Multiple sequence alignment - TraesCS1A01G400400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G400400 chr1A 100.000 2195 0 0 1 2195 564321347 564319153 0.000000e+00 4054
1 TraesCS1A01G400400 chr7A 96.752 1755 52 4 1 1755 367840107 367841856 0.000000e+00 2920
2 TraesCS1A01G400400 chr7A 95.749 447 18 1 1749 2195 367856373 367856818 0.000000e+00 719
3 TraesCS1A01G400400 chr7A 83.571 280 37 7 1916 2192 108804646 108804373 1.010000e-63 254
4 TraesCS1A01G400400 chr5D 88.400 2250 186 30 1 2195 551983753 551985982 0.000000e+00 2639
5 TraesCS1A01G400400 chr5D 83.580 676 87 10 759 1424 473002157 473001496 1.440000e-171 612
6 TraesCS1A01G400400 chrUn 97.280 1434 36 2 763 2195 376497651 376496220 0.000000e+00 2429
7 TraesCS1A01G400400 chrUn 97.141 1434 38 2 763 2195 376510426 376508995 0.000000e+00 2418
8 TraesCS1A01G400400 chrUn 97.232 867 24 0 763 1629 456468599 456467733 0.000000e+00 1469
9 TraesCS1A01G400400 chrUn 97.911 766 15 1 1 765 63569792 63569027 0.000000e+00 1325
10 TraesCS1A01G400400 chrUn 97.471 514 12 1 1683 2195 469134408 469134921 0.000000e+00 876
11 TraesCS1A01G400400 chr4A 87.944 1294 138 9 912 2195 616429378 616428093 0.000000e+00 1509
12 TraesCS1A01G400400 chr4A 86.128 966 69 22 1 918 616445352 616444404 0.000000e+00 981
13 TraesCS1A01G400400 chr5A 83.784 666 88 7 769 1424 592637530 592636875 4.010000e-172 614
14 TraesCS1A01G400400 chr5B 82.388 670 92 11 769 1424 580365385 580364728 5.290000e-156 560
15 TraesCS1A01G400400 chr7D 82.816 419 42 7 1799 2192 104553477 104553064 4.490000e-92 348
16 TraesCS1A01G400400 chr7B 82.297 418 46 7 1799 2191 62683647 62683233 9.710000e-89 337


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G400400 chr1A 564319153 564321347 2194 True 4054 4054 100.000 1 2195 1 chr1A.!!$R1 2194
1 TraesCS1A01G400400 chr7A 367840107 367841856 1749 False 2920 2920 96.752 1 1755 1 chr7A.!!$F1 1754
2 TraesCS1A01G400400 chr5D 551983753 551985982 2229 False 2639 2639 88.400 1 2195 1 chr5D.!!$F1 2194
3 TraesCS1A01G400400 chr5D 473001496 473002157 661 True 612 612 83.580 759 1424 1 chr5D.!!$R1 665
4 TraesCS1A01G400400 chrUn 376496220 376497651 1431 True 2429 2429 97.280 763 2195 1 chrUn.!!$R2 1432
5 TraesCS1A01G400400 chrUn 376508995 376510426 1431 True 2418 2418 97.141 763 2195 1 chrUn.!!$R3 1432
6 TraesCS1A01G400400 chrUn 456467733 456468599 866 True 1469 1469 97.232 763 1629 1 chrUn.!!$R4 866
7 TraesCS1A01G400400 chrUn 63569027 63569792 765 True 1325 1325 97.911 1 765 1 chrUn.!!$R1 764
8 TraesCS1A01G400400 chrUn 469134408 469134921 513 False 876 876 97.471 1683 2195 1 chrUn.!!$F1 512
9 TraesCS1A01G400400 chr4A 616428093 616429378 1285 True 1509 1509 87.944 912 2195 1 chr4A.!!$R1 1283
10 TraesCS1A01G400400 chr4A 616444404 616445352 948 True 981 981 86.128 1 918 1 chr4A.!!$R2 917
11 TraesCS1A01G400400 chr5A 592636875 592637530 655 True 614 614 83.784 769 1424 1 chr5A.!!$R1 655
