Multiple sequence alignment - TraesCS1A01G008700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G008700 chr1A 100.000 3539 0 0 1 3539 5131408 5134946 0.000000e+00 6536.0
1 TraesCS1A01G008700 chr1A 81.818 1111 134 24 952 2015 6202677 6201588 0.000000e+00 870.0
2 TraesCS1A01G008700 chr1A 88.113 673 61 11 922 1594 5107157 5107810 0.000000e+00 782.0
3 TraesCS1A01G008700 chr1A 89.400 500 47 5 1578 2071 5107925 5108424 3.000000e-175 625.0
4 TraesCS1A01G008700 chr1A 84.211 665 76 10 973 1632 6218512 6217872 1.400000e-173 619.0
5 TraesCS1A01G008700 chr1A 84.308 650 79 10 962 1605 6291342 6290710 6.490000e-172 614.0
6 TraesCS1A01G008700 chr1A 85.510 559 64 3 949 1507 6224233 6223692 5.130000e-158 568.0
7 TraesCS1A01G008700 chr1A 83.088 408 48 12 3140 3537 6512044 6511648 5.620000e-93 351.0
8 TraesCS1A01G008700 chr1A 77.134 656 89 30 953 1608 5324145 5324739 1.230000e-84 324.0
9 TraesCS1A01G008700 chr1A 76.829 656 90 31 953 1608 5235171 5235764 2.650000e-81 313.0
10 TraesCS1A01G008700 chr1A 78.652 534 65 27 1526 2015 6201555 6201027 3.430000e-80 309.0
11 TraesCS1A01G008700 chr1A 81.373 408 51 13 1629 2015 6290653 6290250 3.430000e-80 309.0
12 TraesCS1A01G008700 chr1A 80.494 405 62 7 949 1346 5177137 5177531 9.610000e-76 294.0
13 TraesCS1A01G008700 chr1A 80.247 405 63 7 949 1346 5195237 5195631 4.470000e-74 289.0
14 TraesCS1A01G008700 chr1A 77.333 450 64 22 1526 1939 6290217 6289770 7.640000e-57 231.0
15 TraesCS1A01G008700 chr1A 82.011 189 29 4 2268 2454 5643246 5643061 4.730000e-34 156.0
16 TraesCS1A01G008700 chr1A 86.486 74 8 2 1 73 592066868 592066940 2.930000e-11 80.5
17 TraesCS1A01G008700 chr1D 83.447 441 54 11 3099 3530 7178742 7179172 3.310000e-105 392.0
18 TraesCS1A01G008700 chr1D 83.257 436 52 12 3105 3530 4309985 4309561 7.170000e-102 381.0
19 TraesCS1A01G008700 chr1D 79.616 417 64 12 953 1369 3755107 3755502 2.690000e-71 279.0
20 TraesCS1A01G008700 chr1D 79.703 404 65 4 949 1346 3801810 3802202 3.480000e-70 276.0
21 TraesCS1A01G008700 chr1D 87.302 189 22 2 2416 2603 4401335 4401148 7.690000e-52 215.0
22 TraesCS1A01G008700 chr1D 88.398 181 16 5 123 302 471826166 471826342 2.770000e-51 213.0
23 TraesCS1A01G008700 chr1B 77.591 656 94 28 954 1608 6456350 6456953 7.270000e-92 348.0
24 TraesCS1A01G008700 chr1B 85.561 187 26 1 2416 2602 629835011 629835196 1.000000e-45 195.0
25 TraesCS1A01G008700 chr1B 100.000 29 0 0 2173 2201 210211925 210211897 2.000000e-03 54.7
26 TraesCS1A01G008700 chr6B 84.395 314 45 4 2609 2920 507613921 507613610 4.440000e-79 305.0
27 TraesCS1A01G008700 chr6D 83.758 314 45 5 2609 2920 317002011 317002320 3.460000e-75 292.0
28 TraesCS1A01G008700 chr6D 81.731 312 45 10 2609 2916 158848016 158848319 2.110000e-62 250.0
29 TraesCS1A01G008700 chr6D 90.164 183 15 3 121 302 468870422 468870242 5.910000e-58 235.0
30 TraesCS1A01G008700 chr6D 95.122 41 1 1 4 44 462700973 462701012 2.950000e-06 63.9
31 TraesCS1A01G008700 chr6A 82.274 299 51 2 2610 2907 216649038 216649335 1.260000e-64 257.0
32 TraesCS1A01G008700 chr6A 91.061 179 14 2 125 302 584949387 584949210 1.270000e-59 241.0
33 TraesCS1A01G008700 chr7D 89.894 188 13 4 117 302 13796639 13796456 1.640000e-58 237.0
34 TraesCS1A01G008700 chr3A 91.228 171 10 3 123 293 69642916 69643081 9.880000e-56 228.0
35 TraesCS1A01G008700 chr3A 88.701 177 17 3 123 297 546416843 546417018 2.770000e-51 213.0
36 TraesCS1A01G008700 chr3A 93.966 116 6 1 812 927 681449895 681449781 1.310000e-39 174.0
37 TraesCS1A01G008700 chr3A 91.057 123 11 0 809 931 264939823 264939945 2.190000e-37 167.0
38 TraesCS1A01G008700 chr3A 91.736 121 8 2 805 924 572598285 572598404 2.190000e-37 167.0
39 TraesCS1A01G008700 chr3A 87.671 73 9 0 1 73 743374321 743374393 6.290000e-13 86.1
40 TraesCS1A01G008700 chr4B 89.560 182 13 6 123 303 18701930 18701754 3.550000e-55 226.0
41 TraesCS1A01G008700 chr4D 89.011 182 16 4 123 303 481856648 481856470 4.600000e-54 222.0
42 TraesCS1A01G008700 chr2A 88.043 184 17 3 123 302 13615918 13616100 2.770000e-51 213.0
43 TraesCS1A01G008700 chr2A 94.595 111 6 0 816 926 209894273 209894163 4.700000e-39 172.0
44 TraesCS1A01G008700 chr5A 94.017 117 7 0 810 926 503510720 503510604 1.010000e-40 178.0
45 TraesCS1A01G008700 chr5A 100.000 29 0 0 2173 2201 378551013 378550985 2.000000e-03 54.7
46 TraesCS1A01G008700 chr4A 94.595 111 6 0 813 923 90353375 90353265 4.700000e-39 172.0
47 TraesCS1A01G008700 chr2D 90.698 129 11 1 808 936 349931229 349931356 1.690000e-38 171.0
48 TraesCS1A01G008700 chr5D 92.437 119 8 1 807 925 560426075 560426192 6.080000e-38 169.0
49 TraesCS1A01G008700 chr5D 97.222 36 1 0 2174 2209 433503822 433503857 1.060000e-05 62.1
50 TraesCS1A01G008700 chr7B 92.308 117 9 0 810 926 718871657 718871773 2.190000e-37 167.0
51 TraesCS1A01G008700 chrUn 82.468 154 25 2 2765 2916 83974176 83974329 2.220000e-27 134.0
52 TraesCS1A01G008700 chr3D 84.722 72 10 1 2 73 288048010 288048080 1.760000e-08 71.3
53 TraesCS1A01G008700 chr3D 96.970 33 1 0 2174 2206 336588371 336588339 4.940000e-04 56.5
54 TraesCS1A01G008700 chr3B 81.944 72 12 1 2 73 380867987 380868057 3.820000e-05 60.2
55 TraesCS1A01G008700 chr7A 100.000 30 0 0 2082 2111 539305455 539305484 4.940000e-04 56.5
56 TraesCS1A01G008700 chr2B 100.000 28 0 0 2174 2201 8309920 8309893 6.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G008700 chr1A 5131408 5134946 3538 False 6536.000000 6536 100.000000 1 3539 1 chr1A.!!$F1 3538
1 TraesCS1A01G008700 chr1A 5107157 5108424 1267 False 703.500000 782 88.756500 922 2071 2 chr1A.!!$F7 1149
2 TraesCS1A01G008700 chr1A 6217872 6218512 640 True 619.000000 619 84.211000 973 1632 1 chr1A.!!$R2 659
3 TraesCS1A01G008700 chr1A 6201027 6202677 1650 True 589.500000 870 80.235000 952 2015 2 chr1A.!!$R5 1063
4 TraesCS1A01G008700 chr1A 6223692 6224233 541 True 568.000000 568 85.510000 949 1507 1 chr1A.!!$R3 558
5 TraesCS1A01G008700 chr1A 6289770 6291342 1572 True 384.666667 614 81.004667 962 2015 3 chr1A.!!$R6 1053
6 TraesCS1A01G008700 chr1A 5324145 5324739 594 False 324.000000 324 77.134000 953 1608 1 chr1A.!!$F5 655
7 TraesCS1A01G008700 chr1A 5235171 5235764 593 False 313.000000 313 76.829000 953 1608 1 chr1A.!!$F4 655
8 TraesCS1A01G008700 chr1B 6456350 6456953 603 False 348.000000 348 77.591000 954 1608 1 chr1B.!!$F1 654


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
498 499 0.028242 CAGCAGCTACGAGACTACGG 59.972 60.0 0.0 0.0 37.61 4.02 F
508 509 0.031449 GAGACTACGGCTCTCATGGC 59.969 60.0 0.0 0.0 35.21 4.40 F
1149 1154 0.037326 TGTCATGCTCGTCCTGAACC 60.037 55.0 0.0 0.0 0.00 3.62 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2095 2325 0.038166 TAACTGGGGCAGCCTGAAAG 59.962 55.0 12.43 6.53 34.37 2.62 R
2126 2356 0.187361 ACCAAAACAGGCCCTGCTTA 59.813 50.0 11.63 0.00 34.37 3.09 R
2818 3048 0.034089 GGCCCTCAGTGTAGCCAAAT 60.034 55.0 13.59 0.00 45.07 2.32 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 2.565210 GCAAAATGCGATCATGACCA 57.435 45.000 0.00 0.00 31.71 4.02
20 21 3.088194 GCAAAATGCGATCATGACCAT 57.912 42.857 0.00 0.00 31.71 3.55
21 22 3.450578 GCAAAATGCGATCATGACCATT 58.549 40.909 0.00 4.94 31.71 3.16
22 23 3.244345 GCAAAATGCGATCATGACCATTG 59.756 43.478 14.98 9.06 31.71 2.82
23 24 4.674475 CAAAATGCGATCATGACCATTGA 58.326 39.130 14.98 0.00 32.23 2.57
24 25 4.987408 AAATGCGATCATGACCATTGAA 57.013 36.364 14.98 0.00 32.23 2.69
25 26 4.563337 AATGCGATCATGACCATTGAAG 57.437 40.909 14.00 0.00 32.23 3.02
26 27 3.264998 TGCGATCATGACCATTGAAGA 57.735 42.857 0.00 0.00 0.00 2.87
27 28 3.812262 TGCGATCATGACCATTGAAGAT 58.188 40.909 0.00 0.00 0.00 2.40
28 29 4.201657 TGCGATCATGACCATTGAAGATT 58.798 39.130 0.00 0.00 0.00 2.40
29 30 5.367302 TGCGATCATGACCATTGAAGATTA 58.633 37.500 0.00 0.00 0.00 1.75
30 31 5.999600 TGCGATCATGACCATTGAAGATTAT 59.000 36.000 0.00 0.00 0.00 1.28
31 32 6.072893 TGCGATCATGACCATTGAAGATTATG 60.073 38.462 0.00 0.00 0.00 1.90
32 33 6.148315 GCGATCATGACCATTGAAGATTATGA 59.852 38.462 0.00 0.00 0.00 2.15
33 34 7.148289 GCGATCATGACCATTGAAGATTATGAT 60.148 37.037 0.00 0.00 36.90 2.45
34 35 8.727910 CGATCATGACCATTGAAGATTATGATT 58.272 33.333 0.00 0.00 35.02 2.57
54 55 7.935338 TGATTTTTCTTTCTCTCAATGCAAC 57.065 32.000 0.00 0.00 0.00 4.17
55 56 7.719483 TGATTTTTCTTTCTCTCAATGCAACT 58.281 30.769 0.00 0.00 0.00 3.16
56 57 7.864379 TGATTTTTCTTTCTCTCAATGCAACTC 59.136 33.333 0.00 0.00 0.00 3.01
57 58 6.698008 TTTTCTTTCTCTCAATGCAACTCA 57.302 33.333 0.00 0.00 0.00 3.41
58 59 5.679734 TTCTTTCTCTCAATGCAACTCAC 57.320 39.130 0.00 0.00 0.00 3.51
59 60 3.742882 TCTTTCTCTCAATGCAACTCACG 59.257 43.478 0.00 0.00 0.00 4.35
60 61 2.084610 TCTCTCAATGCAACTCACGG 57.915 50.000 0.00 0.00 0.00 4.94
61 62 1.081892 CTCTCAATGCAACTCACGGG 58.918 55.000 0.00 0.00 0.00 5.28
62 63 0.955428 TCTCAATGCAACTCACGGGC 60.955 55.000 0.00 0.00 0.00 6.13
63 64 1.926511 CTCAATGCAACTCACGGGCC 61.927 60.000 0.00 0.00 0.00 5.80
64 65 2.676471 AATGCAACTCACGGGCCC 60.676 61.111 13.57 13.57 0.00 5.80
65 66 3.210012 AATGCAACTCACGGGCCCT 62.210 57.895 22.43 3.67 0.00 5.19
66 67 2.713531 AATGCAACTCACGGGCCCTT 62.714 55.000 22.43 7.92 0.00 3.95
67 68 2.597510 GCAACTCACGGGCCCTTT 60.598 61.111 22.43 2.91 0.00 3.11
68 69 2.200337 GCAACTCACGGGCCCTTTT 61.200 57.895 22.43 0.00 0.00 2.27
69 70 1.956802 CAACTCACGGGCCCTTTTC 59.043 57.895 22.43 0.00 0.00 2.29
70 71 1.228459 AACTCACGGGCCCTTTTCC 60.228 57.895 22.43 0.00 0.00 3.13
71 72 1.716028 AACTCACGGGCCCTTTTCCT 61.716 55.000 22.43 0.00 0.00 3.36
72 73 0.838987 ACTCACGGGCCCTTTTCCTA 60.839 55.000 22.43 0.00 0.00 2.94
73 74 0.392595 CTCACGGGCCCTTTTCCTAC 60.393 60.000 22.43 0.00 0.00 3.18
74 75 0.838987 TCACGGGCCCTTTTCCTACT 60.839 55.000 22.43 0.00 0.00 2.57
75 76 0.392595 CACGGGCCCTTTTCCTACTC 60.393 60.000 22.43 0.00 0.00 2.59
76 77 0.546988 ACGGGCCCTTTTCCTACTCT 60.547 55.000 22.43 0.00 0.00 3.24
77 78 1.273438 ACGGGCCCTTTTCCTACTCTA 60.273 52.381 22.43 0.00 0.00 2.43
78 79 1.835531 CGGGCCCTTTTCCTACTCTAA 59.164 52.381 22.43 0.00 0.00 2.10
79 80 2.438392 CGGGCCCTTTTCCTACTCTAAT 59.562 50.000 22.43 0.00 0.00 1.73
80 81 3.644738 CGGGCCCTTTTCCTACTCTAATA 59.355 47.826 22.43 0.00 0.00 0.98
81 82 4.286291 CGGGCCCTTTTCCTACTCTAATAT 59.714 45.833 22.43 0.00 0.00 1.28
82 83 5.569026 CGGGCCCTTTTCCTACTCTAATATC 60.569 48.000 22.43 0.00 0.00 1.63
83 84 5.548446 GGGCCCTTTTCCTACTCTAATATCT 59.452 44.000 17.04 0.00 0.00 1.98
84 85 6.044520 GGGCCCTTTTCCTACTCTAATATCTT 59.955 42.308 17.04 0.00 0.00 2.40
85 86 7.237055 GGGCCCTTTTCCTACTCTAATATCTTA 59.763 40.741 17.04 0.00 0.00 2.10
86 87 8.315482 GGCCCTTTTCCTACTCTAATATCTTAG 58.685 40.741 0.00 0.00 36.46 2.18
87 88 7.820386 GCCCTTTTCCTACTCTAATATCTTAGC 59.180 40.741 0.00 0.00 35.32 3.09
88 89 8.315482 CCCTTTTCCTACTCTAATATCTTAGCC 58.685 40.741 0.00 0.00 35.32 3.93
89 90 8.871125 CCTTTTCCTACTCTAATATCTTAGCCA 58.129 37.037 0.00 0.00 35.32 4.75
