Multiple sequence alignment - TraesCS1D01G055400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G055400 chr1D 100.000 2364 0 0 1 2364 36615166 36617529 0.000000e+00 4366.0
1 TraesCS1D01G055400 chr1D 89.715 2032 206 3 332 2362 36621909 36623938 0.000000e+00 2591.0
2 TraesCS1D01G055400 chr1D 95.363 1596 74 0 767 2362 37432446 37430851 0.000000e+00 2538.0
3 TraesCS1D01G055400 chr1A 95.004 2362 114 3 3 2362 36171791 36174150 0.000000e+00 3705.0
4 TraesCS1D01G055400 chr1A 95.322 2159 86 4 208 2362 36185505 36187652 0.000000e+00 3413.0
5 TraesCS1D01G055400 chr1A 89.708 1778 174 9 332 2105 36607541 36605769 0.000000e+00 2261.0
6 TraesCS1D01G055400 chr1A 88.068 1827 209 9 538 2362 36615674 36613855 0.000000e+00 2158.0
7 TraesCS1D01G055400 chr1A 93.023 43 1 2 328 369 36607613 36607572 7.050000e-06 62.1
8 TraesCS1D01G055400 chr1B 92.464 2362 172 4 3 2362 56490591 56492948 0.000000e+00 3371.0
9 TraesCS1D01G055400 chr1B 91.039 2377 169 21 1 2362 56617510 56619857 0.000000e+00 3169.0
10 TraesCS1D01G055400 chr1B 89.200 2037 193 15 333 2362 56499113 56501129 0.000000e+00 2518.0
11 TraesCS1D01G055400 chr1B 89.091 55 4 1 171 225 57018431 57018379 1.520000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G055400 chr1D 36615166 36617529 2363 False 4366.00 4366 100.0000 1 2364 1 chr1D.!!$F1 2363
1 TraesCS1D01G055400 chr1D 36621909 36623938 2029 False 2591.00 2591 89.7150 332 2362 1 chr1D.!!$F2 2030
2 TraesCS1D01G055400 chr1D 37430851 37432446 1595 True 2538.00 2538 95.3630 767 2362 1 chr1D.!!$R1 1595
3 TraesCS1D01G055400 chr1A 36171791 36174150 2359 False 3705.00 3705 95.0040 3 2362 1 chr1A.!!$F1 2359
4 TraesCS1D01G055400 chr1A 36185505 36187652 2147 False 3413.00 3413 95.3220 208 2362 1 chr1A.!!$F2 2154
5 TraesCS1D01G055400 chr1A 36613855 36615674 1819 True 2158.00 2158 88.0680 538 2362 1 chr1A.!!$R1 1824
6 TraesCS1D01G055400 chr1A 36605769 36607613 1844 True 1161.55 2261 91.3655 328 2105 2 chr1A.!!$R2 1777
7 TraesCS1D01G055400 chr1B 56490591 56492948 2357 False 3371.00 3371 92.4640 3 2362 1 chr1B.!!$F1 2359
8 TraesCS1D01G055400 chr1B 56617510 56619857 2347 False 3169.00 3169 91.0390 1 2362 1 chr1B.!!$F3 2361
9 TraesCS1D01G055400 chr1B 56499113 56501129 2016 False 2518.00 2518 89.2000 333 2362 1 chr1B.!!$F2 2029

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
478 490 1.0029 ACACACCGCAAAATGAACTCG 60.003 47.619 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2128 2153 3.406764 GATATTCCACATCTGGGCAGTC 58.593 50.0 0.0 0.0 38.25 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 59 1.965643 CCCCATTTGCCCTGACATATG 59.034 52.381 0.00 0.00 0.00 1.78
66 68 5.628797 TGCCCTGACATATGAAACAGATA 57.371 39.130 21.15 10.56 32.90 1.98