12 TraesCS1A01G400400 chr5B 580364728 580365385 657 True 560 560 82.388 769 1424 1 chr5B.!!$R1 655

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
542 560 2.159881 GGAAAGAAATTGACCGTCGACG 60.16 50.0 30.33 30.33 39.44 5.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2125 2219 0.037697 CGTCCAATCGGTCCTTGACA 60.038 55.0 0.0 0.0 33.68 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
137 142 8.375506 TGTATTTTCTAAGATGTGAAGTCCTGT 58.624 33.333 0.00 0.00 0.00 4.00
514 525 3.443681 ACTTTTGAGTGTGTTTCCAGGTG 59.556 43.478 0.00 0.00 0.00 4.00
542 560 2.159881 GGAAAGAAATTGACCGTCGACG 60.160 50.000 30.33 30.33 39.44 5.12
667 692 3.129287 ACTGTGTTCTTGGAAACTTGCTG 59.871 43.478 0.00 0.00 0.00 4.41
680 714 2.755650 ACTTGCTGAACGTACTGAAGG 58.244 47.619 0.00 0.00 0.00 3.46
785 845 4.483950 CTGAGTCCTGGATTCCTGGTATA 58.516 47.826 23.58 6.48 42.31 1.47
1120 1194 3.101643 TGAAGAGGCTAGCTCTTACCA 57.898 47.619 21.70 16.09 40.79 3.25
1144 1218 2.330231 ACCACAAATTCATGTTCGCG 57.670 45.000 0.00 0.00 0.00 5.87
1252 1329 4.285003 TCTTCAAGAACCCGAGAATGGTAA 59.715 41.667 0.00 0.00 34.15 2.85
1356 1438 1.754226 ACGCCAAGGTTGTGTGAAATT 59.246 42.857 0.00 0.00 0.00 1.82
1718 1808 7.067496 ACTTCTCTGAAATGAAGTCCTAACA 57.933 36.000 5.29 0.00 46.70 2.41
1777 1871 8.495949 GGTGACAATATATGTTCTTTATGACCG 58.504 37.037 0.00 0.00 44.12 4.79
1886 1980 5.534654 GTGCTGCCCCAATAGTATTTGATAA 59.465 40.000 0.00 0.00 0.00 1.75
1892 1986 7.232534 TGCCCCAATAGTATTTGATAATTCCAC 59.767 37.037 0.00 0.00 0.00 4.02
1941 2035 3.525609 TGGGTTGGCTTATATTCAGGACA 59.474 43.478 0.00 0.00 0.00 4.02
1947 2041 6.147864 TGGCTTATATTCAGGACAATTTGC 57.852 37.500 0.00 0.00 0.00 3.68
1954 2048 1.888512 TCAGGACAATTTGCTTGGCTC 59.111 47.619 0.00 0.00 43.02 4.70
2125 2219 1.453155 CGCCAACATACTGAGGCTTT 58.547 50.000 0.00 0.00 38.96 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
514 525 5.528870 ACGGTCAATTTCTTTCCAATTGTC 58.471 37.500 4.43 1.06 40.88 3.18
698 732 9.725019 ACAATAGAGTGTCAATTTCAGTATTCA 57.275 29.630 0.00 0.00 0.00 2.57
767 827 4.409247 ACTGTTATACCAGGAATCCAGGAC 59.591 45.833 18.16 5.58 36.75 3.85
785 845 9.574516 AAAGTGAAAGAGTAAATATGGACTGTT 57.425 29.630 0.00 0.00 30.99 3.16
1120 1194 4.792704 GCGAACATGAATTTGTGGTTCAGT 60.793 41.667 0.00 0.00 38.81 3.41
1334 1415 0.736053 TTCACACAACCTTGGCGTTC 59.264 50.000 0.00 0.00 0.00 3.95
1356 1438 5.163703 CGGTTTGCTATACCTTGCACAAATA 60.164 40.000 0.00 0.00 39.05 1.40
1459 1541 4.055360 CTGTCGAGGTACACAAAATGACA 58.945 43.478 0.00 0.00 34.32 3.58
1777 1871 1.377202 TGTTGCGCCCATTCCTCTC 60.377 57.895 4.18 0.00 0.00 3.20
1892 1986 5.220854 CGGGAAATAAGCATAACACCAAGAG 60.221 44.000 0.00 0.00 0.00 2.85
1941 2035 3.146066 TCTGTTACGAGCCAAGCAAATT 58.854 40.909 0.00 0.00 0.00 1.82
1954 2048 2.060326 TCGAAGGTTGCTCTGTTACG 57.940 50.000 0.00 0.00 0.00 3.18
2125 2219 0.037697 CGTCCAATCGGTCCTTGACA 60.038 55.000 0.00 0.00 33.68 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.