90 91 9.921637 CTTTTCCTACTCTAATATCTTAGCCAG 57.078 37.037 0.00 0.00 35.32 4.85
91 92 9.656323 TTTTCCTACTCTAATATCTTAGCCAGA 57.344 33.333 0.00 0.00 35.32 3.86
92 93 8.638629 TTCCTACTCTAATATCTTAGCCAGAC 57.361 38.462 0.00 0.00 35.32 3.51
93 94 7.756614 TCCTACTCTAATATCTTAGCCAGACA 58.243 38.462 0.00 0.00 35.32 3.41
94 95 7.666388 TCCTACTCTAATATCTTAGCCAGACAC 59.334 40.741 0.00 0.00 35.32 3.67
95 96 7.448777 CCTACTCTAATATCTTAGCCAGACACA 59.551 40.741 0.00 0.00 35.32 3.72
96 97 7.661536 ACTCTAATATCTTAGCCAGACACAA 57.338 36.000 0.00 0.00 35.32 3.33
97 98 7.493367 ACTCTAATATCTTAGCCAGACACAAC 58.507 38.462 0.00 0.00 35.32 3.32
98 99 7.343316 ACTCTAATATCTTAGCCAGACACAACT 59.657 37.037 0.00 0.00 35.32 3.16
99 100 8.079211 TCTAATATCTTAGCCAGACACAACTT 57.921 34.615 0.00 0.00 35.32 2.66
100 101 8.198109 TCTAATATCTTAGCCAGACACAACTTC 58.802 37.037 0.00 0.00 35.32 3.01
101 102 3.402628 TCTTAGCCAGACACAACTTCC 57.597 47.619 0.00 0.00 0.00 3.46
102 103 2.972713 TCTTAGCCAGACACAACTTCCT 59.027 45.455 0.00 0.00 0.00 3.36
103 104 4.157246 TCTTAGCCAGACACAACTTCCTA 58.843 43.478 0.00 0.00 0.00 2.94
104 105 4.591498 TCTTAGCCAGACACAACTTCCTAA 59.409 41.667 0.00 0.00 0.00 2.69
105 106 3.409026 AGCCAGACACAACTTCCTAAG 57.591 47.619 0.00 0.00 0.00 2.18
106 107 2.706190 AGCCAGACACAACTTCCTAAGT 59.294 45.455 0.00 0.00 45.46 2.24
121 122 8.510243 ACTTCCTAAGTTAAGCTAGTACTCTC 57.490 38.462 0.00 0.00 39.04 3.20
122 123 7.557358 ACTTCCTAAGTTAAGCTAGTACTCTCC 59.443 40.741 0.00 0.00 39.04 3.71
123 124 6.966751 TCCTAAGTTAAGCTAGTACTCTCCA 58.033 40.000 0.00 0.00 0.00 3.86
124 125 7.408543 TCCTAAGTTAAGCTAGTACTCTCCAA 58.591 38.462 0.00 0.00 0.00 3.53
125 126 8.060075 TCCTAAGTTAAGCTAGTACTCTCCAAT 58.940 37.037 0.00 0.00 0.00 3.16
126 127 9.352191 CCTAAGTTAAGCTAGTACTCTCCAATA 57.648 37.037 0.00 0.00 0.00 1.90
130 131 8.145122 AGTTAAGCTAGTACTCTCCAATAATGC 58.855 37.037 0.00 0.00 0.00 3.56
131 132 6.739331 AAGCTAGTACTCTCCAATAATGCT 57.261 37.500 0.00 0.00 0.00 3.79
132 133 7.841282 AAGCTAGTACTCTCCAATAATGCTA 57.159 36.000 0.00 0.00 0.00 3.49
133 134 7.841282 AGCTAGTACTCTCCAATAATGCTAA 57.159 36.000 0.00 0.00 0.00 3.09
134 135 8.251383 AGCTAGTACTCTCCAATAATGCTAAA 57.749 34.615 0.00 0.00 0.00 1.85
135 136 8.145122 AGCTAGTACTCTCCAATAATGCTAAAC 58.855 37.037 0.00 0.00 0.00 2.01
136 137 7.926555 GCTAGTACTCTCCAATAATGCTAAACA 59.073 37.037 0.00 0.00 0.00 2.83
137 138 9.988815 CTAGTACTCTCCAATAATGCTAAACAT 57.011 33.333 0.00 0.00 42.30 2.71
139 140 9.765795 AGTACTCTCCAATAATGCTAAACATAC 57.234 33.333 0.00 0.00 38.34 2.39
140 141 9.542462 GTACTCTCCAATAATGCTAAACATACA 57.458 33.333 0.00 0.00 38.34 2.29
142 143 9.461312 ACTCTCCAATAATGCTAAACATACAAA 57.539 29.630 0.00 0.00 38.34 2.83
143 144 9.941664 CTCTCCAATAATGCTAAACATACAAAG 57.058 33.333 0.00 0.00 38.34 2.77
144 145 9.679661 TCTCCAATAATGCTAAACATACAAAGA 57.320 29.630 0.00 0.00 38.34 2.52
145 146 9.941664 CTCCAATAATGCTAAACATACAAAGAG 57.058 33.333 0.00 0.00 38.34 2.85
146 147 9.461312 TCCAATAATGCTAAACATACAAAGAGT 57.539 29.630 0.00 0.00 38.34 3.24
152 153 7.112528 TGCTAAACATACAAAGAGTTACACG 57.887 36.000 0.00 0.00 0.00 4.49
153 154 6.013689 GCTAAACATACAAAGAGTTACACGC 58.986 40.000 0.00 0.00 0.00 5.34
154 155 5.994887 AAACATACAAAGAGTTACACGCA 57.005 34.783 0.00 0.00 0.00 5.24
155 156 5.994887 AACATACAAAGAGTTACACGCAA 57.005 34.783 0.00 0.00 0.00 4.85
156 157 6.554334 AACATACAAAGAGTTACACGCAAT 57.446 33.333 0.00 0.00 0.00 3.56
157 158 6.554334 ACATACAAAGAGTTACACGCAATT 57.446 33.333 0.00 0.00 0.00 2.32
158 159 7.661127 ACATACAAAGAGTTACACGCAATTA 57.339 32.000 0.00 0.00 0.00 1.40
159 160 7.515643 ACATACAAAGAGTTACACGCAATTAC 58.484 34.615 0.00 0.00 0.00 1.89
160 161 5.994887 ACAAAGAGTTACACGCAATTACA 57.005 34.783 0.00 0.00 0.00 2.41
161 162 5.744490 ACAAAGAGTTACACGCAATTACAC 58.256 37.500 0.00 0.00 0.00 2.90
162 163 4.640805 AAGAGTTACACGCAATTACACG 57.359 40.909 0.00 0.00 0.00 4.49
163 164 2.410730 AGAGTTACACGCAATTACACGC 59.589 45.455 0.00 0.00 0.00 5.34
164 165 2.409975 AGTTACACGCAATTACACGCT 58.590 42.857 0.00 0.00 0.00 5.07
165 166 2.156891 AGTTACACGCAATTACACGCTG 59.843 45.455 0.00 0.00 0.00 5.18
166 167 2.067414 TACACGCAATTACACGCTGA 57.933 45.000 0.00 0.00 0.00 4.26
167 168 0.511221 ACACGCAATTACACGCTGAC 59.489 50.000 0.00 0.00 0.00 3.51
168 169 0.790207 CACGCAATTACACGCTGACT 59.210 50.000 0.00 0.00 0.00 3.41
169 170 1.989864 CACGCAATTACACGCTGACTA 59.010 47.619 0.00 0.00 0.00 2.59
170 171 2.028045 CACGCAATTACACGCTGACTAG 59.972 50.000 0.00 0.00 0.00 2.57
171 172 1.588404 CGCAATTACACGCTGACTAGG 59.412 52.381 0.00 0.00 0.00 3.02
172 173 2.734175 CGCAATTACACGCTGACTAGGA 60.734 50.000 0.00 0.00 0.00 2.94
173 174 3.458189 GCAATTACACGCTGACTAGGAT 58.542 45.455 0.00 0.00 0.00 3.24
174 175 3.871594 GCAATTACACGCTGACTAGGATT 59.128 43.478 0.00 0.00 0.00 3.01
175 176 4.332819 GCAATTACACGCTGACTAGGATTT 59.667 41.667 0.00 0.00 0.00 2.17
176 177 5.163754 GCAATTACACGCTGACTAGGATTTT 60.164 40.000 0.00 0.00 0.00 1.82
177 178 6.622896 GCAATTACACGCTGACTAGGATTTTT 60.623 38.462 0.00 0.00 0.00 1.94
198 199 6.947644 TTTTGTTTCTAACTAACCACTCCC 57.052 37.500 0.00 0.00 0.00 4.30
199 200 4.628963 TGTTTCTAACTAACCACTCCCC 57.371 45.455 0.00 0.00 0.00 4.81
200 201 3.328637 TGTTTCTAACTAACCACTCCCCC 59.671 47.826 0.00 0.00 0.00 5.40
220 221 2.818921 CCCTGTTTTTCATGGGGATGA 58.181 47.619 0.00 0.00 39.42 2.92
221 222 2.762327 CCCTGTTTTTCATGGGGATGAG 59.238 50.000 0.00 0.00 39.42 2.90
222 223 2.167075 CCTGTTTTTCATGGGGATGAGC 59.833 50.000 0.00 0.00 31.46 4.26
223 224 2.167075 CTGTTTTTCATGGGGATGAGCC 59.833 50.000 0.00 0.00 31.46 4.70
232 233 2.851588 GGATGAGCCCCTCCTCCC 60.852 72.222 5.54 0.00 38.69 4.30
233 234 2.851588 GATGAGCCCCTCCTCCCC 60.852 72.222 0.00 0.00 0.00 4.81
234 235 3.381049 ATGAGCCCCTCCTCCCCT 61.381 66.667 0.00 0.00 0.00 4.79
235 236 2.923852 GATGAGCCCCTCCTCCCCTT 62.924 65.000 0.00 0.00 0.00 3.95
236 237 1.613284 ATGAGCCCCTCCTCCCCTTA 61.613 60.000 0.00 0.00 0.00 2.69
237 238 1.004361 GAGCCCCTCCTCCCCTTAA 59.996 63.158 0.00 0.00 0.00 1.85
238 239 1.307953 AGCCCCTCCTCCCCTTAAC 60.308 63.158 0.00 0.00 0.00 2.01
239 240 2.384433 GCCCCTCCTCCCCTTAACC 61.384 68.421 0.00 0.00 0.00 2.85
240 241 1.400711 CCCCTCCTCCCCTTAACCT 59.599 63.158 0.00 0.00 0.00 3.50
241 242 0.694783 CCCCTCCTCCCCTTAACCTC 60.695 65.000 0.00 0.00 0.00 3.85
242 243 0.694783 CCCTCCTCCCCTTAACCTCC 60.695 65.000 0.00 0.00 0.00 4.30
243 244 0.044244 CCTCCTCCCCTTAACCTCCA 59.956 60.000 0.00 0.00 0.00 3.86
244 245 1.557188 CCTCCTCCCCTTAACCTCCAA 60.557 57.143 0.00 0.00 0.00 3.53
245 246 2.493091 CTCCTCCCCTTAACCTCCAAT 58.507 52.381 0.00 0.00 0.00 3.16
246 247 2.439880 CTCCTCCCCTTAACCTCCAATC 59.560 54.545 0.00 0.00 0.00 2.67
247 248 2.205342 CCTCCCCTTAACCTCCAATCA 58.795 52.381 0.00 0.00 0.00 2.57
248 249 2.785857 CCTCCCCTTAACCTCCAATCAT 59.214 50.000 0.00 0.00 0.00 2.45
249 250 3.980698 CCTCCCCTTAACCTCCAATCATA 59.019 47.826 0.00 0.00 0.00 2.15
250 251 4.415512 CCTCCCCTTAACCTCCAATCATAA 59.584 45.833 0.00 0.00 0.00 1.90
251 252 5.103686 CCTCCCCTTAACCTCCAATCATAAA 60.104 44.000 0.00 0.00 0.00 1.40
252 253 5.762279 TCCCCTTAACCTCCAATCATAAAC 58.238 41.667 0.00 0.00 0.00 2.01
253 254 4.893524 CCCCTTAACCTCCAATCATAAACC 59.106 45.833 0.00 0.00 0.00 3.27
254 255 4.893524 CCCTTAACCTCCAATCATAAACCC 59.106 45.833 0.00 0.00 0.00 4.11
255 256 5.515106 CCTTAACCTCCAATCATAAACCCA 58.485 41.667 0.00 0.00 0.00 4.51
256 257 6.136155 CCTTAACCTCCAATCATAAACCCAT 58.864 40.000 0.00 0.00 0.00 4.00
257 258 7.294584 CCTTAACCTCCAATCATAAACCCATA 58.705 38.462 0.00 0.00 0.00 2.74
258 259 7.950124 CCTTAACCTCCAATCATAAACCCATAT 59.050 37.037 0.00 0.00 0.00 1.78
259 260 8.704849 TTAACCTCCAATCATAAACCCATATG 57.295 34.615 0.00 0.00 35.11 1.78
260 261 6.279813 ACCTCCAATCATAAACCCATATGT 57.720 37.500 1.24 0.00 35.29 2.29
261 262 6.682537 ACCTCCAATCATAAACCCATATGTT 58.317 36.000 1.24 0.00 35.29 2.71
262 263 7.132128 ACCTCCAATCATAAACCCATATGTTT 58.868 34.615 1.24 0.00 41.18 2.83
263 264 7.069826 ACCTCCAATCATAAACCCATATGTTTG 59.930 37.037 1.24 9.53 39.96 2.93
264 265 7.069826 CCTCCAATCATAAACCCATATGTTTGT 59.930 37.037 1.24 0.00 39.30 2.83
265 266 9.130661 CTCCAATCATAAACCCATATGTTTGTA 57.869 33.333 1.24 0.00 39.30 2.41
266 267 9.480861 TCCAATCATAAACCCATATGTTTGTAA 57.519 29.630 1.24 3.69 39.30 2.41
271 272 8.532819 TCATAAACCCATATGTTTGTAAAACCC 58.467 33.333 1.24 0.00 38.79 4.11
272 273 6.749036 AAACCCATATGTTTGTAAAACCCA 57.251 33.333 1.24 0.00 37.08 4.51
273 274 6.943899 AACCCATATGTTTGTAAAACCCAT 57.056 33.333 1.24 0.00 0.00 4.00
274 275 6.293004 ACCCATATGTTTGTAAAACCCATG 57.707 37.500 1.24 4.32 0.00 3.66
275 276 5.782845 ACCCATATGTTTGTAAAACCCATGT 59.217 36.000 1.24 0.00 0.00 3.21
276 277 6.954684 ACCCATATGTTTGTAAAACCCATGTA 59.045 34.615 1.24 0.00 0.00 2.29
277 278 7.455008 ACCCATATGTTTGTAAAACCCATGTAA 59.545 33.333 1.24 0.00 0.00 2.41
278 279 8.314751 CCCATATGTTTGTAAAACCCATGTAAA 58.685 33.333 1.24 0.00 0.00 2.01
279 280 9.145865 CCATATGTTTGTAAAACCCATGTAAAC 57.854 33.333 1.24 0.00 0.00 2.01
280 281 9.921637 CATATGTTTGTAAAACCCATGTAAACT 57.078 29.630 0.00 0.00 0.00 2.66
284 285 9.751542 TGTTTGTAAAACCCATGTAAACTTATG 57.248 29.630 0.00 0.00 0.00 1.90
285 286 9.752961 GTTTGTAAAACCCATGTAAACTTATGT 57.247 29.630 0.00 0.00 0.00 2.29
291 292 8.644374 AAACCCATGTAAACTTATGTATGTGT 57.356 30.769 0.00 0.00 0.00 3.72
292 293 9.742144 AAACCCATGTAAACTTATGTATGTGTA 57.258 29.630 0.00 0.00 0.00 2.90
293 294 8.958119 ACCCATGTAAACTTATGTATGTGTAG 57.042 34.615 0.00 0.00 0.00 2.74
294 295 8.764558 ACCCATGTAAACTTATGTATGTGTAGA 58.235 33.333 0.00 0.00 0.00 2.59
295 296 9.778741 CCCATGTAAACTTATGTATGTGTAGAT 57.221 33.333 0.00 0.00 0.00 1.98
309 310 9.682465 TGTATGTGTAGATTTACTCAGTACTCT 57.318 33.333 0.00 2.44 36.89 3.24
311 312 7.304919 TGTGTAGATTTACTCAGTACTCTCG 57.695 40.000 0.00 0.00 31.60 4.04
312 313 6.315642 TGTGTAGATTTACTCAGTACTCTCGG 59.684 42.308 0.00 0.00 31.60 4.63
313 314 6.315891 GTGTAGATTTACTCAGTACTCTCGGT 59.684 42.308 0.00 0.00 0.00 4.69
314 315 5.821516 AGATTTACTCAGTACTCTCGGTG 57.178 43.478 0.00 0.00 0.00 4.94
315 316 3.844577 TTTACTCAGTACTCTCGGTGC 57.155 47.619 0.00 0.00 0.00 5.01
316 317 2.484742 TACTCAGTACTCTCGGTGCA 57.515 50.000 0.00 0.00 32.88 4.57
317 318 0.882474 ACTCAGTACTCTCGGTGCAC 59.118 55.000 8.80 8.80 32.88 4.57
318 319 0.881796 CTCAGTACTCTCGGTGCACA 59.118 55.000 20.43 0.00 32.88 4.57
319 320 0.596577 TCAGTACTCTCGGTGCACAC 59.403 55.000 20.43 6.13 32.88 3.82
320 321 0.313987 CAGTACTCTCGGTGCACACA 59.686 55.000 20.43 2.66 32.88 3.72
321 322 0.314302 AGTACTCTCGGTGCACACAC 59.686 55.000 20.43 0.00 46.66 3.82
329 330 4.112086 GTGCACACACCACGTACA 57.888 55.556 13.17 0.00 41.21 2.90
330 331 2.385237 GTGCACACACCACGTACAA 58.615 52.632 13.17 0.00 41.21 2.41
331 332 0.303493 GTGCACACACCACGTACAAG 59.697 55.000 13.17 0.00 41.21 3.16
