Multiple sequence alignment - TraesCS1B01G069700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G069700 chr1B 100.000 2755 0 0 1 2755 55006288 55009042 0.000000e+00 5088.0
1 TraesCS1B01G069700 chr1B 99.131 2763 16 3 1 2755 54963003 54965765 0.000000e+00 4963.0
2 TraesCS1B01G069700 chr1D 82.343 1229 100 47 636 1846 35786232 35787361 0.000000e+00 959.0
3 TraesCS1B01G069700 chr1D 91.538 650 39 8 1197 1841 35870505 35871143 0.000000e+00 881.0
4 TraesCS1B01G069700 chr1D 84.551 602 64 18 1197 1789 35917218 35917799 1.110000e-158 569.0
5 TraesCS1B01G069700 chr1D 84.114 598 74 17 1197 1789 35815642 35816223 2.400000e-155 558.0
6 TraesCS1B01G069700 chr1D 82.406 665 70 20 514 1157 35869768 35870406 1.120000e-148 536.0
7 TraesCS1B01G069700 chr1D 84.375 448 34 17 739 1161 35907673 35908109 9.190000e-110 407.0
8 TraesCS1B01G069700 chr1D 82.965 452 41 21 739 1170 35815125 35815560 2.590000e-100 375.0
9 TraesCS1B01G069700 chr1D 82.094 363 44 13 54 411 35754451 35754797 9.650000e-75 291.0
10 TraesCS1B01G069700 chr1D 89.474 152 13 2 2457 2605 202281914 202282065 3.620000e-44 189.0
11 TraesCS1B01G069700 chr1D 86.982 169 18 3 2440 2605 206038449 206038616 1.300000e-43 187.0
12 TraesCS1B01G069700 chr1A 85.952 840 71 26 998 1824 34534325 34535130 0.000000e+00 854.0
13 TraesCS1B01G069700 chr1A 80.832 1106 122 57 744 1789 34877715 34878790 0.000000e+00 785.0
14 TraesCS1B01G069700 chr1A 85.465 688 46 26 1197 1842 34857522 34858197 0.000000e+00 667.0
15 TraesCS1B01G069700 chr1A 86.795 621 37 21 1197 1780 34705222 34705834 0.000000e+00 651.0
16 TraesCS1B01G069700 chr1A 89.683 252 21 1 906 1157 34704876 34705122 1.590000e-82 316.0
17 TraesCS1B01G069700 chr1A 79.915 468 53 18 514 964 34851183 34851626 3.450000e-79 305.0
18 TraesCS1B01G069700 chr1A 88.384 198 18 1 960 1157 34857224 34857416 1.650000e-57 233.0
19 TraesCS1B01G069700 chr1A 78.182 385 33 14 512 876 34533888 34534241 6.020000e-47 198.0
20 TraesCS1B01G069700 chr1A 88.793 116 12 1 54 168 34520513 34520628 1.030000e-29 141.0
21 TraesCS1B01G069700 chr1A 88.095 84 10 0 58 141 34721738 34721821 1.750000e-17 100.0
22 TraesCS1B01G069700 chr4A 94.134 358 11 5 818 1173 521612720 521613069 1.120000e-148 536.0
23 TraesCS1B01G069700 chr4A 93.855 358 12 5 818 1173 536859297 536859646 5.220000e-147 531.0
24 TraesCS1B01G069700 chr7B 91.711 374 22 4 1848 2212 651336219 651335846 6.810000e-141 510.0
25 TraesCS1B01G069700 chr2B 91.247 377 22 4 1846 2211 775740771 775741147 1.140000e-138 503.0
26 TraesCS1B01G069700 chrUn 90.710 366 29 3 1849 2209 141696955 141697320 1.480000e-132 483.0
27 TraesCS1B01G069700 chrUn 89.891 366 31 6 1849 2209 362764780 362765144 1.490000e-127 466.0
28 TraesCS1B01G069700 chr7D 90.160 376 28 4 1846 2212 564139819 564140194 5.340000e-132 481.0
29 TraesCS1B01G069700 chr7D 90.000 150 12 2 2458 2605 107248344 107248196 1.010000e-44 191.0
30 TraesCS1B01G069700 chr7D 87.742 155 17 2 2597 2749 111350310 111350464 2.180000e-41 180.0
31 TraesCS1B01G069700 chr6D 89.267 382 30 5 1846 2217 431057951 431057571 4.150000e-128 468.0
32 TraesCS1B01G069700 chr6D 89.796 147 15 0 2602 2748 336516133 336515987 3.620000e-44 189.0
33 TraesCS1B01G069700 chr2D 89.488 371 30 4 1849 2210 618645081 618645451 6.950000e-126 460.0
34 TraesCS1B01G069700 chr5B 89.008 373 31 4 1846 2210 684896929 684897299 1.160000e-123 453.0
35 TraesCS1B01G069700 chr3D 87.895 380 27 4 1849 2209 560785 560406 1.960000e-116 429.0
36 TraesCS1B01G069700 chr3D 87.895 380 27 4 1849 2209 576999 576620 1.960000e-116 429.0
37 TraesCS1B01G069700 chr3D 87.895 380 27 4 1849 2209 119412682 119412303 1.960000e-116 429.0
38 TraesCS1B01G069700 chr3D 91.333 150 11 1 2458 2605 407812393 407812542 1.290000e-48 204.0
39 TraesCS1B01G069700 chr3D 90.000 150 13 1 2458 2605 278512431 278512580 2.800000e-45 193.0
40 TraesCS1B01G069700 chr3D 89.189 148 14 2 2602 2748 405828016 405827870 1.690000e-42 183.0
