Multiple sequence alignment - TraesCS1B01G074800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G074800 chr1B 100.000 2195 0 0 1 2195 58048015 58050209 0.000000e+00 4054
1 TraesCS1B01G074800 chr1B 99.226 2197 14 3 1 2195 58086949 58089144 0.000000e+00 3960
2 TraesCS1B01G074800 chr1B 99.436 1772 9 1 1 1771 58113594 58115365 0.000000e+00 3216
3 TraesCS1B01G074800 chr1B 87.375 998 124 2 775 1771 58326423 58327419 0.000000e+00 1144
4 TraesCS1B01G074800 chr1B 86.473 998 129 6 777 1771 57789388 57790382 0.000000e+00 1090
5 TraesCS1B01G074800 chr1B 82.991 341 55 2 426 763 58326101 58326441 2.740000e-79 305
6 TraesCS1B01G074800 chr1A 90.281 998 91 6 781 1775 37510079 37511073 0.000000e+00 1301
7 TraesCS1B01G074800 chr1A 87.600 1000 118 6 775 1771 37503080 37504076 0.000000e+00 1155
8 TraesCS1B01G074800 chr1A 90.762 433 22 2 333 763 37509675 37510091 1.470000e-156 562
9 TraesCS1B01G074800 chr1A 80.680 559 96 9 210 762 37502545 37503097 7.240000e-115 424
10 TraesCS1B01G074800 chr1A 77.500 480 77 22 295 763 36172123 36172582 2.160000e-65 259
11 TraesCS1B01G074800 chr1D 88.200 1000 112 6 775 1771 38365773 38366769 0.000000e+00 1188
12 TraesCS1B01G074800 chr1D 87.475 998 123 2 775 1771 38558047 38559043 0.000000e+00 1149
13 TraesCS1B01G074800 chr1D 86.874 998 126 5 777 1771 38257431 38258426 0.000000e+00 1112
14 TraesCS1B01G074800 chr1D 81.250 560 93 9 210 763 38557512 38558065 2.000000e-120 442
15 TraesCS1B01G074800 chr1D 91.346 312 25 2 1 311 38587582 38587892 2.010000e-115 425
16 TraesCS1B01G074800 chr1D 77.801 473 81 18 300 763 36615502 36615959 9.990000e-69 270
17 TraesCS1B01G074800 chr1D 84.980 253 37 1 510 762 38365539 38365790 2.800000e-64 255
18 TraesCS1B01G074800 chr1D 87.387 222 24 3 544 763 36622152 36622371 3.620000e-63 252
19 TraesCS1B01G074800 chr1D 81.000 300 49 6 467 760 38581478 38581775 4.710000e-57 231
20 TraesCS1B01G074800 chr1D 85.354 198 27 2 567 763 37448422 37448226 1.030000e-48 204
21 TraesCS1B01G074800 chr7B 96.759 432 12 2 1764 2194 533473780 533474210 0.000000e+00 719
22 TraesCS1B01G074800 chr4B 96.759 432 12 2 1764 2194 574470780 574470350 0.000000e+00 719
23 TraesCS1B01G074800 chr4B 96.296 432 13 3 1764 2194 96695999 96695570 0.000000e+00 706
24 TraesCS1B01G074800 chr2B 96.528 432 13 2 1764 2194 663004211 663004641 0.000000e+00 713
25 TraesCS1B01G074800 chr2B 95.672 439 16 3 1758 2194 648764780 648764343 0.000000e+00 702
26 TraesCS1B01G074800 chr6B 96.503 429 13 2 1767 2194 532875972 532875545 0.000000e+00 708
27 TraesCS1B01G074800 chr6B 96.305 433 12 4 1764 2194 599557599 599557169 0.000000e+00 708
28 TraesCS1B01G074800 chr3B 95.672 439 16 3 1758 2194 596160213 596159776 0.000000e+00 702


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G074800 chr1B 58048015 58050209 2194 False 4054.0 4054 100.0000 1 2195 1 chr1B.!!$F2 2194
1 TraesCS1B01G074800 chr1B 58086949 58089144 2195 False 3960.0 3960 99.2260 1 2195 1 chr1B.!!$F3 2194