332 333 0.108089 TGCACACACCACGTACAAGT 60.108 50.000 0.00 0.00 0.00 3.16
333 334 0.580104 GCACACACCACGTACAAGTC 59.420 55.000 0.00 0.00 0.00 3.01
334 335 1.214367 CACACACCACGTACAAGTCC 58.786 55.000 0.00 0.00 0.00 3.85
335 336 0.825410 ACACACCACGTACAAGTCCA 59.175 50.000 0.00 0.00 0.00 4.02
336 337 1.207570 ACACACCACGTACAAGTCCAA 59.792 47.619 0.00 0.00 0.00 3.53
337 338 2.281517 CACACCACGTACAAGTCCAAA 58.718 47.619 0.00 0.00 0.00 3.28
338 339 2.031191 CACACCACGTACAAGTCCAAAC 59.969 50.000 0.00 0.00 0.00 2.93
339 340 1.600485 CACCACGTACAAGTCCAAACC 59.400 52.381 0.00 0.00 0.00 3.27
340 341 1.209990 ACCACGTACAAGTCCAAACCA 59.790 47.619 0.00 0.00 0.00 3.67
341 342 1.871039 CCACGTACAAGTCCAAACCAG 59.129 52.381 0.00 0.00 0.00 4.00
342 343 2.484065 CCACGTACAAGTCCAAACCAGA 60.484 50.000 0.00 0.00 0.00 3.86
343 344 2.542595 CACGTACAAGTCCAAACCAGAC 59.457 50.000 0.00 0.00 34.31 3.51
344 345 2.433239 ACGTACAAGTCCAAACCAGACT 59.567 45.455 0.00 0.00 46.50 3.24
345 346 2.800544 CGTACAAGTCCAAACCAGACTG 59.199 50.000 0.00 0.00 43.77 3.51
346 347 3.491964 CGTACAAGTCCAAACCAGACTGA 60.492 47.826 3.32 0.00 43.77 3.41
347 348 3.644966 ACAAGTCCAAACCAGACTGAA 57.355 42.857 3.32 0.00 43.77 3.02
348 349 4.170468 ACAAGTCCAAACCAGACTGAAT 57.830 40.909 3.32 0.00 43.77 2.57
349 350 3.885297 ACAAGTCCAAACCAGACTGAATG 59.115 43.478 3.32 0.00 43.77 2.67
350 351 2.508526 AGTCCAAACCAGACTGAATGC 58.491 47.619 3.32 0.00 42.94 3.56
351 352 2.107204 AGTCCAAACCAGACTGAATGCT 59.893 45.455 3.32 0.00 42.94 3.79
352 353 3.327757 AGTCCAAACCAGACTGAATGCTA 59.672 43.478 3.32 0.00 42.94 3.49
353 354 3.437049 GTCCAAACCAGACTGAATGCTAC 59.563 47.826 3.32 0.00 0.00 3.58
354 355 3.072330 TCCAAACCAGACTGAATGCTACA 59.928 43.478 3.32 0.00 0.00 2.74
355 356 3.820467 CCAAACCAGACTGAATGCTACAA 59.180 43.478 3.32 0.00 0.00 2.41
356 357 4.278170 CCAAACCAGACTGAATGCTACAAA 59.722 41.667 3.32 0.00 0.00 2.83
357 358 5.215160 CAAACCAGACTGAATGCTACAAAC 58.785 41.667 3.32 0.00 0.00 2.93
358 359 3.412386 ACCAGACTGAATGCTACAAACC 58.588 45.455 3.32 0.00 0.00 3.27
359 360 2.749621 CCAGACTGAATGCTACAAACCC 59.250 50.000 3.32 0.00 0.00 4.11
360 361 3.411446 CAGACTGAATGCTACAAACCCA 58.589 45.455 0.00 0.00 0.00 4.51
361 362 3.189287 CAGACTGAATGCTACAAACCCAC 59.811 47.826 0.00 0.00 0.00 4.61
362 363 2.151202 ACTGAATGCTACAAACCCACG 58.849 47.619 0.00 0.00 0.00 4.94
363 364 2.151202 CTGAATGCTACAAACCCACGT 58.849 47.619 0.00 0.00 0.00 4.49
364 365 3.244284 ACTGAATGCTACAAACCCACGTA 60.244 43.478 0.00 0.00 0.00 3.57
365 366 3.068560 TGAATGCTACAAACCCACGTAC 58.931 45.455 0.00 0.00 0.00 3.67
366 367 2.843401 ATGCTACAAACCCACGTACA 57.157 45.000 0.00 0.00 0.00 2.90
367 368 2.616634 TGCTACAAACCCACGTACAA 57.383 45.000 0.00 0.00 0.00 2.41
368 369 2.915349 TGCTACAAACCCACGTACAAA 58.085 42.857 0.00 0.00 0.00 2.83
369 370 2.613133 TGCTACAAACCCACGTACAAAC 59.387 45.455 0.00 0.00 0.00 2.93
370 371 2.031769 GCTACAAACCCACGTACAAACC 60.032 50.000 0.00 0.00 0.00 3.27
371 372 2.423446 ACAAACCCACGTACAAACCT 57.577 45.000 0.00 0.00 0.00 3.50
372 373 2.018515 ACAAACCCACGTACAAACCTG 58.981 47.619 0.00 0.00 0.00 4.00
373 374 2.290464 CAAACCCACGTACAAACCTGA 58.710 47.619 0.00 0.00 0.00 3.86
374 375 2.683867 CAAACCCACGTACAAACCTGAA 59.316 45.455 0.00 0.00 0.00 3.02
375 376 1.957668 ACCCACGTACAAACCTGAAC 58.042 50.000 0.00 0.00 0.00 3.18
376 377 1.209990 ACCCACGTACAAACCTGAACA 59.790 47.619 0.00 0.00 0.00 3.18
377 378 1.600485 CCCACGTACAAACCTGAACAC 59.400 52.381 0.00 0.00 0.00 3.32
378 379 2.281517 CCACGTACAAACCTGAACACA 58.718 47.619 0.00 0.00 0.00 3.72
379 380 2.678836 CCACGTACAAACCTGAACACAA 59.321 45.455 0.00 0.00 0.00 3.33
380 381 3.486209 CCACGTACAAACCTGAACACAAC 60.486 47.826 0.00 0.00 0.00 3.32
381 382 3.125487 CACGTACAAACCTGAACACAACA 59.875 43.478 0.00 0.00 0.00 3.33
382 383 3.125658 ACGTACAAACCTGAACACAACAC 59.874 43.478 0.00 0.00 0.00 3.32
383 384 3.372822 CGTACAAACCTGAACACAACACT 59.627 43.478 0.00 0.00 0.00 3.55
384 385 3.848272 ACAAACCTGAACACAACACTG 57.152 42.857 0.00 0.00 0.00 3.66
385 386 3.153919 ACAAACCTGAACACAACACTGT 58.846 40.909 0.00 0.00 35.63 3.55
386 387 3.572255 ACAAACCTGAACACAACACTGTT 59.428 39.130 0.00 0.00 37.06 3.16
387 388 4.762765 ACAAACCTGAACACAACACTGTTA 59.237 37.500 0.00 0.00 34.40 2.41
388 389 4.957759 AACCTGAACACAACACTGTTAC 57.042 40.909 0.00 0.00 34.40 2.50
389 390 4.216411 ACCTGAACACAACACTGTTACT 57.784 40.909 0.00 0.00 34.40 2.24
390 391 4.585879 ACCTGAACACAACACTGTTACTT 58.414 39.130 0.00 0.00 34.40 2.24
391 392 5.007682 ACCTGAACACAACACTGTTACTTT 58.992 37.500 0.00 0.00 34.40 2.66
392 393 5.475564 ACCTGAACACAACACTGTTACTTTT 59.524 36.000 0.00 0.00 34.40 2.27
393 394 6.015772 ACCTGAACACAACACTGTTACTTTTT 60.016 34.615 0.00 0.00 34.40 1.94
394 395 6.526674 CCTGAACACAACACTGTTACTTTTTC 59.473 38.462 0.00 0.00 34.40 2.29
395 396 7.209471 TGAACACAACACTGTTACTTTTTCT 57.791 32.000 0.00 0.00 34.40 2.52
396 397 8.325421 TGAACACAACACTGTTACTTTTTCTA 57.675 30.769 0.00 0.00 34.40 2.10
397 398 8.784994 TGAACACAACACTGTTACTTTTTCTAA 58.215 29.630 0.00 0.00 34.40 2.10
398 399 9.783256 GAACACAACACTGTTACTTTTTCTAAT 57.217 29.630 0.00 0.00 34.40 1.73
399 400 9.783256 AACACAACACTGTTACTTTTTCTAATC 57.217 29.630 0.00 0.00 32.38 1.75
400 401 9.174166 ACACAACACTGTTACTTTTTCTAATCT 57.826 29.630 0.00 0.00 31.64 2.40
409 410 9.582431 TGTTACTTTTTCTAATCTACTCATCCG 57.418 33.333 0.00 0.00 0.00 4.18
410 411 9.032420 GTTACTTTTTCTAATCTACTCATCCGG 57.968 37.037 0.00 0.00 0.00 5.14
411 412 6.049790 ACTTTTTCTAATCTACTCATCCGGC 58.950 40.000 0.00 0.00 0.00 6.13
412 413 5.607939 TTTTCTAATCTACTCATCCGGCA 57.392 39.130 0.00 0.00 0.00 5.69
413 414 5.607939 TTTCTAATCTACTCATCCGGCAA 57.392 39.130 0.00 0.00 0.00 4.52
414 415 4.585955 TCTAATCTACTCATCCGGCAAC 57.414 45.455 0.00 0.00 0.00 4.17
415 416 2.622064 AATCTACTCATCCGGCAACC 57.378 50.000 0.00 0.00 0.00 3.77
416 417 1.794714 ATCTACTCATCCGGCAACCT 58.205 50.000 0.00 0.00 0.00 3.50
417 418 1.568504 TCTACTCATCCGGCAACCTT 58.431 50.000 0.00 0.00 0.00 3.50
418 419 1.207089 TCTACTCATCCGGCAACCTTG 59.793 52.381 0.00 0.00 0.00 3.61
419 420 1.207089 CTACTCATCCGGCAACCTTGA 59.793 52.381 0.00 0.00 0.00 3.02
420 421 0.620556 ACTCATCCGGCAACCTTGAT 59.379 50.000 0.00 0.00 0.00 2.57
421 422 1.303309 CTCATCCGGCAACCTTGATC 58.697 55.000 0.00 0.00 0.00 2.92
422 423 0.617935 TCATCCGGCAACCTTGATCA 59.382 50.000 0.00 0.00 0.00 2.92
423 424 1.004161 TCATCCGGCAACCTTGATCAA 59.996 47.619 8.12 8.12 0.00 2.57
424 425 1.133025 CATCCGGCAACCTTGATCAAC 59.867 52.381 3.38 0.00 0.00 3.18
425 426 0.400213 TCCGGCAACCTTGATCAACT 59.600 50.000 3.38 0.00 0.00 3.16
426 427 1.202879 TCCGGCAACCTTGATCAACTT 60.203 47.619 3.38 0.00 0.00 2.66
427 428 1.068333 CCGGCAACCTTGATCAACTTG 60.068 52.381 3.38 9.95 0.00 3.16
428 429 1.666888 CGGCAACCTTGATCAACTTGC 60.667 52.381 25.26 25.26 37.16 4.01
429 430 1.615392 GGCAACCTTGATCAACTTGCT 59.385 47.619 28.70 5.81 37.85 3.91
430 431 2.819608 GGCAACCTTGATCAACTTGCTA 59.180 45.455 28.70 4.06 37.85 3.49
431 432 3.255642 GGCAACCTTGATCAACTTGCTAA 59.744 43.478 28.70 3.44 37.85 3.09
432 433 4.082026 GGCAACCTTGATCAACTTGCTAAT 60.082 41.667 28.70 4.04 37.85 1.73
433 434 5.098211 GCAACCTTGATCAACTTGCTAATC 58.902 41.667 25.65 8.37 35.41 1.75
434 435 5.644644 CAACCTTGATCAACTTGCTAATCC 58.355 41.667 3.38 0.00 0.00 3.01
435 436 4.922206 ACCTTGATCAACTTGCTAATCCA 58.078 39.130 3.38 0.00 0.00 3.41
436 437 4.946157 ACCTTGATCAACTTGCTAATCCAG 59.054 41.667 3.38 0.00 0.00 3.86
437 438 5.188434 CCTTGATCAACTTGCTAATCCAGA 58.812 41.667 3.38 0.00 0.00 3.86
438 439 5.065731 CCTTGATCAACTTGCTAATCCAGAC 59.934 44.000 3.38 0.00 0.00 3.51
439 440 5.164620 TGATCAACTTGCTAATCCAGACA 57.835 39.130 0.00 0.00 0.00 3.41
440 441 5.559770 TGATCAACTTGCTAATCCAGACAA 58.440 37.500 0.00 0.00 0.00 3.18
441 442 6.003326 TGATCAACTTGCTAATCCAGACAAA 58.997 36.000 0.00 0.00 0.00 2.83
442 443 6.489700 TGATCAACTTGCTAATCCAGACAAAA 59.510 34.615 0.00 0.00 0.00 2.44
443 444 6.899393 TCAACTTGCTAATCCAGACAAAAT 57.101 33.333 0.00 0.00 0.00 1.82
444 445 7.994425 TCAACTTGCTAATCCAGACAAAATA 57.006 32.000 0.00 0.00 0.00 1.40
445 446 8.044060 TCAACTTGCTAATCCAGACAAAATAG 57.956 34.615 0.00 0.00 0.00 1.73
446 447 7.882791 TCAACTTGCTAATCCAGACAAAATAGA 59.117 33.333 0.00 0.00 0.00 1.98
447 448 7.617041 ACTTGCTAATCCAGACAAAATAGAC 57.383 36.000 0.00 0.00 0.00 2.59
448 449 7.398024 ACTTGCTAATCCAGACAAAATAGACT 58.602 34.615 0.00 0.00 0.00 3.24
449 450 7.885399 ACTTGCTAATCCAGACAAAATAGACTT 59.115 33.333 0.00 0.00 0.00 3.01
450 451 7.615582 TGCTAATCCAGACAAAATAGACTTG 57.384 36.000 0.00 0.00 0.00 3.16
451 452 6.599244 TGCTAATCCAGACAAAATAGACTTGG 59.401 38.462 0.00 0.00 0.00 3.61
452 453 6.038714 GCTAATCCAGACAAAATAGACTTGGG 59.961 42.308 0.00 0.00 0.00 4.12
453 454 3.686016 TCCAGACAAAATAGACTTGGGC 58.314 45.455 0.00 0.00 0.00 5.36
454 455 3.073798 TCCAGACAAAATAGACTTGGGCA 59.926 43.478 0.00 0.00 0.00 5.36
455 456 3.826157 CCAGACAAAATAGACTTGGGCAA 59.174 43.478 0.00 0.00 0.00 4.52
456 457 4.280677 CCAGACAAAATAGACTTGGGCAAA 59.719 41.667 0.00 0.00 0.00 3.68
457 458 5.222631 CAGACAAAATAGACTTGGGCAAAC 58.777 41.667 0.00 0.00 0.00 2.93
458 459 4.892934 AGACAAAATAGACTTGGGCAAACA 59.107 37.500 0.00 0.00 0.00 2.83
459 460 4.944048 ACAAAATAGACTTGGGCAAACAC 58.056 39.130 0.00 0.00 0.00 3.32
460 461 4.649218 ACAAAATAGACTTGGGCAAACACT 59.351 37.500 0.00 0.00 0.00 3.55
461 462 4.853924 AAATAGACTTGGGCAAACACTG 57.146 40.909 0.00 0.00 0.00 3.66
462 463 3.788227 ATAGACTTGGGCAAACACTGA 57.212 42.857 0.00 0.00 0.00 3.41
463 464 1.680338 AGACTTGGGCAAACACTGAC 58.320 50.000 0.00 0.00 0.00 3.51
464 465 1.212935 AGACTTGGGCAAACACTGACT 59.787 47.619 0.00 0.00 31.36 3.41
465 466 1.604278 GACTTGGGCAAACACTGACTC 59.396 52.381 0.00 0.00 31.36 3.36
466 467 1.064758 ACTTGGGCAAACACTGACTCA 60.065 47.619 0.00 0.00 31.36 3.41
467 468 2.233271 CTTGGGCAAACACTGACTCAT 58.767 47.619 0.00 0.00 31.36 2.90
468 469 1.608055 TGGGCAAACACTGACTCATG 58.392 50.000 0.00 0.00 31.36 3.07
469 470 1.142667 TGGGCAAACACTGACTCATGA 59.857 47.619 0.00 0.00 31.36 3.07
470 471 2.224843 TGGGCAAACACTGACTCATGAT 60.225 45.455 0.00 0.00 31.36 2.45
471 472 2.821969 GGGCAAACACTGACTCATGATT 59.178 45.455 0.00 0.00 31.36 2.57
472 473 4.009675 GGGCAAACACTGACTCATGATTA 58.990 43.478 0.00 0.00 31.36 1.75
473 474 4.641989 GGGCAAACACTGACTCATGATTAT 59.358 41.667 0.00 0.00 31.36 1.28
474 475 5.449588 GGGCAAACACTGACTCATGATTATG 60.450 44.000 0.00 0.00 31.36 1.90
475 476 5.032863 GCAAACACTGACTCATGATTATGC 58.967 41.667 0.00 0.00 34.21 3.14
476 477 5.163683 GCAAACACTGACTCATGATTATGCT 60.164 40.000 0.00 0.00 34.21 3.79
477 478 6.037500 GCAAACACTGACTCATGATTATGCTA 59.962 38.462 0.00 0.00 34.21 3.49
478 479 7.414429 GCAAACACTGACTCATGATTATGCTAA 60.414 37.037 0.00 0.00 34.21 3.09
479 480 7.545362 AACACTGACTCATGATTATGCTAAC 57.455 36.000 0.00 0.00 34.21 2.34
480 481 6.643388 ACACTGACTCATGATTATGCTAACA 58.357 36.000 0.00 0.00 34.21 2.41
