665 GCATAAAAATATGCCGCTGACA 58.036 40.909 9.17 0.00 45.16 3.58
1229 1253 1.275010 TGCCGCTGACATGAGTAAAGA 59.725 47.619 0.00 0.00 0.00 2.52
1237 1261 6.509199 CGCTGACATGAGTAAAGATAAAGCAG 60.509 42.308 0.00 0.00 0.00 4.24
1261 1287 6.720288 AGCAGTAGTATTTATATCTCGTGGGT 59.280 38.462 0.00 0.00 0.00 4.51
1544 1570 3.118482 AGTGATGAGTACTTGGGCATGAG 60.118 47.826 0.00 0.00 0.00 2.90
1631 1657 5.402630 ACCCCTTGAGTGTTTTAATGGAAT 58.597 37.500 0.00 0.00 0.00 3.01
1672 1698 9.787532 ATATTGTCCTGTGATAAAAATTGAACG 57.212 29.630 0.00 0.00 0.00 3.95
1722 1748 4.758674 CCATCTCTTTCTCAACTCAGCAAA 59.241 41.667 0.00 0.00 0.00 3.68
2124 2187 9.434420 GAGCTATATACTCTTTTTGCTGATCAT 57.566 33.333 0.00 0.00 0.00 2.45
2151 2214 3.421919 TCACAATGTCTGGCAATCTCA 57.578 42.857 0.00 0.00 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
297 303 2.679837 GCTGCTTCTGTTATTGCTGCTA 59.320 45.455 0.00 0.0 43.59 3.49
495 502 8.748179 ATCCGATATATGGATATGGAATTCCT 57.252 34.615 24.73 12.9 44.38 3.36
941 965 6.644592 TCTTATTTTTGCAACATTAGCCACAC 59.355 34.615 0.00 0.0 0.00 3.82
944 968 5.868801 GCTCTTATTTTTGCAACATTAGCCA 59.131 36.000 0.00 0.0 0.00 4.75
1062 1086 4.513692 CGACTTTTCGGGAATATATTGGCA 59.486 41.667 1.78 0.0 41.89 4.92
1219 1243 7.560368 ACTACTGCTGCTTTATCTTTACTCAT 58.440 34.615 0.00 0.0 0.00 2.90
1237 1261 6.807230 CACCCACGAGATATAAATACTACTGC 59.193 42.308 0.00 0.0 0.00 4.40
1261 1287 3.518766 CCATGGGGAATTAGCAGCA 57.481 52.632 2.85 0.0 35.59 4.41
1544 1570 3.576550 TGGCAAATAGGAGGTTTCCAAAC 59.423 43.478 0.00 0.0 46.64 2.93
2124 2187 1.675714 GCCAGACATTGTGATCGTCCA 60.676 52.381 0.00 0.0 0.00 4.02
2151 2214 4.697514 CTCGGCGGGATCAAATATATGAT 58.302 43.478 0.00 0.0 42.62 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.