2 TraesCS1B01G074800 chr1B 58113594 58115365 1771 False 3216.0 3216 99.4360 1 1771 1 chr1B.!!$F4 1770
3 TraesCS1B01G074800 chr1B 57789388 57790382 994 False 1090.0 1090 86.4730 777 1771 1 chr1B.!!$F1 994
4 TraesCS1B01G074800 chr1B 58326101 58327419 1318 False 724.5 1144 85.1830 426 1771 2 chr1B.!!$F5 1345
5 TraesCS1B01G074800 chr1A 37509675 37511073 1398 False 931.5 1301 90.5215 333 1775 2 chr1A.!!$F3 1442
6 TraesCS1B01G074800 chr1A 37502545 37504076 1531 False 789.5 1155 84.1400 210 1771 2 chr1A.!!$F2 1561
7 TraesCS1B01G074800 chr1D 38257431 38258426 995 False 1112.0 1112 86.8740 777 1771 1 chr1D.!!$F3 994
8 TraesCS1B01G074800 chr1D 38557512 38559043 1531 False 795.5 1149 84.3625 210 1771 2 chr1D.!!$F7 1561
9 TraesCS1B01G074800 chr1D 38365539 38366769 1230 False 721.5 1188 86.5900 510 1771 2 chr1D.!!$F6 1261

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
45 46 4.705507 GTGTGTATCTGAAGTGGAGAGGTA 59.294 45.833 0.0 0.0 0.0 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2034 2042 2.23066 GTGGGTGGTGAAGAAAAGGAG 58.769 52.381 0.0 0.0 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 4.705507 GTGTGTATCTGAAGTGGAGAGGTA 59.294 45.833 0.00 0.00 0.00 3.08
448 450 5.219633 ACCGCAAAATGTACTCAATGAAAC 58.780 37.500 0.00 0.00 0.00 2.78
1625 1632 5.480642 AATCACCATGCATACAAAAACCA 57.519 34.783 0.00 0.00 0.00 3.67
1791 1798 1.135721 GTTGGCTTTGGGCTGATCATC 59.864 52.381 0.00 0.00 41.46 2.92
1941 1949 5.823209 AGTTCATTTCATCATGATTCGCA 57.177 34.783 5.16 0.00 33.07 5.10
1984 1992 0.700564 TCAGGCCTCCAGCAAATTCT 59.299 50.000 0.00 0.00 46.50 2.40
2014 2022 1.821061 AAGGCACGTCTGGAGACCTG 61.821 60.000 1.15 1.87 41.86 4.00
2034 2042 4.314121 CTGACCCTGCATAAGAGATTAGC 58.686 47.826 0.00 0.00 0.00 3.09
2058 2066 2.286365 TTTCTTCACCACCCACATCC 57.714 50.000 0.00 0.00 0.00 3.51
2059 2067 1.144691 TTCTTCACCACCCACATCCA 58.855 50.000 0.00 0.00 0.00 3.41
2094 2102 0.718343 GTTCATCACTCTGCGAGCAC 59.282 55.000 5.63 0.00 32.04 4.40
2154 2162 3.502051 TCACATAAGAGGGGTTAGGGT 57.498 47.619 0.00 0.00 0.00 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 2.030274 GCGTTGGTTCACCTTGCTTTAT 60.030 45.455 0.00 0.0 36.82 1.40
448 450 5.333111 GCTTGTAAAAAGTAGACACCTCGTG 60.333 44.000 0.00 0.0 39.75 4.35
632 637 3.637229 TGTTGTCTCTCTTTTCGAGGAGT 59.363 43.478 10.42 0.0 40.30 3.85
1625 1632 8.109634 ACAACTGTTTATCACTCCCTAATTCAT 58.890 33.333 0.00 0.0 0.00 2.57
1791 1798 3.693085 AGTTGCACTAATTCATCTGCAGG 59.307 43.478 15.13 0.0 40.59 4.85
1984 1992 4.002906 AGACGTGCCTTAAATGTCTGAA 57.997 40.909 0.00 0.0 41.32 3.02
2014 2022 4.562552 GGAGCTAATCTCTTATGCAGGGTC 60.563 50.000 0.00 0.0 41.60 4.46
2034 2042 2.230660 GTGGGTGGTGAAGAAAAGGAG 58.769 52.381 0.00 0.0 0.00 3.69
2058 2066 1.341209 GAACTCTTTGCCACCCCTTTG 59.659 52.381 0.00 0.0 0.00 2.77
2059 2067 1.063266 TGAACTCTTTGCCACCCCTTT 60.063 47.619 0.00 0.0 0.00 3.11
2094 2102 4.209538 TCAATGCCACCTTTCTCATATGG 58.790 43.478 2.13 0.0 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.