481 482 6.760298 ACACTGACTCATGATTATGCTAACAG 59.240 38.462 0.00 0.00 34.21 3.16
482 483 5.757320 ACTGACTCATGATTATGCTAACAGC 59.243 40.000 0.00 0.00 42.82 4.40
493 494 1.551145 GCTAACAGCAGCTACGAGAC 58.449 55.000 0.00 0.00 41.89 3.36
494 495 1.133407 GCTAACAGCAGCTACGAGACT 59.867 52.381 0.00 0.00 41.89 3.24
495 496 2.355132 GCTAACAGCAGCTACGAGACTA 59.645 50.000 0.00 0.00 41.89 2.59
496 497 2.923605 AACAGCAGCTACGAGACTAC 57.076 50.000 0.00 0.00 0.00 2.73
497 498 0.727970 ACAGCAGCTACGAGACTACG 59.272 55.000 0.00 0.00 39.31 3.51
498 499 0.028242 CAGCAGCTACGAGACTACGG 59.972 60.000 0.00 0.00 37.61 4.02
499 500 1.298488 GCAGCTACGAGACTACGGC 60.298 63.158 0.00 0.00 37.61 5.68
500 501 1.716826 GCAGCTACGAGACTACGGCT 61.717 60.000 0.00 0.00 37.61 5.52
501 502 0.305313 CAGCTACGAGACTACGGCTC 59.695 60.000 0.00 0.00 37.61 4.70
502 503 0.178533 AGCTACGAGACTACGGCTCT 59.821 55.000 0.00 0.00 37.61 4.09
503 504 0.582960 GCTACGAGACTACGGCTCTC 59.417 60.000 0.00 0.00 37.61 3.20
504 505 1.937278 CTACGAGACTACGGCTCTCA 58.063 55.000 0.00 0.00 34.85 3.27
505 506 2.485903 CTACGAGACTACGGCTCTCAT 58.514 52.381 0.00 0.00 34.85 2.90
506 507 1.018148 ACGAGACTACGGCTCTCATG 58.982 55.000 0.00 0.00 34.85 3.07
507 508 0.309302 CGAGACTACGGCTCTCATGG 59.691 60.000 0.00 0.00 34.85 3.66
508 509 0.031449 GAGACTACGGCTCTCATGGC 59.969 60.000 0.00 0.00 35.21 4.40
509 510 1.068250 GACTACGGCTCTCATGGCC 59.932 63.158 0.00 0.00 45.57 5.36
515 516 2.203181 GCTCTCATGGCCAGGAGC 60.203 66.667 36.75 32.53 43.07 4.70
526 527 2.979676 CAGGAGCCAGCACGCAAA 60.980 61.111 0.00 0.00 0.00 3.68
527 528 2.034687 AGGAGCCAGCACGCAAAT 59.965 55.556 0.00 0.00 0.00 2.32
528 529 2.180017 GGAGCCAGCACGCAAATG 59.820 61.111 0.00 0.00 0.00 2.32
529 530 2.334946 GGAGCCAGCACGCAAATGA 61.335 57.895 0.00 0.00 0.00 2.57
530 531 1.154150 GAGCCAGCACGCAAATGAC 60.154 57.895 0.00 0.00 0.00 3.06
531 532 1.580845 GAGCCAGCACGCAAATGACT 61.581 55.000 0.00 0.00 0.00 3.41
532 533 1.154150 GCCAGCACGCAAATGACTC 60.154 57.895 0.00 0.00 0.00 3.36
533 534 1.133253 CCAGCACGCAAATGACTCG 59.867 57.895 0.00 0.00 0.00 4.18
534 535 1.568612 CCAGCACGCAAATGACTCGT 61.569 55.000 0.00 0.00 36.84 4.18
535 536 1.067693 CAGCACGCAAATGACTCGTA 58.932 50.000 0.00 0.00 34.81 3.43
536 537 1.459209 CAGCACGCAAATGACTCGTAA 59.541 47.619 0.00 0.00 34.81 3.18
537 538 1.459592 AGCACGCAAATGACTCGTAAC 59.540 47.619 0.00 0.00 34.81 2.50
538 539 1.463528 GCACGCAAATGACTCGTAACC 60.464 52.381 0.00 0.00 34.81 2.85
539 540 1.065358 ACGCAAATGACTCGTAACCG 58.935 50.000 0.00 0.00 34.41 4.44
540 541 1.065358 CGCAAATGACTCGTAACCGT 58.935 50.000 0.00 0.00 35.01 4.83
541 542 1.058695 CGCAAATGACTCGTAACCGTC 59.941 52.381 0.00 0.00 35.01 4.79
542 543 1.392510 GCAAATGACTCGTAACCGTCC 59.607 52.381 0.00 0.00 35.01 4.79
543 544 2.679450 CAAATGACTCGTAACCGTCCA 58.321 47.619 0.00 0.00 35.01 4.02
544 545 3.259064 CAAATGACTCGTAACCGTCCAT 58.741 45.455 0.00 0.00 35.01 3.41
545 546 2.579207 ATGACTCGTAACCGTCCATG 57.421 50.000 0.00 0.00 35.01 3.66
546 547 0.108992 TGACTCGTAACCGTCCATGC 60.109 55.000 0.00 0.00 35.01 4.06
547 548 0.172803 GACTCGTAACCGTCCATGCT 59.827 55.000 0.00 0.00 35.01 3.79
548 549 0.108804 ACTCGTAACCGTCCATGCTG 60.109 55.000 0.00 0.00 35.01 4.41
549 550 0.108804 CTCGTAACCGTCCATGCTGT 60.109 55.000 0.00 0.00 35.01 4.40
550 551 0.108992 TCGTAACCGTCCATGCTGTC 60.109 55.000 0.00 0.00 35.01 3.51
551 552 0.108804 CGTAACCGTCCATGCTGTCT 60.109 55.000 0.00 0.00 0.00 3.41
552 553 1.359848 GTAACCGTCCATGCTGTCTG 58.640 55.000 0.00 0.00 0.00 3.51
553 554 0.391130 TAACCGTCCATGCTGTCTGC 60.391 55.000 0.00 0.00 43.25 4.26
554 555 2.821366 CCGTCCATGCTGTCTGCC 60.821 66.667 0.00 0.00 42.00 4.85
555 556 2.821366 CGTCCATGCTGTCTGCCC 60.821 66.667 0.00 0.00 42.00 5.36
556 557 2.352422 GTCCATGCTGTCTGCCCA 59.648 61.111 0.00 0.00 42.00 5.36
557 558 1.748122 GTCCATGCTGTCTGCCCAG 60.748 63.158 0.00 0.00 42.00 4.45
558 559 2.439701 CCATGCTGTCTGCCCAGG 60.440 66.667 0.00 0.00 42.00 4.45
559 560 2.353958 CATGCTGTCTGCCCAGGT 59.646 61.111 0.00 0.00 42.00 4.00
560 561 1.748122 CATGCTGTCTGCCCAGGTC 60.748 63.158 0.00 0.00 42.00 3.85
561 562 3.320879 ATGCTGTCTGCCCAGGTCG 62.321 63.158 0.00 0.00 42.00 4.79
562 563 4.767255 GCTGTCTGCCCAGGTCGG 62.767 72.222 0.00 0.00 35.15 4.79
571 572 3.687102 CCAGGTCGGGTACACGCA 61.687 66.667 14.02 0.00 0.00 5.24
572 573 2.431942 CAGGTCGGGTACACGCAC 60.432 66.667 14.02 11.82 0.00 5.34
573 574 4.047059 AGGTCGGGTACACGCACG 62.047 66.667 14.02 0.00 0.00 5.34
575 576 4.347453 GTCGGGTACACGCACGGT 62.347 66.667 14.02 0.00 0.00 4.83
583 584 2.126228 CACGCACGGTGTCGGTAT 60.126 61.111 22.14 5.67 41.89 2.73
584 585 2.126228 ACGCACGGTGTCGGTATG 60.126 61.111 22.14 4.41 41.39 2.39
585 586 2.126228 CGCACGGTGTCGGTATGT 60.126 61.111 10.24 0.00 41.39 2.29
586 587 1.735198 CGCACGGTGTCGGTATGTT 60.735 57.895 10.24 0.00 41.39 2.71
587 588 1.286354 CGCACGGTGTCGGTATGTTT 61.286 55.000 10.24 0.00 41.39 2.83
588 589 0.165079 GCACGGTGTCGGTATGTTTG 59.835 55.000 10.24 0.00 41.39 2.93
589 590 0.793861 CACGGTGTCGGTATGTTTGG 59.206 55.000 0.00 0.00 41.39 3.28
590 591 0.393820 ACGGTGTCGGTATGTTTGGT 59.606 50.000 0.00 0.00 41.39 3.67
591 592 0.793861 CGGTGTCGGTATGTTTGGTG 59.206 55.000 0.00 0.00 0.00 4.17
592 593 0.519961 GGTGTCGGTATGTTTGGTGC 59.480 55.000 0.00 0.00 0.00 5.01
593 594 1.231221 GTGTCGGTATGTTTGGTGCA 58.769 50.000 0.00 0.00 0.00 4.57
594 595 1.069500 GTGTCGGTATGTTTGGTGCAC 60.069 52.381 8.80 8.80 0.00 4.57
595 596 1.231221 GTCGGTATGTTTGGTGCACA 58.769 50.000 20.43 1.62 0.00 4.57
596 597 1.810151 GTCGGTATGTTTGGTGCACAT 59.190 47.619 20.43 5.53 38.45 3.21
597 598 1.809547 TCGGTATGTTTGGTGCACATG 59.190 47.619 20.43 0.00 35.57 3.21
598 599 1.135431 CGGTATGTTTGGTGCACATGG 60.135 52.381 20.43 0.00 35.57 3.66
599 600 1.892474 GGTATGTTTGGTGCACATGGT 59.108 47.619 20.43 1.59 35.57 3.55
600 601 2.352617 GGTATGTTTGGTGCACATGGTG 60.353 50.000 20.43 0.00 35.57 4.17
601 602 0.680618 ATGTTTGGTGCACATGGTGG 59.319 50.000 20.43 0.00 33.42 4.61
602 603 1.300853 GTTTGGTGCACATGGTGGC 60.301 57.895 20.43 0.00 33.64 5.01
603 604 1.759692 TTTGGTGCACATGGTGGCA 60.760 52.632 20.43 2.01 37.77 4.92
607 608 2.669229 TGCACATGGTGGCACGAG 60.669 61.111 12.17 6.30 34.58 4.18
608 609 3.434319 GCACATGGTGGCACGAGG 61.434 66.667 12.74 12.74 33.64 4.63
609 610 2.032528 CACATGGTGGCACGAGGT 59.967 61.111 14.17 14.17 0.00 3.85
610 611 2.034879 CACATGGTGGCACGAGGTC 61.035 63.158 16.92 0.19 0.00 3.85
611 612 2.347114 CATGGTGGCACGAGGTCA 59.653 61.111 12.17 3.61 0.00 4.02
612 613 1.302431 CATGGTGGCACGAGGTCAA 60.302 57.895 12.17 0.00 29.11 3.18
613 614 0.677731 CATGGTGGCACGAGGTCAAT 60.678 55.000 12.17 0.00 29.11 2.57
614 615 0.677731 ATGGTGGCACGAGGTCAATG 60.678 55.000 12.17 0.00 29.11 2.82
615 616 2.040544 GGTGGCACGAGGTCAATGG 61.041 63.158 12.17 0.00 29.11 3.16
616 617 1.302511 GTGGCACGAGGTCAATGGT 60.303 57.895 0.00 0.00 29.11 3.55
617 618 1.302431 TGGCACGAGGTCAATGGTG 60.302 57.895 0.00 0.00 32.61 4.17
618 619 2.040544 GGCACGAGGTCAATGGTGG 61.041 63.158 0.00 0.00 30.39 4.61
619 620 2.690778 GCACGAGGTCAATGGTGGC 61.691 63.158 0.00 0.00 30.39 5.01
620 621 1.302431 CACGAGGTCAATGGTGGCA 60.302 57.895 0.00 0.00 0.00 4.92
621 622 1.302511 ACGAGGTCAATGGTGGCAC 60.303 57.895 9.70 9.70 0.00 5.01
622 623 2.390599 CGAGGTCAATGGTGGCACG 61.391 63.158 12.17 0.00 0.00 5.34
623 624 2.034066 AGGTCAATGGTGGCACGG 59.966 61.111 12.17 1.19 0.00 4.94
624 625 2.282180 GGTCAATGGTGGCACGGT 60.282 61.111 12.17 0.00 0.00 4.83
625 626 2.625823 GGTCAATGGTGGCACGGTG 61.626 63.158 12.17 9.34 0.00 4.94
626 627 2.282110 TCAATGGTGGCACGGTGG 60.282 61.111 12.17 0.00 0.00 4.61
627 628 4.054825 CAATGGTGGCACGGTGGC 62.055 66.667 25.93 25.93 44.03 5.01
635 636 4.794648 GCACGGTGGCAGCCCATA 62.795 66.667 9.64 0.00 44.51 2.74
636 637 2.824041 CACGGTGGCAGCCCATAC 60.824 66.667 9.64 0.00 44.51 2.39
637 638 4.467084 ACGGTGGCAGCCCATACG 62.467 66.667 9.64 10.65 44.51 3.06
639 640 3.792736 GGTGGCAGCCCATACGGA 61.793 66.667 9.64 0.00 44.51 4.69
640 641 2.203070 GTGGCAGCCCATACGGAG 60.203 66.667 9.64 0.00 44.51 4.63
641 642 4.175337 TGGCAGCCCATACGGAGC 62.175 66.667 9.64 0.00 35.79 4.70
642 643 4.175337 GGCAGCCCATACGGAGCA 62.175 66.667 0.00 0.00 36.26 4.26
643 644 2.897350 GCAGCCCATACGGAGCAC 60.897 66.667 0.00 0.00 35.05 4.40
649 650 2.890474 CATACGGAGCACGGTGCC 60.890 66.667 28.14 19.07 46.52 5.01
650 651 3.387091 ATACGGAGCACGGTGCCA 61.387 61.111 28.14 10.04 46.52 4.92
651 652 2.949909 ATACGGAGCACGGTGCCAA 61.950 57.895 28.14 10.71 46.52 4.52
652 653 3.869473 TACGGAGCACGGTGCCAAC 62.869 63.158 28.14 19.06 46.52 3.77
665 666 4.680237 CCAACCACGCCGAGCTCA 62.680 66.667 15.40 0.00 0.00 4.26
666 667 3.414700 CAACCACGCCGAGCTCAC 61.415 66.667 15.40 3.93 0.00 3.51
667 668 4.681978 AACCACGCCGAGCTCACC 62.682 66.667 15.40 2.34 0.00 4.02
669 670 4.457496 CCACGCCGAGCTCACCAT 62.457 66.667 15.40 0.00 0.00 3.55
670 671 3.190849 CACGCCGAGCTCACCATG 61.191 66.667 15.40 2.54 0.00 3.66
671 672 3.381983 ACGCCGAGCTCACCATGA 61.382 61.111 15.40 0.00 0.00 3.07
672 673 2.107750 CGCCGAGCTCACCATGAT 59.892 61.111 15.40 0.00 0.00 2.45
673 674 2.242572 CGCCGAGCTCACCATGATG 61.243 63.158 15.40 0.00 0.00 3.07
674 675 2.541120 GCCGAGCTCACCATGATGC 61.541 63.158 15.40 0.00 0.00 3.91
675 676 1.153309 CCGAGCTCACCATGATGCA 60.153 57.895 15.40 0.00 0.00 3.96
676 677 1.434622 CCGAGCTCACCATGATGCAC 61.435 60.000 15.40 0.00 0.00 4.57
677 678 0.741927 CGAGCTCACCATGATGCACA 60.742 55.000 15.40 0.00 0.00 4.57
678 679 1.676746 GAGCTCACCATGATGCACAT 58.323 50.000 9.40 0.00 40.17 3.21
730 731 7.668525 AGTTAAATTAATCGATTCGGATCCC 57.331 36.000 15.25 0.00 0.00 3.85
731 732 7.221450 AGTTAAATTAATCGATTCGGATCCCA 58.779 34.615 15.25 0.00 0.00 4.37
732 733 7.883311 AGTTAAATTAATCGATTCGGATCCCAT 59.117 33.333 15.25 0.00 0.00 4.00
733 734 8.512138 GTTAAATTAATCGATTCGGATCCCATT 58.488 33.333 15.25 0.00 0.00 3.16
734 735 9.727859 TTAAATTAATCGATTCGGATCCCATTA 57.272 29.630 15.25 0.00 0.00 1.90
735 736 8.630054 AAATTAATCGATTCGGATCCCATTAA 57.370 30.769 15.25 13.95 32.98 1.40
736 737 8.630054 AATTAATCGATTCGGATCCCATTAAA 57.370 30.769 15.25 0.00 32.60 1.52
737 738 8.630054 ATTAATCGATTCGGATCCCATTAAAA 57.370 30.769 15.25 0.00 32.60 1.52
738 739 6.952773 AATCGATTCGGATCCCATTAAAAA 57.047 33.333 4.39 0.00 0.00 1.94
759 760 7.787725 AAAAATCTTTCTAAGCGATACGGAT 57.212 32.000 0.00 0.00 0.00 4.18
760 761 7.409465 AAAATCTTTCTAAGCGATACGGATC 57.591 36.000 0.00 0.00 0.00 3.36
761 762 5.707242 ATCTTTCTAAGCGATACGGATCA 57.293 39.130 8.69 0.00 31.78 2.92
762 763 5.109662 TCTTTCTAAGCGATACGGATCAG 57.890 43.478 8.69 1.74 31.78 2.90
763 764 4.579340 TCTTTCTAAGCGATACGGATCAGT 59.421 41.667 8.69 3.43 31.78 3.41
764 765 3.898517 TCTAAGCGATACGGATCAGTG 57.101 47.619 8.69 0.00 31.78 3.66
765 766 2.031069 TCTAAGCGATACGGATCAGTGC 60.031 50.000 8.69 3.00 31.78 4.40