41 TraesCS1B01G069700 chr3D 88.312 154 16 2 2597 2748 565256092 565256245 1.690000e-42 183.0
42 TraesCS1B01G069700 chr3D 89.189 148 15 1 2602 2748 602717057 602716910 1.690000e-42 183.0
43 TraesCS1B01G069700 chr5D 90.000 150 13 1 2458 2605 10762017 10761868 2.800000e-45 193.0
44 TraesCS1B01G069700 chr5D 89.032 155 14 2 2453 2605 377147852 377148005 3.620000e-44 189.0
45 TraesCS1B01G069700 chr3A 89.172 157 13 3 2451 2605 464244139 464243985 2.800000e-45 193.0
46 TraesCS1B01G069700 chr3A 87.755 147 18 0 2602 2748 464243942 464243796 3.650000e-39 172.0
47 TraesCS1B01G069700 chr3A 89.583 48 5 0 408 455 27015580 27015627 8.240000e-06 62.1
48 TraesCS1B01G069700 chr5A 87.838 148 17 1 2602 2748 32052870 32053017 3.650000e-39 172.0
49 TraesCS1B01G069700 chr5A 90.000 50 3 2 411 459 495899226 495899178 2.290000e-06 63.9
50 TraesCS1B01G069700 chr7A 87.586 145 16 2 2597 2739 111289999 111290143 1.700000e-37 167.0
51 TraesCS1B01G069700 chr6B 86.538 52 5 1 408 459 374977777 374977826 3.830000e-04 56.5
52 TraesCS1B01G069700 chr6A 96.875 32 1 0 428 459 317147342 317147311 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G069700 chr1B 55006288 55009042 2754 False 5088.0 5088 100.0000 1 2755 1 chr1B.!!$F2 2754
1 TraesCS1B01G069700 chr1B 54963003 54965765 2762 False 4963.0 4963 99.1310 1 2755 1 chr1B.!!$F1 2754
2 TraesCS1B01G069700 chr1D 35786232 35787361 1129 False 959.0 959 82.3430 636 1846 1 chr1D.!!$F2 1210
3 TraesCS1B01G069700 chr1D 35869768 35871143 1375 False 708.5 881 86.9720 514 1841 2 chr1D.!!$F8 1327
4 TraesCS1B01G069700 chr1D 35917218 35917799 581 False 569.0 569 84.5510 1197 1789 1 chr1D.!!$F4 592
5 TraesCS1B01G069700 chr1D 35815125 35816223 1098 False 466.5 558 83.5395 739 1789 2 chr1D.!!$F7 1050
6 TraesCS1B01G069700 chr1A 34877715 34878790 1075 False 785.0 785 80.8320 744 1789 1 chr1A.!!$F4 1045
7 TraesCS1B01G069700 chr1A 34533888 34535130 1242 False 526.0 854 82.0670 512 1824 2 chr1A.!!$F5 1312
8 TraesCS1B01G069700 chr1A 34704876 34705834 958 False 483.5 651 88.2390 906 1780 2 chr1A.!!$F6 874
9 TraesCS1B01G069700 chr1A 34857224 34858197 973 False 450.0 667 86.9245 960 1842 2 chr1A.!!$F7 882

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
887 926 2.860628 CGTCTCTATGTTGGCGCGC 61.861 63.158 25.94 25.94 0.0 6.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2661 2921 1.355043 TGGTATGTACCCCAAACCCAC 59.645 52.381 6.74 0.0 45.87 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 3.443681 AGTGCAACACAGGGCAATTATAC 59.556 43.478 0.00 0.00 42.45 1.47
422 423 4.393062 CCACATGCGTCTAAGACTTGAATT 59.607 41.667 0.00 0.00 0.00 2.17
887 926 2.860628 CGTCTCTATGTTGGCGCGC 61.861 63.158 25.94 25.94 0.00 6.86
1800 2050 2.416893 GGCGACTTCAGTTCATCCTTTC 59.583 50.000 0.00 0.00 0.00 2.62
1804 2054 5.470368 CGACTTCAGTTCATCCTTTCTACA 58.530 41.667 0.00 0.00 0.00 2.74
1932 2185 4.436242 TCGATAAATCCTCATACCGAGC 57.564 45.455 0.00 0.00 40.78 5.03
2192 2451 5.199982 TCCTGGGTAAAATTGCCTCATTA 57.800 39.130 0.00 0.00 33.03 1.90
2500 2760 1.147824 CCGGCCTCTGCATCTGAAT 59.852 57.895 0.00 0.00 40.13 2.57
2661 2921 2.092212 AGACCCCAATCAAGCCACATAG 60.092 50.000 0.00 0.00 0.00 2.23
2711 2971 0.792640 CTCTCATGTGTCGTTGCCAC 59.207 55.000 0.00 0.00 0.00 5.01
2726 2986 0.734889 GCCACCATCTTCCACGAATG 59.265 55.000 0.00 0.00 0.00 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 0.105039 GCTACCTCATGGTCCCTTCG 59.895 60.000 0.00 0.00 44.78 3.79
482 483 7.125811 AGGCATGGTACCGATATATTTAGTGAT 59.874 37.037 7.57 0.00 0.00 3.06
887 926 2.228103 GCCTTTTTAACCGGAAGACAGG 59.772 50.000 9.46 7.24 37.39 4.00
2500 2760 8.734218 AATTAATAAAATGGTTGCATGCATCA 57.266 26.923 23.37 22.09 0.00 3.07
2661 2921 1.355043 TGGTATGTACCCCAAACCCAC 59.645 52.381 6.74 0.00 45.87 4.61
2726 2986 2.355717 AGTTACTGCTCTGAAGACGC 57.644 50.000 0.00 0.00 0.00 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.