Multiple sequence alignment - TraesCS1A01G412600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G412600 chr1A 100.000 2437 0 0 1 2437 572884515 572882079 0.000000e+00 4501
1 TraesCS1A01G412600 chr1A 88.851 296 27 5 220 512 519472788 519472496 2.300000e-95 359
2 TraesCS1A01G412600 chr7A 97.406 2197 25 7 242 2437 634975848 634978013 0.000000e+00 3712
3 TraesCS1A01G412600 chr7A 98.030 203 4 0 1 203 634975645 634975847 1.070000e-93 353
4 TraesCS1A01G412600 chr2B 92.025 2207 124 13 234 2437 632520603 632518446 0.000000e+00 3053
5 TraesCS1A01G412600 chr2B 79.682 1068 121 42 727 1718 381234079 381235126 0.000000e+00 682
6 TraesCS1A01G412600 chr2B 88.158 228 14 5 6 220 632520909 632520682 2.400000e-65 259
7 TraesCS1A01G412600 chr7D 95.388 889 24 3 1 876 70225602 70226486 0.000000e+00 1399
8 TraesCS1A01G412600 chr7D 94.071 624 20 1 1814 2437 70226532 70227138 0.000000e+00 931
9 TraesCS1A01G412600 chr7D 87.970 266 28 4 2175 2437 590187384 590187120 6.540000e-81 311
10 TraesCS1A01G412600 chr2D 79.018 1039 115 53 737 1718 313462818 313463810 1.240000e-172 616
11 TraesCS1A01G412600 chr2D 84.906 159 19 2 1893 2046 313464089 313464247 3.240000e-34 156
12 TraesCS1A01G412600 chr5B 83.142 611 74 12 1 584 679964075 679964683 4.610000e-147 531
13 TraesCS1A01G412600 chr2A 81.607 647 71 23 1118 1738 423754826 423754202 2.180000e-135 492
14 TraesCS1A01G412600 chr2A 78.624 407 55 13 735 1124 423755239 423754848 8.710000e-60 241
15 TraesCS1A01G412600 chr2A 84.277 159 20 2 1893 2046 423753953 423753795 1.510000e-32 150
16 TraesCS1A01G412600 chr5A 87.432 366 43 3 220 584 544448416 544448053 3.750000e-113 418
17 TraesCS1A01G412600 chr5A 81.714 350 26 11 2053 2402 544446696 544446385 8.650000e-65 257
18 TraesCS1A01G412600 chr4D 83.879 397 49 13 2046 2437 367800305 367799919 4.950000e-97 364
19 TraesCS1A01G412600 chr4D 79.323 266 36 7 2172 2432 400238351 400238602 4.170000e-38 169
20 TraesCS1A01G412600 chr4A 88.851 296 27 5 220 512 714208806 714208514 2.300000e-95 359
21 TraesCS1A01G412600 chr3D 88.851 296 26 6 220 512 55113203 55112912 8.290000e-95 357
22 TraesCS1A01G412600 chr3D 83.333 150 11 8 2300 2435 175253312 175253461 2.540000e-25 126
23 TraesCS1A01G412600 chr3A 85.632 348 41 4 220 561 290419276 290418932 8.290000e-95 357
24 TraesCS1A01G412600 chr3A 82.235 349 23 12 2054 2402 290417596 290417287 5.170000e-67 265
25 TraesCS1A01G412600 chr6B 87.640 178 18 3 2263 2436 45265709 45265886 1.140000e-48 204
26 TraesCS1A01G412600 chr4B 87.931 174 20 1 2263 2436 663766826 663766998 1.140000e-48 204
27 TraesCS1A01G412600 chr4B 97.778 90 2 0 2348 2437 445247791 445247702 3.240000e-34 156
28 TraesCS1A01G412600 chr7B 81.579 266 29 8 2175 2435 583165396 583165146 4.110000e-48 202


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G412600 chr1A 572882079 572884515 2436 True 4501.000000 4501 100.000000 1 2437 1 chr1A.!!$R2 2436
1 TraesCS1A01G412600 chr7A 634975645 634978013 2368 False 2032.500000 3712 97.718000 1 2437 2 chr7A.!!$F1 2436
2 TraesCS1A01G412600 chr2B 632518446 632520909 2463 True 1656.000000 3053 90.091500 6 2437 2 chr2B.!!$R1 2431
3 TraesCS1A01G412600 chr2B 381234079 381235126 1047 False 682.000000 682 79.682000 727 1718 1 chr2B.!!$F1 991
4 TraesCS1A01G412600 chr7D 70225602 70227138 1536 False 1165.000000 1399 94.729500 1 2437 2 chr7D.!!$F1 2436
5 TraesCS1A01G412600 chr2D 313462818 313464247 1429 False 386.000000 616 81.962000 737 2046 2 chr2D.!!$F1 1309
6 TraesCS1A01G412600 chr5B 679964075 679964683 608 False 531.000000 531 83.142000 1 584 1 chr5B.!!$F1 583
7 TraesCS1A01G412600 chr2A 423753795 423755239 1444 True 294.333333 492 81.502667 735 2046 3 chr2A.!!$R1 1311