766 767 0.747255 AAGCGATACGGATCAGTGCT 59.253 50.000 8.69 5.54 30.30 4.40
767 768 1.605753 AGCGATACGGATCAGTGCTA 58.394 50.000 8.69 0.00 28.11 3.49
768 769 1.537638 AGCGATACGGATCAGTGCTAG 59.462 52.381 8.69 0.00 28.11 3.42
769 770 1.970447 CGATACGGATCAGTGCTAGC 58.030 55.000 8.10 8.10 31.78 3.42
770 771 1.401670 CGATACGGATCAGTGCTAGCC 60.402 57.143 13.29 3.49 31.78 3.93
771 772 1.613925 GATACGGATCAGTGCTAGCCA 59.386 52.381 13.29 0.00 31.78 4.75
772 773 1.032794 TACGGATCAGTGCTAGCCAG 58.967 55.000 13.29 1.77 0.00 4.85
785 786 4.864704 GCTAGCCAGCTAGTTTCTCTAT 57.135 45.455 23.81 0.00 45.67 1.98
786 787 5.208463 GCTAGCCAGCTAGTTTCTCTATT 57.792 43.478 23.81 0.00 45.67 1.73
787 788 5.606505 GCTAGCCAGCTAGTTTCTCTATTT 58.393 41.667 23.81 0.00 45.67 1.40
788 789 6.052360 GCTAGCCAGCTAGTTTCTCTATTTT 58.948 40.000 23.81 0.00 45.67 1.82
789 790 6.540551 GCTAGCCAGCTAGTTTCTCTATTTTT 59.459 38.462 23.81 0.00 45.67 1.94
804 805 4.898607 TTTTTGCGAGCTGGAGGT 57.101 50.000 0.00 0.00 0.00 3.85
805 806 2.330254 TTTTTGCGAGCTGGAGGTG 58.670 52.632 0.00 0.00 0.00 4.00
806 807 1.172180 TTTTTGCGAGCTGGAGGTGG 61.172 55.000 0.00 0.00 0.00 4.61
807 808 2.050836 TTTTGCGAGCTGGAGGTGGA 62.051 55.000 0.00 0.00 0.00 4.02
808 809 1.841302 TTTGCGAGCTGGAGGTGGAT 61.841 55.000 0.00 0.00 0.00 3.41
809 810 1.841302 TTGCGAGCTGGAGGTGGATT 61.841 55.000 0.00 0.00 0.00 3.01
810 811 0.975556 TGCGAGCTGGAGGTGGATTA 60.976 55.000 0.00 0.00 0.00 1.75
811 812 0.178068 GCGAGCTGGAGGTGGATTAA 59.822 55.000 0.00 0.00 0.00 1.40
812 813 1.202698 GCGAGCTGGAGGTGGATTAAT 60.203 52.381 0.00 0.00 0.00 1.40
813 814 2.037251 GCGAGCTGGAGGTGGATTAATA 59.963 50.000 0.00 0.00 0.00 0.98
814 815 3.862642 GCGAGCTGGAGGTGGATTAATAG 60.863 52.174 0.00 0.00 0.00 1.73
815 816 3.669536 GAGCTGGAGGTGGATTAATAGC 58.330 50.000 0.00 0.00 0.00 2.97
816 817 3.321950 AGCTGGAGGTGGATTAATAGCT 58.678 45.455 0.00 0.00 35.61 3.32
817 818 4.493618 AGCTGGAGGTGGATTAATAGCTA 58.506 43.478 0.00 0.00 38.38 3.32
818 819 4.284746 AGCTGGAGGTGGATTAATAGCTAC 59.715 45.833 0.00 0.00 38.38 3.58
819 820 4.284746 GCTGGAGGTGGATTAATAGCTACT 59.715 45.833 0.00 0.00 0.00 2.57
820 821 5.567823 GCTGGAGGTGGATTAATAGCTACTC 60.568 48.000 0.00 0.00 0.00 2.59
821 822 4.838986 TGGAGGTGGATTAATAGCTACTCC 59.161 45.833 12.18 12.18 31.35 3.85
822 823 4.223255 GGAGGTGGATTAATAGCTACTCCC 59.777 50.000 9.16 2.45 29.90 4.30
823 824 5.088026 GAGGTGGATTAATAGCTACTCCCT 58.912 45.833 0.00 0.00 29.90 4.20
824 825 5.088026 AGGTGGATTAATAGCTACTCCCTC 58.912 45.833 0.00 0.00 29.90 4.30
825 826 4.223255 GGTGGATTAATAGCTACTCCCTCC 59.777 50.000 0.00 0.00 29.90 4.30
826 827 4.082136 GTGGATTAATAGCTACTCCCTCCG 60.082 50.000 0.00 0.00 29.90 4.63
827 828 4.087907 GGATTAATAGCTACTCCCTCCGT 58.912 47.826 0.00 0.00 0.00 4.69
828 829 4.527427 GGATTAATAGCTACTCCCTCCGTT 59.473 45.833 0.00 0.00 0.00 4.44
829 830 5.336610 GGATTAATAGCTACTCCCTCCGTTC 60.337 48.000 0.00 0.00 0.00 3.95
830 831 1.998222 ATAGCTACTCCCTCCGTTCC 58.002 55.000 0.00 0.00 0.00 3.62
831 832 0.627451 TAGCTACTCCCTCCGTTCCA 59.373 55.000 0.00 0.00 0.00 3.53
832 833 0.252103 AGCTACTCCCTCCGTTCCAA 60.252 55.000 0.00 0.00 0.00 3.53
833 834 0.611714 GCTACTCCCTCCGTTCCAAA 59.388 55.000 0.00 0.00 0.00 3.28
834 835 1.209747 GCTACTCCCTCCGTTCCAAAT 59.790 52.381 0.00 0.00 0.00 2.32
835 836 2.355818 GCTACTCCCTCCGTTCCAAATT 60.356 50.000 0.00 0.00 0.00 1.82
836 837 3.118519 GCTACTCCCTCCGTTCCAAATTA 60.119 47.826 0.00 0.00 0.00 1.40
837 838 3.345508 ACTCCCTCCGTTCCAAATTAC 57.654 47.619 0.00 0.00 0.00 1.89
838 839 2.910977 ACTCCCTCCGTTCCAAATTACT 59.089 45.455 0.00 0.00 0.00 2.24
839 840 3.055312 ACTCCCTCCGTTCCAAATTACTC 60.055 47.826 0.00 0.00 0.00 2.59
840 841 2.093869 TCCCTCCGTTCCAAATTACTCG 60.094 50.000 0.00 0.00 0.00 4.18
841 842 2.354403 CCCTCCGTTCCAAATTACTCGT 60.354 50.000 0.00 0.00 0.00 4.18
842 843 3.119029 CCCTCCGTTCCAAATTACTCGTA 60.119 47.826 0.00 0.00 0.00 3.43
843 844 4.110482 CCTCCGTTCCAAATTACTCGTAG 58.890 47.826 0.00 0.00 0.00 3.51
844 845 3.514645 TCCGTTCCAAATTACTCGTAGC 58.485 45.455 0.00 0.00 0.00 3.58
845 846 3.056678 TCCGTTCCAAATTACTCGTAGCA 60.057 43.478 0.00 0.00 0.00 3.49
846 847 3.306166 CCGTTCCAAATTACTCGTAGCAG 59.694 47.826 0.00 0.00 0.00 4.24
847 848 4.171005 CGTTCCAAATTACTCGTAGCAGA 58.829 43.478 0.00 0.00 0.00 4.26
848 849 4.624024 CGTTCCAAATTACTCGTAGCAGAA 59.376 41.667 0.00 0.00 0.00 3.02
849 850 5.119588 CGTTCCAAATTACTCGTAGCAGAAA 59.880 40.000 0.00 0.00 0.00 2.52
850 851 6.183360 CGTTCCAAATTACTCGTAGCAGAAAT 60.183 38.462 0.00 0.00 0.00 2.17
851 852 6.662414 TCCAAATTACTCGTAGCAGAAATG 57.338 37.500 0.00 0.00 0.00 2.32
852 853 5.584649 TCCAAATTACTCGTAGCAGAAATGG 59.415 40.000 0.00 0.00 0.00 3.16
853 854 5.584649 CCAAATTACTCGTAGCAGAAATGGA 59.415 40.000 0.00 0.00 0.00 3.41
854 855 6.260936 CCAAATTACTCGTAGCAGAAATGGAT 59.739 38.462 0.00 0.00 0.00 3.41
855 856 6.851222 AATTACTCGTAGCAGAAATGGATG 57.149 37.500 0.00 0.00 0.00 3.51
856 857 3.895232 ACTCGTAGCAGAAATGGATGT 57.105 42.857 0.00 0.00 0.00 3.06
857 858 6.459670 TTACTCGTAGCAGAAATGGATGTA 57.540 37.500 0.00 0.00 0.00 2.29
858 859 5.537300 ACTCGTAGCAGAAATGGATGTAT 57.463 39.130 0.00 0.00 0.00 2.29
859 860 5.533482 ACTCGTAGCAGAAATGGATGTATC 58.467 41.667 0.00 0.00 0.00 2.24
860 861 5.303078 ACTCGTAGCAGAAATGGATGTATCT 59.697 40.000 0.00 0.00 0.00 1.98
861 862 6.490381 ACTCGTAGCAGAAATGGATGTATCTA 59.510 38.462 0.00 0.00 0.00 1.98
862 863 6.914259 TCGTAGCAGAAATGGATGTATCTAG 58.086 40.000 0.00 0.00 0.00 2.43
863 864 6.715264 TCGTAGCAGAAATGGATGTATCTAGA 59.285 38.462 0.00 0.00 0.00 2.43
864 865 7.230712 TCGTAGCAGAAATGGATGTATCTAGAA 59.769 37.037 0.00 0.00 0.00 2.10
865 866 7.327275 CGTAGCAGAAATGGATGTATCTAGAAC 59.673 40.741 0.00 0.00 0.00 3.01
866 867 7.372260 AGCAGAAATGGATGTATCTAGAACT 57.628 36.000 0.00 0.00 0.00 3.01
867 868 8.484214 AGCAGAAATGGATGTATCTAGAACTA 57.516 34.615 0.00 0.00 0.00 2.24
868 869 8.928448 AGCAGAAATGGATGTATCTAGAACTAA 58.072 33.333 0.00 0.00 0.00 2.24
869 870 9.547753 GCAGAAATGGATGTATCTAGAACTAAA 57.452 33.333 0.00 0.00 0.00 1.85
896 897 7.544804 ACATCTAGATACATCCATACTTGCA 57.455 36.000 4.54 0.00 0.00 4.08
897 898 7.966812 ACATCTAGATACATCCATACTTGCAA 58.033 34.615 4.54 0.00 0.00 4.08
898 899 8.600668 ACATCTAGATACATCCATACTTGCAAT 58.399 33.333 4.54 0.00 0.00 3.56
901 902 9.929180 TCTAGATACATCCATACTTGCAATAAC 57.071 33.333 0.00 0.00 0.00 1.89
902 903 9.935241 CTAGATACATCCATACTTGCAATAACT 57.065 33.333 0.00 0.00 0.00 2.24
909 910 9.467258 CATCCATACTTGCAATAACTAATTTGG 57.533 33.333 0.00 0.00 0.00 3.28
910 911 8.815565 TCCATACTTGCAATAACTAATTTGGA 57.184 30.769 0.00 0.49 0.00 3.53
911 912 9.249053 TCCATACTTGCAATAACTAATTTGGAA 57.751 29.630 0.00 0.00 26.88 3.53
912 913 9.301153 CCATACTTGCAATAACTAATTTGGAAC 57.699 33.333 0.00 0.00 0.00 3.62
913 914 9.009327 CATACTTGCAATAACTAATTTGGAACG 57.991 33.333 0.00 0.00 0.00 3.95
914 915 6.386654 ACTTGCAATAACTAATTTGGAACGG 58.613 36.000 0.00 0.00 0.00 4.44
915 916 6.207810 ACTTGCAATAACTAATTTGGAACGGA 59.792 34.615 0.00 0.00 0.00 4.69
916 917 6.189677 TGCAATAACTAATTTGGAACGGAG 57.810 37.500 0.00 0.00 0.00 4.63
917 918 5.124776 TGCAATAACTAATTTGGAACGGAGG 59.875 40.000 0.00 0.00 0.00 4.30
918 919 5.449999 GCAATAACTAATTTGGAACGGAGGG 60.450 44.000 0.00 0.00 0.00 4.30
919 920 5.703730 ATAACTAATTTGGAACGGAGGGA 57.296 39.130 0.00 0.00 0.00 4.20
920 921 4.376225 AACTAATTTGGAACGGAGGGAA 57.624 40.909 0.00 0.00 0.00 3.97
924 925 4.586306 AATTTGGAACGGAGGGAATAGT 57.414 40.909 0.00 0.00 0.00 2.12
931 932 4.022155 GGAACGGAGGGAATAGTTAGCTAG 60.022 50.000 0.00 0.00 0.00 3.42
938 939 3.715315 GGGAATAGTTAGCTAGGGTGGTT 59.285 47.826 0.00 0.00 0.00 3.67
943 944 3.100671 AGTTAGCTAGGGTGGTTCTCAG 58.899 50.000 0.00 0.00 0.00 3.35
1004 1005 8.040002 TCAATCATATGGGAATGTACCAGTTA 57.960 34.615 2.13 0.00 42.15 2.24
1006 1007 9.130661 CAATCATATGGGAATGTACCAGTTAAA 57.869 33.333 2.13 0.00 42.15 1.52
1016 1017 7.308951 GGAATGTACCAGTTAAAAAGCAGCTAA 60.309 37.037 0.00 0.00 0.00 3.09
1052 1057 5.105064 CCATCCATTGCATCTTTTCTTCCTT 60.105 40.000 0.00 0.00 0.00 3.36
1103 1108 5.892119 ACATTCATCAATGGCTTCATCTCTT 59.108 36.000 0.00 0.00 43.47 2.85
1108 1113 4.202441 TCAATGGCTTCATCTCTTAAGGC 58.798 43.478 1.85 0.00 45.68 4.35
1149 1154 0.037326 TGTCATGCTCGTCCTGAACC 60.037 55.000 0.00 0.00 0.00 3.62
1193 1198 3.822735 CAGAATGTGACAATTGTCTGGGT 59.177 43.478 32.57 18.88 44.99 4.51
1203 1208 4.037923 ACAATTGTCTGGGTGATTGTGTTC 59.962 41.667 4.92 0.00 40.21 3.18
1212 1217 2.327568 GTGATTGTGTTCCCATTTGCG 58.672 47.619 0.00 0.00 0.00 4.85
1219 1224 1.602323 TTCCCATTTGCGTCGCCTT 60.602 52.632 15.88 0.00 0.00 4.35
1263 1268 0.253044 ATGCAACGCTACACCTCCAT 59.747 50.000 0.00 0.00 0.00 3.41
1349 1354 2.457598 TGTACCCTCTTCTGCTAGGTG 58.542 52.381 0.00 0.00 31.89 4.00
1404 1412 1.195448 CTGCGTGTGTGAATGTTCCTC 59.805 52.381 0.00 0.00 0.00 3.71
1407 1415 0.517316 GTGTGTGAATGTTCCTCCGC 59.483 55.000 0.00 0.00 0.00 5.54
1430 1449 5.564848 GCTTTGTTCTTTGTTGATACCTCCC 60.565 44.000 0.00 0.00 0.00 4.30
1435 1454 0.108520 TTGTTGATACCTCCCGCGTC 60.109 55.000 4.92 0.00 0.00 5.19
1440 1459 0.459063 GATACCTCCCGCGTCGTTTT 60.459 55.000 4.92 0.00 0.00 2.43
1450 1470 0.981956 GCGTCGTTTTTAAGCCATGC 59.018 50.000 0.00 0.00 0.00 4.06
1507 1532 3.761218 TGTGGGTACTATGGCAAATGTTG 59.239 43.478 0.00 0.00 0.00 3.33
1590 1759 3.181491 GGTGTGTGCTTTGTGCTTCTTTA 60.181 43.478 0.00 0.00 43.37 1.85
1596 1765 6.306356 GTGTGCTTTGTGCTTCTTTATACATG 59.694 38.462 0.00 0.00 43.37 3.21
1602 1771 6.122850 TGTGCTTCTTTATACATGTCATGC 57.877 37.500 12.91 0.00 0.00 4.06
1610 1784 0.610687 TACATGTCATGCGTCCACCA 59.389 50.000 12.91 0.00 0.00 4.17
1612 1786 1.209261 ACATGTCATGCGTCCACCATA 59.791 47.619 12.91 0.00 0.00 2.74
1670 1875 2.380084 TGATTTCACTCACGGTAGGC 57.620 50.000 0.00 0.00 0.00 3.93
1690 1895 0.459585 TTTGACATCTCTACGGCGGC 60.460 55.000 13.24 0.00 0.00 6.53
1696 1901 2.061182 ATCTCTACGGCGGCGAGTTC 62.061 60.000 38.93 0.00 0.00 3.01
1698 1903 3.823330 CTACGGCGGCGAGTTCCT 61.823 66.667 38.93 17.07 0.00 3.36
1723 1928 4.021925 AGGACGAGCTTGGGTGGC 62.022 66.667 5.79 0.00 0.00 5.01
1740 1945 0.250338 GGCGGGGTTGTAGGATGATC 60.250 60.000 0.00 0.00 0.00 2.92
1741 1946 0.250338 GCGGGGTTGTAGGATGATCC 60.250 60.000 2.46 2.46 36.58 3.36
1743 1948 1.070758 CGGGGTTGTAGGATGATCCAG 59.929 57.143 14.90 0.00 39.61 3.86
1749 1954 1.459348 TAGGATGATCCAGGCGGCA 60.459 57.895 14.90 0.00 39.61 5.69
1814 2041 2.115427 TGCTTAGGGGATCATTGACGA 58.885 47.619 0.00 0.00 0.00 4.20
1817 2044 3.181465 GCTTAGGGGATCATTGACGAAGA 60.181 47.826 0.00 0.00 0.00 2.87
1849 2076 4.767255 GGTGCAGAGTGGGCCTCG 62.767 72.222 4.53 0.00 45.44 4.63
1877 2104 1.111116 AACTGGACGTGGGTTCGAGA 61.111 55.000 0.00 0.00 34.70 4.04
1901 2128 5.066593 GCCTAGCTAATGGAAATTGCTAGT 58.933 41.667 15.93 0.00 46.75 2.57
1923 2150 5.699458 AGTATATGCCCTTAACGTGTAATGC 59.301 40.000 0.00 0.00 0.00 3.56