186 188 6.625532 AAATCCCAAGATTGCATACCTTTT 57.374 33.333 0.00 0.00 42.03 2.27
218 221 5.368989 CCATCAGAAGTCATTACCCCTAAC 58.631 45.833 0.00 0.00 0.00 2.34
331 337 6.238869 CCTTTAAATCAAAGAGGCTCCTATGC 60.239 42.308 11.71 0.00 45.62 3.14
478 490 1.002900 ACACACCGCAAAATGAACTCG 60.003 47.619 0.00 0.00 0.00 4.18
531 543 1.131638 AGTTGTTCTGGCAGGACAGA 58.868 50.000 26.56 15.85 45.22 3.41
535 547 2.507484 TGTTCTGGCAGGACAGATTTG 58.493 47.619 24.65 0.00 46.07 2.32
717 739 5.350091 GGTAGTTGAAGCTTCAAGTGAGATC 59.650 44.000 40.82 26.88 46.97 2.75
947 969 1.179152 CCATTGGCTGACATTGCAGA 58.821 50.000 10.89 0.00 38.14 4.26
963 985 4.519540 TGCAGAAAACAAATCCTTAGCC 57.480 40.909 0.00 0.00 0.00 3.93
982 1004 2.226674 GCCTCTTCCTTTCTTTGAACCG 59.773 50.000 0.00 0.00 0.00 4.44
1080 1102 1.008875 TGATCGCTTCGTCTGCACAC 61.009 55.000 0.00 0.00 0.00 3.82
1101 1123 6.371825 CACACTTATTTCTACAAAGACCTCCC 59.628 42.308 0.00 0.00 0.00 4.30
1358 1380 4.780815 TCAGACTCAACACCAACTGATTT 58.219 39.130 0.00 0.00 31.02 2.17
2128 2153 2.421424 AGCAATTTAGCAGCCTCTTTCG 59.579 45.455 0.00 0.00 36.85 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 59 6.481313 TGATGCTATGTTGAGCTATCTGTTTC 59.519 38.462 0.0 0.0 43.27 2.78
66 68 2.681848 GTTGCTGATGCTATGTTGAGCT 59.318 45.455 0.0 0.0 43.27 4.09
168 170 5.404466 TTGGAAAAGGTATGCAATCTTGG 57.596 39.130 0.0 0.0 0.00 3.61
177 179 4.097741 TGATGGCGATTTGGAAAAGGTATG 59.902 41.667 0.0 0.0 0.00 2.39
186 188 2.027285 TGACTTCTGATGGCGATTTGGA 60.027 45.455 0.0 0.0 0.00 3.53
331 337 3.012518 ACTTCTGATGGCGATTGGAAAG 58.987 45.455 0.0 0.0 0.00 2.62
478 490 5.974108 TCCAAACTGCCTACTTGTATAGTC 58.026 41.667 0.0 0.0 38.33 2.59
528 540 7.009815 CAGTTATGTTATTGCTTGCCAAATCTG 59.990 37.037 0.0 0.0 36.92 2.90
531 543 6.591062 CACAGTTATGTTATTGCTTGCCAAAT 59.409 34.615 0.0 0.0 37.65 2.32
535 547 3.859386 GCACAGTTATGTTATTGCTTGCC 59.141 43.478 0.0 0.0 37.65 4.52
717 739 5.165961 TGTCTAAAGTTGATGGGAAGAGG 57.834 43.478 0.0 0.0 0.00 3.69
806 828 3.200825 CAGTGGTATCATTCCCAGTTCCT 59.799 47.826 0.0 0.0 31.95 3.36
939 961 5.349543 GGCTAAGGATTTGTTTTCTGCAATG 59.650 40.000 0.0 0.0 0.00 2.82
947 969 5.645201 AGGAAGAGGCTAAGGATTTGTTTT 58.355 37.500 0.0 0.0 0.00 2.43
963 985 3.877508 ACACGGTTCAAAGAAAGGAAGAG 59.122 43.478 0.0 0.0 0.00 2.85
982 1004 9.184062 CAATACCATGATTAATGCAATGTACAC 57.816 33.333 0.0 0.0 34.67 2.90
1023 1045 7.609760 ATTACGAGCAATGAATGTGAAGTTA 57.390 32.000 0.0 0.0 0.00 2.24
1080 1102 6.712276 ACTGGGAGGTCTTTGTAGAAATAAG 58.288 40.000 0.0 0.0 30.65 1.73
1358 1380 8.058667 AGCATTCAAAATACTTGATGTCATGA 57.941 30.769 0.0 0.0 0.00 3.07
2128 2153 3.406764 GATATTCCACATCTGGGCAGTC 58.593 50.000 0.0 0.0 38.25 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.