8 TraesCS1A01G412600 chr5A 544446385 544448416 2031 True 337.500000 418 84.573000 220 2402 2 chr5A.!!$R1 2182
9 TraesCS1A01G412600 chr3A 290417287 290419276 1989 True 311.000000 357 83.933500 220 2402 2 chr3A.!!$R1 2182

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
501 582 2.171003 AGCCCCTGCAAAAGTCAATAC 58.829 47.619 0.0 0.0 41.13 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1696 2713 1.168714 GTGTCACCTTGAGGATTGCC 58.831 55.0 3.59 0.0 38.94 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
78 80 3.771577 AAAGTGACTTACCTGGTGAGG 57.228 47.619 21.08 8.43 46.21 3.86
501 582 2.171003 AGCCCCTGCAAAAGTCAATAC 58.829 47.619 0.00 0.00 41.13 1.89
1233 2070 2.262423 AGCCTTCTTCGCAGAAAGTT 57.738 45.000 0.00 0.00 45.90 2.66
1655 2671 2.563427 GGCGCACTGAAGAAAGCC 59.437 61.111 10.83 0.00 37.61 4.35
1696 2713 6.922957 GCTCAGTTACTCTATTCAATGAGAGG 59.077 42.308 3.21 0.00 43.00 3.69
2156 3338 4.462132 TGATGCTTTGCAAAGTAGGCATTA 59.538 37.500 33.47 25.43 43.62 1.90
2157 3339 4.862902 TGCTTTGCAAAGTAGGCATTAA 57.137 36.364 33.47 7.72 41.58 1.40
2158 3340 4.808558 TGCTTTGCAAAGTAGGCATTAAG 58.191 39.130 33.47 10.94 41.58 1.85
2159 3341 4.522405 TGCTTTGCAAAGTAGGCATTAAGA 59.478 37.500 33.47 6.75 41.58 2.10
2160 3342 5.010516 TGCTTTGCAAAGTAGGCATTAAGAA 59.989 36.000 33.47 2.10 41.58 2.52
2161 3343 6.101997 GCTTTGCAAAGTAGGCATTAAGAAT 58.898 36.000 33.47 0.00 41.58 2.40
2162 3344 7.093988 TGCTTTGCAAAGTAGGCATTAAGAATA 60.094 33.333 33.47 4.84 41.58 1.75
2163 3345 7.433425 GCTTTGCAAAGTAGGCATTAAGAATAG 59.567 37.037 33.47 9.04 41.58 1.73
2164 3346 8.574251 TTTGCAAAGTAGGCATTAAGAATAGA 57.426 30.769 8.05 0.00 41.58 1.98
2165 3347 7.792374 TGCAAAGTAGGCATTAAGAATAGAG 57.208 36.000 0.00 0.00 36.11 2.43
2166 3348 6.767902 TGCAAAGTAGGCATTAAGAATAGAGG 59.232 38.462 0.00 0.00 36.11 3.69
2167 3349 6.293680 GCAAAGTAGGCATTAAGAATAGAGGC 60.294 42.308 0.00 0.00 0.00 4.70
2168 3350 5.491323 AGTAGGCATTAAGAATAGAGGCC 57.509 43.478 0.00 0.00 40.18 5.19
2170 3352 4.632327 AGGCATTAAGAATAGAGGCCTC 57.368 45.455 26.22 26.22 46.70 4.70
2171 3353 4.238669 AGGCATTAAGAATAGAGGCCTCT 58.761 43.478 36.62 36.62 46.70 3.69
2172 3354 4.662650 AGGCATTAAGAATAGAGGCCTCTT 59.337 41.667 39.23 23.77 46.70 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
78 80 6.855836 TCTTAATCAATGCCAAACACATCTC 58.144 36.000 0.00 0.00 0.00 2.75
232 313 6.054295 GGAGTGACATTGATTAAGATCTGCT 58.946 40.000 0.00 0.00 33.28 4.24
1233 2070 3.806949 ACTGGCTTTGGGTGATTAGAA 57.193 42.857 0.00 0.00 0.00 2.10
1328 2171 6.378564 TGGAAGACACCATAGAAACAAAACAA 59.621 34.615 0.00 0.00 34.77 2.83
1329 2172 5.888724 TGGAAGACACCATAGAAACAAAACA 59.111 36.000 0.00 0.00 34.77 2.83
1647 2663 2.716969 AGTTAGGACCCAAGGCTTTCTT 59.283 45.455 0.00 0.00 35.79 2.52
1655 2671 1.902508 TGAGCAGAGTTAGGACCCAAG 59.097 52.381 0.00 0.00 0.00 3.61
1696 2713 1.168714 GTGTCACCTTGAGGATTGCC 58.831 55.000 3.59 0.00 38.94 4.52
2156 3338 9.386122 TCATATTCTTAAGAGGCCTCTATTCTT 57.614 33.333 35.31 21.51 39.39 2.52
2157 3339 8.964533 TCATATTCTTAAGAGGCCTCTATTCT 57.035 34.615 35.31 21.90 39.39 2.40
2160 3342 9.386122 TCTTTCATATTCTTAAGAGGCCTCTAT 57.614 33.333 35.31 25.17 39.39 1.98
2161 3343 8.783660 TCTTTCATATTCTTAAGAGGCCTCTA 57.216 34.615 35.31 20.05 39.39 2.43
2162 3344 7.566879 TCTCTTTCATATTCTTAAGAGGCCTCT 59.433 37.037 30.40 30.40 42.33 3.69
2163 3345 7.731054 TCTCTTTCATATTCTTAAGAGGCCTC 58.269 38.462 26.22 26.22 42.33 4.70
2164 3346 7.682787 TCTCTTTCATATTCTTAAGAGGCCT 57.317 36.000 3.86 3.86 42.33 5.19
2165 3347 7.990314 AGTTCTCTTTCATATTCTTAAGAGGCC 59.010 37.037 5.12 0.00 42.33 5.19
2166 3348 8.956533 AGTTCTCTTTCATATTCTTAAGAGGC 57.043 34.615 5.12 0.00 42.33 4.70
2169 3351 9.725019 TGCAAGTTCTCTTTCATATTCTTAAGA 57.275 29.630 0.00 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.