1942 2169 2.381838 CTGTTGGTTGCTTTGGGGGC 62.382 60.000 0.00 0.00 0.00 5.80
2015 2244 0.038251 TACACTTCGCTGGACTGCTG 60.038 55.000 0.00 0.00 0.00 4.41
2017 2246 2.357881 CTTCGCTGGACTGCTGCA 60.358 61.111 0.88 0.88 0.00 4.41
2029 2259 0.180642 CTGCTGCAGATGGTGATCCT 59.819 55.000 24.88 0.00 32.44 3.24
2045 2275 5.714806 GGTGATCCTAAGGTCCAATTTGAAA 59.285 40.000 0.00 0.00 0.00 2.69
2050 2280 4.766891 CCTAAGGTCCAATTTGAAAGCTCA 59.233 41.667 0.00 0.00 0.00 4.26
2052 2282 2.893489 AGGTCCAATTTGAAAGCTCACC 59.107 45.455 0.00 0.00 0.00 4.02
2065 2295 1.819632 CTCACCAGCAATACCCGCC 60.820 63.158 0.00 0.00 0.00 6.13
2071 2301 0.179094 CAGCAATACCCGCCGTTAGA 60.179 55.000 0.00 0.00 0.00 2.10
2072 2302 0.756903 AGCAATACCCGCCGTTAGAT 59.243 50.000 0.00 0.00 0.00 1.98
2073 2303 1.140252 AGCAATACCCGCCGTTAGATT 59.860 47.619 0.00 0.00 0.00 2.40
2074 2304 2.366266 AGCAATACCCGCCGTTAGATTA 59.634 45.455 0.00 0.00 0.00 1.75
2075 2305 3.132925 GCAATACCCGCCGTTAGATTAA 58.867 45.455 0.00 0.00 0.00 1.40
2076 2306 3.185797 GCAATACCCGCCGTTAGATTAAG 59.814 47.826 0.00 0.00 0.00 1.85
2077 2307 2.514205 TACCCGCCGTTAGATTAAGC 57.486 50.000 0.00 0.00 0.00 3.09
2078 2308 0.538118 ACCCGCCGTTAGATTAAGCA 59.462 50.000 0.00 0.00 0.00 3.91
2079 2309 1.217882 CCCGCCGTTAGATTAAGCAG 58.782 55.000 0.00 0.00 0.00 4.24
2080 2310 1.202486 CCCGCCGTTAGATTAAGCAGA 60.202 52.381 0.00 0.00 0.00 4.26
2081 2311 2.548067 CCCGCCGTTAGATTAAGCAGAT 60.548 50.000 0.00 0.00 0.00 2.90
2082 2312 2.476619 CCGCCGTTAGATTAAGCAGATG 59.523 50.000 0.00 0.00 0.00 2.90
2083 2313 3.381045 CGCCGTTAGATTAAGCAGATGA 58.619 45.455 0.00 0.00 0.00 2.92
2084 2314 3.182572 CGCCGTTAGATTAAGCAGATGAC 59.817 47.826 0.00 0.00 0.00 3.06
2085 2315 3.495001 GCCGTTAGATTAAGCAGATGACC 59.505 47.826 0.00 0.00 0.00 4.02
2086 2316 4.693283 CCGTTAGATTAAGCAGATGACCA 58.307 43.478 0.00 0.00 0.00 4.02
2087 2317 5.116180 CCGTTAGATTAAGCAGATGACCAA 58.884 41.667 0.00 0.00 0.00 3.67
2088 2318 5.584649 CCGTTAGATTAAGCAGATGACCAAA 59.415 40.000 0.00 0.00 0.00 3.28
2089 2319 6.093495 CCGTTAGATTAAGCAGATGACCAAAA 59.907 38.462 0.00 0.00 0.00 2.44
2090 2320 7.201732 CCGTTAGATTAAGCAGATGACCAAAAT 60.202 37.037 0.00 0.00 0.00 1.82
2091 2321 7.641411 CGTTAGATTAAGCAGATGACCAAAATG 59.359 37.037 0.00 0.00 0.00 2.32
2092 2322 8.462016 GTTAGATTAAGCAGATGACCAAAATGT 58.538 33.333 0.00 0.00 0.00 2.71
2093 2323 7.472334 AGATTAAGCAGATGACCAAAATGTT 57.528 32.000 0.00 0.00 0.00 2.71
2094 2324 7.318141 AGATTAAGCAGATGACCAAAATGTTG 58.682 34.615 0.00 0.00 34.25 3.33
2095 2325 3.308438 AGCAGATGACCAAAATGTTGC 57.692 42.857 0.00 0.00 33.01 4.17
2096 2326 2.895404 AGCAGATGACCAAAATGTTGCT 59.105 40.909 0.00 0.00 35.96 3.91
2097 2327 3.322828 AGCAGATGACCAAAATGTTGCTT 59.677 39.130 0.00 0.00 37.36 3.91
2098 2328 4.060205 GCAGATGACCAAAATGTTGCTTT 58.940 39.130 0.00 0.00 33.01 3.51
2099 2329 4.151157 GCAGATGACCAAAATGTTGCTTTC 59.849 41.667 0.00 0.00 33.01 2.62
2100 2330 5.291178 CAGATGACCAAAATGTTGCTTTCA 58.709 37.500 0.00 0.00 33.01 2.69
2101 2331 5.404366 CAGATGACCAAAATGTTGCTTTCAG 59.596 40.000 0.00 0.00 33.01 3.02
2102 2332 4.057406 TGACCAAAATGTTGCTTTCAGG 57.943 40.909 0.00 0.00 33.01 3.86
2103 2333 2.802247 GACCAAAATGTTGCTTTCAGGC 59.198 45.455 0.00 0.00 33.01 4.85
2104 2334 2.435437 ACCAAAATGTTGCTTTCAGGCT 59.565 40.909 0.00 0.00 33.01 4.58
2105 2335 2.803956 CCAAAATGTTGCTTTCAGGCTG 59.196 45.455 8.58 8.58 33.01 4.85
2106 2336 2.159327 AAATGTTGCTTTCAGGCTGC 57.841 45.000 10.34 0.00 0.00 5.25
2107 2337 0.319405 AATGTTGCTTTCAGGCTGCC 59.681 50.000 11.65 11.65 0.00 4.85
2108 2338 1.538687 ATGTTGCTTTCAGGCTGCCC 61.539 55.000 16.57 0.00 0.00 5.36
2109 2339 2.601367 TTGCTTTCAGGCTGCCCC 60.601 61.111 16.57 0.00 0.00 5.80
2110 2340 3.449494 TTGCTTTCAGGCTGCCCCA 62.449 57.895 16.57 0.00 35.39 4.96
2111 2341 3.066814 GCTTTCAGGCTGCCCCAG 61.067 66.667 16.57 6.02 35.39 4.45
2112 2342 2.437897 CTTTCAGGCTGCCCCAGT 59.562 61.111 16.57 0.00 35.39 4.00
2113 2343 1.228675 CTTTCAGGCTGCCCCAGTT 60.229 57.895 16.57 0.00 35.39 3.16
2114 2344 0.038166 CTTTCAGGCTGCCCCAGTTA 59.962 55.000 16.57 0.00 35.39 2.24
2115 2345 0.480690 TTTCAGGCTGCCCCAGTTAA 59.519 50.000 16.57 0.00 35.39 2.01
2116 2346 0.704076 TTCAGGCTGCCCCAGTTAAT 59.296 50.000 16.57 0.00 35.39 1.40
2117 2347 1.590591 TCAGGCTGCCCCAGTTAATA 58.409 50.000 16.57 0.00 35.39 0.98
2118 2348 1.919654 TCAGGCTGCCCCAGTTAATAA 59.080 47.619 16.57 0.00 35.39 1.40
2119 2349 2.024414 CAGGCTGCCCCAGTTAATAAC 58.976 52.381 16.57 0.00 35.39 1.89
2120 2350 1.638589 AGGCTGCCCCAGTTAATAACA 59.361 47.619 16.57 0.00 35.39 2.41
2121 2351 2.244769 AGGCTGCCCCAGTTAATAACAT 59.755 45.455 16.57 0.00 35.39 2.71
2122 2352 3.031013 GGCTGCCCCAGTTAATAACATT 58.969 45.455 7.66 0.00 33.43 2.71
2123 2353 4.079443 AGGCTGCCCCAGTTAATAACATTA 60.079 41.667 16.57 0.00 35.39 1.90
2124 2354 4.647399 GGCTGCCCCAGTTAATAACATTAA 59.353 41.667 7.66 0.00 33.43 1.40
2125 2355 5.304357 GGCTGCCCCAGTTAATAACATTAAT 59.696 40.000 7.66 0.00 33.43 1.40
2126 2356 6.183360 GGCTGCCCCAGTTAATAACATTAATT 60.183 38.462 7.66 0.00 33.43 1.40
2127 2357 7.014808 GGCTGCCCCAGTTAATAACATTAATTA 59.985 37.037 7.66 0.00 33.43 1.40
2128 2358 8.417884 GCTGCCCCAGTTAATAACATTAATTAA 58.582 33.333 5.89 0.00 33.43 1.40
2129 2359 9.965824 CTGCCCCAGTTAATAACATTAATTAAG 57.034 33.333 5.89 0.00 0.00 1.85
2130 2360 8.417884 TGCCCCAGTTAATAACATTAATTAAGC 58.582 33.333 5.89 0.00 0.00 3.09
2131 2361 8.417884 GCCCCAGTTAATAACATTAATTAAGCA 58.582 33.333 5.89 0.00 0.00 3.91
2132 2362 9.965824 CCCCAGTTAATAACATTAATTAAGCAG 57.034 33.333 5.89 0.00 0.00 4.24
2133 2363 9.965824 CCCAGTTAATAACATTAATTAAGCAGG 57.034 33.333 5.89 0.00 0.00 4.85
2134 2364 9.965824 CCAGTTAATAACATTAATTAAGCAGGG 57.034 33.333 5.89 0.00 0.00 4.45
2135 2365 9.463443 CAGTTAATAACATTAATTAAGCAGGGC 57.537 33.333 5.89 0.00 0.00 5.19
2136 2366 8.638873 AGTTAATAACATTAATTAAGCAGGGCC 58.361 33.333 5.89 0.00 0.00 5.80
2137 2367 8.638873 GTTAATAACATTAATTAAGCAGGGCCT 58.361 33.333 0.00 0.00 0.00 5.19
2138 2368 6.655078 ATAACATTAATTAAGCAGGGCCTG 57.345 37.500 29.44 29.44 34.12 4.85
2139 2369 3.981212 ACATTAATTAAGCAGGGCCTGT 58.019 40.909 32.80 18.04 33.43 4.00
2140 2370 4.352893 ACATTAATTAAGCAGGGCCTGTT 58.647 39.130 32.80 26.11 33.43 3.16
2141 2371 4.777366 ACATTAATTAAGCAGGGCCTGTTT 59.223 37.500 33.44 33.44 38.39 2.83
2142 2372 5.248248 ACATTAATTAAGCAGGGCCTGTTTT 59.752 36.000 35.49 28.44 36.41 2.43
2143 2373 3.683365 AATTAAGCAGGGCCTGTTTTG 57.317 42.857 35.49 13.05 36.41 2.44
2144 2374 1.337118 TTAAGCAGGGCCTGTTTTGG 58.663 50.000 35.49 11.39 36.41 3.28
2145 2375 0.187361 TAAGCAGGGCCTGTTTTGGT 59.813 50.000 35.49 17.85 36.41 3.67
2146 2376 0.187361 AAGCAGGGCCTGTTTTGGTA 59.813 50.000 32.80 0.00 31.14 3.25
2147 2377 0.251341 AGCAGGGCCTGTTTTGGTAG 60.251 55.000 32.80 6.38 33.43 3.18
2148 2378 1.250840 GCAGGGCCTGTTTTGGTAGG 61.251 60.000 32.80 5.59 37.14 3.18
2149 2379 0.404040 CAGGGCCTGTTTTGGTAGGA 59.596 55.000 25.74 0.00 36.11 2.94
2150 2380 1.005924 CAGGGCCTGTTTTGGTAGGAT 59.994 52.381 25.74 0.00 36.11 3.24
2151 2381 1.005924 AGGGCCTGTTTTGGTAGGATG 59.994 52.381 4.50 0.00 36.11 3.51
2152 2382 1.005450 GGGCCTGTTTTGGTAGGATGA 59.995 52.381 0.84 0.00 36.11 2.92
2153 2383 2.092323 GGCCTGTTTTGGTAGGATGAC 58.908 52.381 0.00 0.00 36.11 3.06
2154 2384 2.290960 GGCCTGTTTTGGTAGGATGACT 60.291 50.000 0.00 0.00 36.11 3.41
2155 2385 3.421844 GCCTGTTTTGGTAGGATGACTT 58.578 45.455 0.00 0.00 36.11 3.01
2156 2386 3.191371 GCCTGTTTTGGTAGGATGACTTG 59.809 47.826 0.00 0.00 36.11 3.16
2157 2387 4.398319 CCTGTTTTGGTAGGATGACTTGT 58.602 43.478 0.00 0.00 36.11 3.16
2158 2388 4.827284 CCTGTTTTGGTAGGATGACTTGTT 59.173 41.667 0.00 0.00 36.11 2.83
2159 2389 5.278463 CCTGTTTTGGTAGGATGACTTGTTG 60.278 44.000 0.00 0.00 36.11 3.33
2160 2390 5.441500 TGTTTTGGTAGGATGACTTGTTGA 58.558 37.500 0.00 0.00 0.00 3.18
2161 2391 5.530915 TGTTTTGGTAGGATGACTTGTTGAG 59.469 40.000 0.00 0.00 0.00 3.02
2162 2392 5.560722 TTTGGTAGGATGACTTGTTGAGA 57.439 39.130 0.00 0.00 0.00 3.27
2163 2393 5.762179 TTGGTAGGATGACTTGTTGAGAT 57.238 39.130 0.00 0.00 0.00 2.75
2164 2394 5.089970 TGGTAGGATGACTTGTTGAGATG 57.910 43.478 0.00 0.00 0.00 2.90
2165 2395 4.080919 TGGTAGGATGACTTGTTGAGATGG 60.081 45.833 0.00 0.00 0.00 3.51
2166 2396 4.162320 GGTAGGATGACTTGTTGAGATGGA 59.838 45.833 0.00 0.00 0.00 3.41
2167 2397 5.163258 GGTAGGATGACTTGTTGAGATGGAT 60.163 44.000 0.00 0.00 0.00 3.41
2168 2398 4.778579 AGGATGACTTGTTGAGATGGATG 58.221 43.478 0.00 0.00 0.00 3.51
2169 2399 3.881688 GGATGACTTGTTGAGATGGATGG 59.118 47.826 0.00 0.00 0.00 3.51
2170 2400 4.521146 GATGACTTGTTGAGATGGATGGT 58.479 43.478 0.00 0.00 0.00 3.55
2171 2401 3.678289 TGACTTGTTGAGATGGATGGTG 58.322 45.455 0.00 0.00 0.00 4.17
2172 2402 3.012518 GACTTGTTGAGATGGATGGTGG 58.987 50.000 0.00 0.00 0.00 4.61
2173 2403 2.644299 ACTTGTTGAGATGGATGGTGGA 59.356 45.455 0.00 0.00 0.00 4.02
2174 2404 3.267812 ACTTGTTGAGATGGATGGTGGAT 59.732 43.478 0.00 0.00 0.00 3.41
2175 2405 4.474651 ACTTGTTGAGATGGATGGTGGATA 59.525 41.667 0.00 0.00 0.00 2.59
2176 2406 4.422073 TGTTGAGATGGATGGTGGATAC 57.578 45.455 0.00 0.00 0.00 2.24
2177 2407 4.040047 TGTTGAGATGGATGGTGGATACT 58.960 43.478 0.00 0.00 37.61 2.12
2178 2408 4.101585 TGTTGAGATGGATGGTGGATACTC 59.898 45.833 0.00 0.00 37.61 2.59
2185 2415 4.701286 GGTGGATACTCCCTCCGT 57.299 61.111 0.00 0.00 44.68 4.69
2186 2416 2.427742 GGTGGATACTCCCTCCGTC 58.572 63.158 0.00 0.00 44.68 4.79
2187 2417 1.114119 GGTGGATACTCCCTCCGTCC 61.114 65.000 0.00 0.00 44.68 4.79
2188 2418 1.114119 GTGGATACTCCCTCCGTCCC 61.114 65.000 0.00 0.00 35.03 4.46
2189 2419 1.902432 GGATACTCCCTCCGTCCCG 60.902 68.421 0.00 0.00 0.00 5.14
2190 2420 1.150081 GATACTCCCTCCGTCCCGA 59.850 63.158 0.00 0.00 0.00 5.14
2191 2421 0.466922 GATACTCCCTCCGTCCCGAA 60.467 60.000 0.00 0.00 0.00 4.30
2192 2422 0.187851 ATACTCCCTCCGTCCCGAAT 59.812 55.000 0.00 0.00 0.00 3.34
2193 2423 0.032813 TACTCCCTCCGTCCCGAATT 60.033 55.000 0.00 0.00 0.00 2.17
2194 2424 0.032813 ACTCCCTCCGTCCCGAATTA 60.033 55.000 0.00 0.00 0.00 1.40
2195 2425 0.388294 CTCCCTCCGTCCCGAATTAC 59.612 60.000 0.00 0.00 0.00 1.89
2196 2426 0.032813 TCCCTCCGTCCCGAATTACT 60.033 55.000 0.00 0.00 0.00 2.24
2197 2427 0.388294 CCCTCCGTCCCGAATTACTC 59.612 60.000 0.00 0.00 0.00 2.59
2199 2429 0.737219 CTCCGTCCCGAATTACTCGT 59.263 55.000 0.00 0.00 46.65 4.18
2200 2430 0.734889 TCCGTCCCGAATTACTCGTC 59.265 55.000 0.00 0.00 46.65 4.20
2201 2431 0.737219 CCGTCCCGAATTACTCGTCT 59.263 55.000 0.00 0.00 46.65 4.18
2202 2432 1.268437 CCGTCCCGAATTACTCGTCTC 60.268 57.143 0.00 0.00 46.65 3.36
2203 2433 1.399440 CGTCCCGAATTACTCGTCTCA 59.601 52.381 0.00 0.00 46.65 3.27
2204 2434 2.539142 CGTCCCGAATTACTCGTCTCAG 60.539 54.545 0.00 0.00 46.65 3.35
2205 2435 2.681848 GTCCCGAATTACTCGTCTCAGA 59.318 50.000 0.00 0.00 46.65 3.27
2206 2436 3.315749 GTCCCGAATTACTCGTCTCAGAT 59.684 47.826 0.00 0.00 46.65 2.90
2207 2437 3.952323 TCCCGAATTACTCGTCTCAGATT 59.048 43.478 0.00 0.00 46.65 2.40
2208 2438 4.401519 TCCCGAATTACTCGTCTCAGATTT 59.598 41.667 0.00 0.00 46.65 2.17
2209 2439 5.591472 TCCCGAATTACTCGTCTCAGATTTA 59.409 40.000 0.00 0.00 46.65 1.40
2210 2440 5.915758 CCCGAATTACTCGTCTCAGATTTAG 59.084 44.000 0.00 0.00 46.65 1.85
2211 2441 6.459848 CCCGAATTACTCGTCTCAGATTTAGT 60.460 42.308 0.00 0.00 46.65 2.24
2212 2442 6.415280 CCGAATTACTCGTCTCAGATTTAGTG 59.585 42.308 0.00 0.00 46.65 2.74
2213 2443 6.967767 CGAATTACTCGTCTCAGATTTAGTGT 59.032 38.462 0.00 0.00 42.89 3.55
2214 2444 7.485277 CGAATTACTCGTCTCAGATTTAGTGTT 59.515 37.037 0.00 0.00 42.89 3.32
2215 2445 9.784680 GAATTACTCGTCTCAGATTTAGTGTTA 57.215 33.333 0.00 0.00 0.00 2.41
2216 2446 9.790389 AATTACTCGTCTCAGATTTAGTGTTAG 57.210 33.333 0.00 0.00 0.00 2.34
2217 2447 8.557592 TTACTCGTCTCAGATTTAGTGTTAGA 57.442 34.615 0.00 0.00 0.00 2.10
2218 2448 7.633193 ACTCGTCTCAGATTTAGTGTTAGAT 57.367 36.000 0.00 0.00 0.00 1.98
2219 2449 8.734218 ACTCGTCTCAGATTTAGTGTTAGATA 57.266 34.615 0.00 0.00 0.00 1.98
2220 2450 8.614346 ACTCGTCTCAGATTTAGTGTTAGATAC 58.386 37.037 0.00 0.00 0.00 2.24
2221 2451 8.502105 TCGTCTCAGATTTAGTGTTAGATACA 57.498 34.615 0.00 0.00 0.00 2.29
2222 2452 9.121658 TCGTCTCAGATTTAGTGTTAGATACAT 57.878 33.333 0.00 0.00 39.39 2.29
2223 2453 9.388346 CGTCTCAGATTTAGTGTTAGATACATC 57.612 37.037 0.00 0.00 39.39 3.06
2224 2454 9.685828 GTCTCAGATTTAGTGTTAGATACATCC 57.314 37.037 0.00 0.00 39.39 3.51
2225 2455 8.568794 TCTCAGATTTAGTGTTAGATACATCCG 58.431 37.037 0.00 0.00 39.39 4.18
2226 2456 8.234136 TCAGATTTAGTGTTAGATACATCCGT 57.766 34.615 0.00 0.00 39.39 4.69
2227 2457 9.346005 TCAGATTTAGTGTTAGATACATCCGTA 57.654 33.333 0.00 0.00 39.39 4.02
2228 2458 9.961265 CAGATTTAGTGTTAGATACATCCGTAA 57.039 33.333 0.00 0.00 39.39 3.18
2229 2459 9.962783 AGATTTAGTGTTAGATACATCCGTAAC 57.037 33.333 0.00 0.00 39.39 2.50
2230 2460 9.962783 GATTTAGTGTTAGATACATCCGTAACT 57.037 33.333 0.00 0.00 39.39 2.24
2232 2462 9.577110 TTTAGTGTTAGATACATCCGTAACTTG 57.423 33.333 0.00 0.00 39.39 3.16
2233 2463 7.400599 AGTGTTAGATACATCCGTAACTTGA 57.599 36.000 0.00 0.00 39.39 3.02
2234 2464 7.256286 AGTGTTAGATACATCCGTAACTTGAC 58.744 38.462 0.00 0.00 39.39 3.18
2235 2465 7.031372 GTGTTAGATACATCCGTAACTTGACA 58.969 38.462 0.00 0.00 39.39 3.58
2236 2466 7.543172 GTGTTAGATACATCCGTAACTTGACAA 59.457 37.037 0.00 0.00 39.39 3.18
2237 2467 8.089597 TGTTAGATACATCCGTAACTTGACAAA 58.910 33.333 0.00 0.00 33.25 2.83
2238 2468 9.095065 GTTAGATACATCCGTAACTTGACAAAT 57.905 33.333 0.00 0.00 33.25 2.32
2239 2469 7.772332 AGATACATCCGTAACTTGACAAATC 57.228 36.000 0.00 0.00 26.81 2.17
2240 2470 7.556844 AGATACATCCGTAACTTGACAAATCT 58.443 34.615 0.00 0.00 26.81 2.40
2241 2471 8.692710 AGATACATCCGTAACTTGACAAATCTA 58.307 33.333 0.00 0.00 26.81 1.98
2242 2472 9.309516 GATACATCCGTAACTTGACAAATCTAA 57.690 33.333 0.00 0.00 0.00 2.10
2243 2473 7.596749 ACATCCGTAACTTGACAAATCTAAG 57.403 36.000 0.00 0.00 0.00 2.18
2244 2474 7.159372 ACATCCGTAACTTGACAAATCTAAGT 58.841 34.615 0.00 0.00 36.29 2.24
2245 2475 7.331193 ACATCCGTAACTTGACAAATCTAAGTC 59.669 37.037 0.00 0.00 33.82 3.01
2246 2476 6.751157 TCCGTAACTTGACAAATCTAAGTCA 58.249 36.000 0.00 0.00 42.55 3.41
2248 2478 7.170320 TCCGTAACTTGACAAATCTAAGTCAAC 59.830 37.037 4.07 0.00 46.46 3.18
2249 2479 7.170998 CCGTAACTTGACAAATCTAAGTCAACT 59.829 37.037 4.07 0.00 46.46 3.16
2250 2480 9.188588 CGTAACTTGACAAATCTAAGTCAACTA 57.811 33.333 4.07 0.00 46.46 2.24
2257 2487 9.567776 TGACAAATCTAAGTCAACTAATTTGGA 57.432 29.630 19.16 10.03 41.42 3.53
2295 2525 8.937634 TTTTAGTTTAGTAGGATGTTCCGATC 57.062 34.615 0.00 0.00 42.75 3.69
2296 2526 7.893124 TTAGTTTAGTAGGATGTTCCGATCT 57.107 36.000 0.00 0.00 42.75 2.75
2297 2527 8.985315 TTAGTTTAGTAGGATGTTCCGATCTA 57.015 34.615 0.00 0.00 42.75 1.98
2298 2528 7.893124 AGTTTAGTAGGATGTTCCGATCTAA 57.107 36.000 0.00 0.00 42.75 2.10
2299 2529 8.480133 AGTTTAGTAGGATGTTCCGATCTAAT 57.520 34.615 0.00 0.00 42.75 1.73
2300 2530 8.578151 AGTTTAGTAGGATGTTCCGATCTAATC 58.422 37.037 0.00 7.77 42.75 1.75
2301 2531 8.358148 GTTTAGTAGGATGTTCCGATCTAATCA 58.642 37.037 0.00 0.00 42.75 2.57
2302 2532 8.651589 TTAGTAGGATGTTCCGATCTAATCAT 57.348 34.615 0.00 0.00 42.75 2.45
2303 2533 6.929625 AGTAGGATGTTCCGATCTAATCATG 58.070 40.000 0.00 0.00 42.75 3.07
2304 2534 6.721668 AGTAGGATGTTCCGATCTAATCATGA 59.278 38.462 0.00 0.00 42.75 3.07
2305 2535 6.425210 AGGATGTTCCGATCTAATCATGAA 57.575 37.500 0.00 0.00 42.75 2.57
2306 2536 6.226787 AGGATGTTCCGATCTAATCATGAAC 58.773 40.000 0.00 10.24 42.75 3.18
2307 2537 6.042552 AGGATGTTCCGATCTAATCATGAACT 59.957 38.462 0.00 0.00 42.75 3.01
2308 2538 6.146837 GGATGTTCCGATCTAATCATGAACTG 59.853 42.308 0.00 0.00 39.50 3.16
2309 2539 6.220726 TGTTCCGATCTAATCATGAACTGA 57.779 37.500 0.00 0.00 39.50 3.41
2310 2540 6.820335 TGTTCCGATCTAATCATGAACTGAT 58.180 36.000 0.00 3.44 46.87 2.90
2311 2541 6.703165 TGTTCCGATCTAATCATGAACTGATG 59.297 38.462 0.00 0.06 44.03 3.07
2312 2542 6.655078 TCCGATCTAATCATGAACTGATGA 57.345 37.500 0.00 0.00 44.03 2.92
2313 2543 7.237209 TCCGATCTAATCATGAACTGATGAT 57.763 36.000 0.00 0.00 44.03 2.45
2314 2544 8.353423 TCCGATCTAATCATGAACTGATGATA 57.647 34.615 0.00 0.00 44.03 2.15
2315 2545 8.465201 TCCGATCTAATCATGAACTGATGATAG 58.535 37.037 0.00 0.00 44.03 2.08
2316 2546 8.249638 CCGATCTAATCATGAACTGATGATAGT 58.750 37.037 0.00 0.00 44.03 2.12
2324 2554 8.992835 TCATGAACTGATGATAGTATATGCAC 57.007 34.615 0.00 0.00 30.49 4.57
2325 2555 8.037166 TCATGAACTGATGATAGTATATGCACC 58.963 37.037 0.00 0.00 30.49 5.01
2326 2556 6.701340 TGAACTGATGATAGTATATGCACCC 58.299 40.000 0.00 0.00 0.00 4.61
2327 2557 6.269769 TGAACTGATGATAGTATATGCACCCA 59.730 38.462 0.00 0.00 0.00 4.51
2328 2558 6.686484 ACTGATGATAGTATATGCACCCAA 57.314 37.500 0.00 0.00 0.00 4.12
2329 2559 6.467677 ACTGATGATAGTATATGCACCCAAC 58.532 40.000 0.00 0.00 0.00 3.77
2330 2560 6.270927 ACTGATGATAGTATATGCACCCAACT 59.729 38.462 0.00 0.00 0.00 3.16
2331 2561 7.078249 TGATGATAGTATATGCACCCAACTT 57.922 36.000 0.00 0.00 0.00 2.66
2332 2562 7.517320 TGATGATAGTATATGCACCCAACTTT 58.483 34.615 0.00 0.00 0.00 2.66
2333 2563 7.998383 TGATGATAGTATATGCACCCAACTTTT 59.002 33.333 0.00 0.00 0.00 2.27
2334 2564 7.566760 TGATAGTATATGCACCCAACTTTTG 57.433 36.000 0.00 0.00 0.00 2.44
2335 2565 7.116075 TGATAGTATATGCACCCAACTTTTGT 58.884 34.615 0.00 0.00 0.00 2.83
2336 2566 7.613801 TGATAGTATATGCACCCAACTTTTGTT 59.386 33.333 0.00 0.00 44.66 2.83
2337 2567 6.664428 AGTATATGCACCCAACTTTTGTTT 57.336 33.333 0.00 0.00 41.35 2.83
2338 2568 7.768807 AGTATATGCACCCAACTTTTGTTTA 57.231 32.000 0.00 0.00 41.35 2.01
2339 2569 8.361169 AGTATATGCACCCAACTTTTGTTTAT 57.639 30.769 0.00 0.00 41.35 1.40
2340 2570 9.469097 AGTATATGCACCCAACTTTTGTTTATA 57.531 29.630 0.00 0.00 41.35 0.98
2343 2573 5.848406 TGCACCCAACTTTTGTTTATAAGG 58.152 37.500 0.00 0.00 41.35 2.69
2344 2574 5.364157 TGCACCCAACTTTTGTTTATAAGGT 59.636 36.000 0.00 0.00 41.35 3.50
2345 2575 5.924254 GCACCCAACTTTTGTTTATAAGGTC 59.076 40.000 0.00 0.00 41.35 3.85
2346 2576 6.146898 CACCCAACTTTTGTTTATAAGGTCG 58.853 40.000 0.00 0.00 41.35 4.79
2347 2577 6.016943 CACCCAACTTTTGTTTATAAGGTCGA 60.017 38.462 0.00 0.00 41.35 4.20
2348 2578 6.206048 ACCCAACTTTTGTTTATAAGGTCGAG 59.794 38.462 0.00 0.00 41.35 4.04
2349 2579 6.206048 CCCAACTTTTGTTTATAAGGTCGAGT 59.794 38.462 0.00 0.00 41.35 4.18
2350 2580 7.075741 CCAACTTTTGTTTATAAGGTCGAGTG 58.924 38.462 0.00 0.00 41.35 3.51
2351 2581 6.796705 ACTTTTGTTTATAAGGTCGAGTGG 57.203 37.500 0.00 0.00 0.00 4.00
2352 2582 6.527423 ACTTTTGTTTATAAGGTCGAGTGGA 58.473 36.000 0.00 0.00 0.00 4.02
2353 2583 6.426025 ACTTTTGTTTATAAGGTCGAGTGGAC 59.574 38.462 0.00 0.00 45.31 4.02
2354 2584 5.733620 TTGTTTATAAGGTCGAGTGGACT 57.266 39.130 5.21 0.00 45.35 3.85
2355 2585 6.839124 TTGTTTATAAGGTCGAGTGGACTA 57.161 37.500 5.21 0.00 45.35 2.59
2356 2586 6.839124 TGTTTATAAGGTCGAGTGGACTAA 57.161 37.500 5.21 0.00 45.35 2.24
2357 2587 7.414222 TGTTTATAAGGTCGAGTGGACTAAT 57.586 36.000 5.21 0.16 45.35 1.73
2358 2588 8.523915 TGTTTATAAGGTCGAGTGGACTAATA 57.476 34.615 5.21 0.00 45.35 0.98
2359 2589 8.627403 TGTTTATAAGGTCGAGTGGACTAATAG 58.373 37.037 5.21 0.00 45.35 1.73
2360 2590 5.708877 ATAAGGTCGAGTGGACTAATAGC 57.291 43.478 5.21 0.00 45.35 2.97
2361 2591 3.014304 AGGTCGAGTGGACTAATAGCA 57.986 47.619 5.21 0.00 45.35 3.49
2362 2592 3.362706 AGGTCGAGTGGACTAATAGCAA 58.637 45.455 5.21 0.00 45.35 3.91
2363 2593 3.130693 AGGTCGAGTGGACTAATAGCAAC 59.869 47.826 5.21 0.00 45.35 4.17
2364 2594 3.130693 GGTCGAGTGGACTAATAGCAACT 59.869 47.826 5.21 0.00 45.35 3.16
2365 2595 4.337555 GGTCGAGTGGACTAATAGCAACTA 59.662 45.833 5.21 0.00 45.35 2.24
2366 2596 5.505985 GGTCGAGTGGACTAATAGCAACTAG 60.506 48.000 5.21 0.00 45.35 2.57
2367 2597 5.066246 GTCGAGTGGACTAATAGCAACTAGT 59.934 44.000 0.00 0.00 42.62 2.57
2368 2598 6.259608 GTCGAGTGGACTAATAGCAACTAGTA 59.740 42.308 0.00 0.00 42.62 1.82
2369 2599 6.259608 TCGAGTGGACTAATAGCAACTAGTAC 59.740 42.308 0.00 0.00 30.69 2.73
2370 2600 6.037940 CGAGTGGACTAATAGCAACTAGTACA 59.962 42.308 0.00 1.10 36.77 2.90
2371 2601 7.255173 CGAGTGGACTAATAGCAACTAGTACAT 60.255 40.741 0.00 0.00 40.32 2.29
2372 2602 7.717568 AGTGGACTAATAGCAACTAGTACATG 58.282 38.462 0.00 0.00 40.32 3.21
2373 2603 7.560262 AGTGGACTAATAGCAACTAGTACATGA 59.440 37.037 0.00 0.00 40.32 3.07
2374 2604 7.648510 GTGGACTAATAGCAACTAGTACATGAC 59.351 40.741 0.00 0.00 40.32 3.06
2375 2605 7.340999 TGGACTAATAGCAACTAGTACATGACA 59.659 37.037 0.00 0.00 34.66 3.58
2376 2606 7.863375 GGACTAATAGCAACTAGTACATGACAG 59.137 40.741 0.00 0.00 30.46 3.51
2377 2607 7.717568 ACTAATAGCAACTAGTACATGACAGG 58.282 38.462 0.00 0.00 0.00 4.00
2378 2608 6.791867 AATAGCAACTAGTACATGACAGGA 57.208 37.500 0.00 0.00 0.00 3.86
2379 2609 6.791867 ATAGCAACTAGTACATGACAGGAA 57.208 37.500 0.00 0.00 0.00 3.36
2380 2610 5.483685 AGCAACTAGTACATGACAGGAAA 57.516 39.130 0.00 0.00 0.00 3.13
2381 2611 5.865085 AGCAACTAGTACATGACAGGAAAA 58.135 37.500 0.00 0.00 0.00 2.29
2382 2612 6.476378 AGCAACTAGTACATGACAGGAAAAT 58.524 36.000 0.00 0.00 0.00 1.82
2383 2613 6.595716 AGCAACTAGTACATGACAGGAAAATC 59.404 38.462 0.00 0.00 0.00 2.17
2384 2614 6.455646 GCAACTAGTACATGACAGGAAAATCG 60.456 42.308 0.00 0.00 0.00 3.34
2385 2615 6.525578 ACTAGTACATGACAGGAAAATCGA 57.474 37.500 0.00 0.00 0.00 3.59
2386 2616 6.331061 ACTAGTACATGACAGGAAAATCGAC 58.669 40.000 0.00 0.00 0.00 4.20
2387 2617 5.407407 AGTACATGACAGGAAAATCGACT 57.593 39.130 0.00 0.00 0.00 4.18
2388 2618 5.411781 AGTACATGACAGGAAAATCGACTC 58.588 41.667 0.00 0.00 0.00 3.36
2389 2619 3.600388 ACATGACAGGAAAATCGACTCC 58.400 45.455 0.00 0.00 0.00 3.85
2390 2620 3.007940 ACATGACAGGAAAATCGACTCCA 59.992 43.478 0.00 0.00 33.83 3.86
2391 2621 3.762407 TGACAGGAAAATCGACTCCAA 57.238 42.857 11.49 0.00 33.83 3.53
2392 2622 4.079980 TGACAGGAAAATCGACTCCAAA 57.920 40.909 11.49 0.00 33.83 3.28
2393 2623 4.065088 TGACAGGAAAATCGACTCCAAAG 58.935 43.478 11.49 4.86 33.83 2.77
2394 2624 2.814336 ACAGGAAAATCGACTCCAAAGC 59.186 45.455 11.49 0.00 33.83 3.51
2395 2625 3.077359 CAGGAAAATCGACTCCAAAGCT 58.923 45.455 11.49 0.00 33.83 3.74
2396 2626 3.077359 AGGAAAATCGACTCCAAAGCTG 58.923 45.455 11.49 0.00 33.83 4.24
2397 2627 2.414691 GGAAAATCGACTCCAAAGCTGC 60.415 50.000 5.38 0.00 0.00 5.25
2398 2628 1.896220 AAATCGACTCCAAAGCTGCA 58.104 45.000 1.02 0.00 0.00 4.41
2399 2629 2.119801 AATCGACTCCAAAGCTGCAT 57.880 45.000 1.02 0.00 0.00 3.96
2400 2630 2.988010 ATCGACTCCAAAGCTGCATA 57.012 45.000 1.02 0.00 0.00 3.14
2401 2631 2.988010 TCGACTCCAAAGCTGCATAT 57.012 45.000 1.02 0.00 0.00 1.78
2402 2632 2.826428 TCGACTCCAAAGCTGCATATC 58.174 47.619 1.02 0.00 0.00 1.63
2403 2633 2.432146 TCGACTCCAAAGCTGCATATCT 59.568 45.455 1.02 0.00 0.00 1.98
2404 2634 3.636764 TCGACTCCAAAGCTGCATATCTA 59.363 43.478 1.02 0.00 0.00 1.98
2405 2635 4.099419 TCGACTCCAAAGCTGCATATCTAA 59.901 41.667 1.02 0.00 0.00 2.10
2406 2636 4.447054 CGACTCCAAAGCTGCATATCTAAG 59.553 45.833 1.02 0.00 0.00 2.18
2407 2637 4.712476 ACTCCAAAGCTGCATATCTAAGG 58.288 43.478 1.02 0.00 0.00 2.69
2408 2638 4.070716 CTCCAAAGCTGCATATCTAAGGG 58.929 47.826 1.02 0.00 0.00 3.95
2409 2639 3.152341 CCAAAGCTGCATATCTAAGGGG 58.848 50.000 1.02 0.00 0.00 4.79
2410 2640 3.181440 CCAAAGCTGCATATCTAAGGGGA 60.181 47.826 1.02 0.00 0.00 4.81
2411 2641 4.464008 CAAAGCTGCATATCTAAGGGGAA 58.536 43.478 1.02 0.00 0.00 3.97
2412 2642 5.075493 CAAAGCTGCATATCTAAGGGGAAT 58.925 41.667 1.02 0.00 0.00 3.01
2413 2643 5.330648 AAGCTGCATATCTAAGGGGAATT 57.669 39.130 1.02 0.00 0.00 2.17
2414 2644 4.660168 AGCTGCATATCTAAGGGGAATTG 58.340 43.478 1.02 0.00 0.00 2.32
2415 2645 4.105377 AGCTGCATATCTAAGGGGAATTGT 59.895 41.667 1.02 0.00 0.00 2.71
2416 2646 5.310594 AGCTGCATATCTAAGGGGAATTGTA 59.689 40.000 1.02 0.00 0.00 2.41
2417 2647 6.012157 AGCTGCATATCTAAGGGGAATTGTAT 60.012 38.462 1.02 0.00 0.00 2.29
2418 2648 7.182749 AGCTGCATATCTAAGGGGAATTGTATA 59.817 37.037 1.02 0.00 0.00 1.47
2419 2649 7.829211 GCTGCATATCTAAGGGGAATTGTATAA 59.171 37.037 0.00 0.00 0.00 0.98
2420 2650 9.388506 CTGCATATCTAAGGGGAATTGTATAAG 57.611 37.037 0.00 0.00 0.00 1.73
2421 2651 8.328758 TGCATATCTAAGGGGAATTGTATAAGG 58.671 37.037 0.00 0.00 0.00 2.69
2422 2652 8.548877 GCATATCTAAGGGGAATTGTATAAGGA 58.451 37.037 0.00 0.00 0.00 3.36
2426 2656 8.165267 TCTAAGGGGAATTGTATAAGGAAACA 57.835 34.615 0.00 0.00 0.00 2.83
2427 2657 8.616598 TCTAAGGGGAATTGTATAAGGAAACAA 58.383 33.333 0.00 0.00 39.73 2.83
2428 2658 9.250246 CTAAGGGGAATTGTATAAGGAAACAAA 57.750 33.333 0.00 0.00 38.95 2.83
2429 2659 7.718334 AGGGGAATTGTATAAGGAAACAAAG 57.282 36.000 0.00 0.00 38.95 2.77
2430 2660 7.246027 AGGGGAATTGTATAAGGAAACAAAGT 58.754 34.615 0.00 0.00 38.95 2.66
2431 2661 8.395605 AGGGGAATTGTATAAGGAAACAAAGTA 58.604 33.333 0.00 0.00 38.95 2.24
2432 2662 8.464404 GGGGAATTGTATAAGGAAACAAAGTAC 58.536 37.037 0.00 0.00 38.95 2.73
2433 2663 9.016438 GGGAATTGTATAAGGAAACAAAGTACA 57.984 33.333 0.00 0.00 38.95 2.90
2434 2664 9.836076 GGAATTGTATAAGGAAACAAAGTACAC 57.164 33.333 0.00 0.00 38.95 2.90
2437 2667 9.787435 ATTGTATAAGGAAACAAAGTACACAGA 57.213 29.630 0.00 0.00 38.95 3.41
2438 2668 9.787435 TTGTATAAGGAAACAAAGTACACAGAT 57.213 29.630 0.00 0.00 32.86 2.90
2439 2669 9.787435 TGTATAAGGAAACAAAGTACACAGATT 57.213 29.630 0.00 0.00 0.00 2.40
2443 2673 8.608844 AAGGAAACAAAGTACACAGATTAGAG 57.391 34.615 0.00 0.00 0.00 2.43
2444 2674 6.651225 AGGAAACAAAGTACACAGATTAGAGC 59.349 38.462 0.00 0.00 0.00 4.09
2445 2675 6.426937 GGAAACAAAGTACACAGATTAGAGCA 59.573 38.462 0.00 0.00 0.00 4.26
2446 2676 7.119846 GGAAACAAAGTACACAGATTAGAGCAT 59.880 37.037 0.00 0.00 0.00 3.79
2447 2677 7.602517 AACAAAGTACACAGATTAGAGCATC 57.397 36.000 0.00 0.00 0.00 3.91
2461 2691 2.723322 AGCATCTGCCAATAGCTCAA 57.277 45.000 0.00 0.00 44.23 3.02
2462 2692 2.573369 AGCATCTGCCAATAGCTCAAG 58.427 47.619 0.00 0.00 44.23 3.02
2463 2693 1.001597 GCATCTGCCAATAGCTCAAGC 60.002 52.381 0.00 0.00 44.23 4.01
2464 2694 4.503817 GCATCTGCCAATAGCTCAAGCG 62.504 54.545 0.00 0.00 44.23 4.68
2476 2706 2.618053 GCTCAAGCGGCTTACTTAAGA 58.382 47.619 15.93 6.47 35.33 2.10
2477 2707 2.348971 GCTCAAGCGGCTTACTTAAGAC 59.651 50.000 15.93 0.00 37.97 3.01
2478 2708 3.851098 CTCAAGCGGCTTACTTAAGACT 58.149 45.455 15.93 0.00 39.20 3.24
2479 2709 4.677250 GCTCAAGCGGCTTACTTAAGACTA 60.677 45.833 15.93 0.00 39.20 2.59
2480 2710 5.395682 TCAAGCGGCTTACTTAAGACTAA 57.604 39.130 15.93 0.00 39.20 2.24
2481 2711 5.974108 TCAAGCGGCTTACTTAAGACTAAT 58.026 37.500 15.93 0.00 39.20 1.73
2482 2712 5.810587 TCAAGCGGCTTACTTAAGACTAATG 59.189 40.000 15.93 0.00 39.20 1.90
2483 2713 4.694339 AGCGGCTTACTTAAGACTAATGG 58.306 43.478 10.09 0.00 39.20 3.16
2484 2714 4.404715 AGCGGCTTACTTAAGACTAATGGA 59.595 41.667 10.09 0.00 39.20 3.41
2485 2715 4.507021 GCGGCTTACTTAAGACTAATGGAC 59.493 45.833 10.09 0.00 39.20 4.02
2486 2716 5.681695 GCGGCTTACTTAAGACTAATGGACT 60.682 44.000 10.09 0.00 39.20 3.85
2487 2717 6.460676 GCGGCTTACTTAAGACTAATGGACTA 60.461 42.308 10.09 0.00 39.20 2.59
2488 2718 7.140048 CGGCTTACTTAAGACTAATGGACTAG 58.860 42.308 10.09 0.00 39.20 2.57
2489 2719 6.924612 GGCTTACTTAAGACTAATGGACTAGC 59.075 42.308 10.09 0.00 38.31 3.42
2490 2720 7.201929 GGCTTACTTAAGACTAATGGACTAGCT 60.202 40.741 10.09 0.00 38.31 3.32
2491 2721 8.198778 GCTTACTTAAGACTAATGGACTAGCTT 58.801 37.037 10.09 0.00 35.33 3.74
2495 2725 9.203163 ACTTAAGACTAATGGACTAGCTTATGT 57.797 33.333 10.09 0.00 31.08 2.29
2496 2726 9.685828 CTTAAGACTAATGGACTAGCTTATGTC 57.314 37.037 0.00 0.00 0.00 3.06
2497 2727 7.906199 AAGACTAATGGACTAGCTTATGTCT 57.094 36.000 0.00 0.00 34.01 3.41
2498 2728 7.906199 AGACTAATGGACTAGCTTATGTCTT 57.094 36.000 0.00 0.00 34.01 3.01
2499 2729 8.312669 AGACTAATGGACTAGCTTATGTCTTT 57.687 34.615 0.00 0.75 34.01 2.52
2500 2730 8.417884 AGACTAATGGACTAGCTTATGTCTTTC 58.582 37.037 0.00 0.00 34.01 2.62
2501 2731 7.501844 ACTAATGGACTAGCTTATGTCTTTCC 58.498 38.462 0.00 0.00 34.01 3.13
2502 2732 6.567602 AATGGACTAGCTTATGTCTTTCCT 57.432 37.500 0.00 0.00 34.01 3.36
2503 2733 6.567602 ATGGACTAGCTTATGTCTTTCCTT 57.432 37.500 0.00 0.00 34.01 3.36
2504 2734 5.734720 TGGACTAGCTTATGTCTTTCCTTG 58.265 41.667 0.00 0.00 34.01 3.61
2505 2735 5.119694 GGACTAGCTTATGTCTTTCCTTGG 58.880 45.833 0.00 0.00 34.01 3.61
2506 2736 5.338463 GGACTAGCTTATGTCTTTCCTTGGT 60.338 44.000 0.00 0.00 34.01 3.67
2507 2737 5.491982 ACTAGCTTATGTCTTTCCTTGGTG 58.508 41.667 0.00 0.00 0.00 4.17
2508 2738 4.640771 AGCTTATGTCTTTCCTTGGTGA 57.359 40.909 0.00 0.00 0.00 4.02
2509 2739 4.985538 AGCTTATGTCTTTCCTTGGTGAA 58.014 39.130 0.00 0.00 0.00 3.18
2510 2740 5.006386 AGCTTATGTCTTTCCTTGGTGAAG 58.994 41.667 0.00 0.00 0.00 3.02
2511 2741 4.379918 GCTTATGTCTTTCCTTGGTGAAGC 60.380 45.833 0.00 0.00 0.00 3.86
2512 2742 3.515602 ATGTCTTTCCTTGGTGAAGCT 57.484 42.857 0.00 0.00 0.00 3.74
2513 2743 4.640771 ATGTCTTTCCTTGGTGAAGCTA 57.359 40.909 0.00 0.00 0.00 3.32
2514 2744 4.008074 TGTCTTTCCTTGGTGAAGCTAG 57.992 45.455 0.00 0.00 0.00 3.42
2515 2745 3.646162 TGTCTTTCCTTGGTGAAGCTAGA 59.354 43.478 0.00 0.00 0.00 2.43
2516 2746 4.287067 TGTCTTTCCTTGGTGAAGCTAGAT 59.713 41.667 0.00 0.00 0.00 1.98
2517 2747 5.483937 TGTCTTTCCTTGGTGAAGCTAGATA 59.516 40.000 0.00 0.00 0.00 1.98
2518 2748 6.045955 GTCTTTCCTTGGTGAAGCTAGATAG 58.954 44.000 0.00 0.00 0.00 2.08
2530 2760 1.638529 CTAGATAGCACCTGGAGGGG 58.361 60.000 0.00 0.00 43.01 4.79
2531 2761 0.941963 TAGATAGCACCTGGAGGGGT 59.058 55.000 0.00 0.00 41.84 4.95
2532 2762 0.044855 AGATAGCACCTGGAGGGGTT 59.955 55.000 0.00 0.00 41.84 4.11
2533 2763 1.294068 AGATAGCACCTGGAGGGGTTA 59.706 52.381 0.00 0.00 41.84 2.85
2534 2764 2.124411 GATAGCACCTGGAGGGGTTAA 58.876 52.381 0.00 0.00 41.84 2.01
2535 2765 2.280308 TAGCACCTGGAGGGGTTAAT 57.720 50.000 0.00 0.00 41.84 1.40
2536 2766 2.280308 AGCACCTGGAGGGGTTAATA 57.720 50.000 0.00 0.00 41.84 0.98
2537 2767 2.568979 AGCACCTGGAGGGGTTAATAA 58.431 47.619 0.00 0.00 41.84 1.40
2538 2768 2.923629 AGCACCTGGAGGGGTTAATAAA 59.076 45.455 0.00 0.00 41.84 1.40
2539 2769 3.531814 AGCACCTGGAGGGGTTAATAAAT 59.468 43.478 0.00 0.00 41.84 1.40
2540 2770 4.016572 AGCACCTGGAGGGGTTAATAAATT 60.017 41.667 0.00 0.00 41.84 1.82
2541 2771 4.099419 GCACCTGGAGGGGTTAATAAATTG 59.901 45.833 0.00 0.00 41.84 2.32
2542 2772 5.269189 CACCTGGAGGGGTTAATAAATTGT 58.731 41.667 0.00 0.00 37.52 2.71
2543 2773 6.428295 CACCTGGAGGGGTTAATAAATTGTA 58.572 40.000 0.00 0.00 37.52 2.41
2544 2774 6.320418 CACCTGGAGGGGTTAATAAATTGTAC 59.680 42.308 0.00 0.00 37.52 2.90
2545 2775 6.218938 ACCTGGAGGGGTTAATAAATTGTACT 59.781 38.462 0.00 0.00 40.27 2.73
2546 2776 7.123383 CCTGGAGGGGTTAATAAATTGTACTT 58.877 38.462 0.00 0.00 0.00 2.24
2547 2777 7.068226 CCTGGAGGGGTTAATAAATTGTACTTG 59.932 40.741 0.00 0.00 0.00 3.16
2548 2778 7.700846 TGGAGGGGTTAATAAATTGTACTTGA 58.299 34.615 0.00 0.00 0.00 3.02
2549 2779 8.171400 TGGAGGGGTTAATAAATTGTACTTGAA 58.829 33.333 0.00 0.00 0.00 2.69
2550 2780 9.197306 GGAGGGGTTAATAAATTGTACTTGAAT 57.803 33.333 0.00 0.00 0.00 2.57
2552 2782 8.977412 AGGGGTTAATAAATTGTACTTGAATGG 58.023 33.333 0.00 0.00 0.00 3.16
2553 2783 8.201464 GGGGTTAATAAATTGTACTTGAATGGG 58.799 37.037 0.00 0.00 0.00 4.00
2554 2784 8.201464 GGGTTAATAAATTGTACTTGAATGGGG 58.799 37.037 0.00 0.00 0.00 4.96
2555 2785 8.973182 GGTTAATAAATTGTACTTGAATGGGGA 58.027 33.333 0.00 0.00 0.00 4.81
2557 2787 7.660030 AATAAATTGTACTTGAATGGGGAGG 57.340 36.000 0.00 0.00 0.00 4.30
2558 2788 4.946160 AATTGTACTTGAATGGGGAGGA 57.054 40.909 0.00 0.00 0.00 3.71
2559 2789 4.510167 ATTGTACTTGAATGGGGAGGAG 57.490 45.455 0.00 0.00 0.00 3.69
2560 2790 1.559682 TGTACTTGAATGGGGAGGAGC 59.440 52.381 0.00 0.00 0.00 4.70
2561 2791 1.840635 GTACTTGAATGGGGAGGAGCT 59.159 52.381 0.00 0.00 0.00 4.09
2562 2792 1.376649 ACTTGAATGGGGAGGAGCTT 58.623 50.000 0.00 0.00 0.00 3.74
2563 2793 2.562296 ACTTGAATGGGGAGGAGCTTA 58.438 47.619 0.00 0.00 0.00 3.09
2564 2794 2.507471 ACTTGAATGGGGAGGAGCTTAG 59.493 50.000 0.00 0.00 0.00 2.18
2565 2795 2.568546 TGAATGGGGAGGAGCTTAGA 57.431 50.000 0.00 0.00 0.00 2.10
2566 2796 3.066208 TGAATGGGGAGGAGCTTAGAT 57.934 47.619 0.00 0.00 0.00 1.98
2567 2797 2.707791 TGAATGGGGAGGAGCTTAGATG 59.292 50.000 0.00 0.00 0.00 2.90
2568 2798 2.503869 ATGGGGAGGAGCTTAGATGT 57.496 50.000 0.00 0.00 0.00 3.06
2569 2799 3.637821 ATGGGGAGGAGCTTAGATGTA 57.362 47.619 0.00 0.00 0.00 2.29
2570 2800 3.637821 TGGGGAGGAGCTTAGATGTAT 57.362 47.619 0.00 0.00 0.00 2.29
2571 2801 3.941629 TGGGGAGGAGCTTAGATGTATT 58.058 45.455 0.00 0.00 0.00 1.89
2572 2802 4.307259 TGGGGAGGAGCTTAGATGTATTT 58.693 43.478 0.00 0.00 0.00 1.40
2573 2803 4.348168 TGGGGAGGAGCTTAGATGTATTTC 59.652 45.833 0.00 0.00 0.00 2.17
2574 2804 4.561105 GGGAGGAGCTTAGATGTATTTCG 58.439 47.826 0.00 0.00 0.00 3.46
2575 2805 4.281182 GGGAGGAGCTTAGATGTATTTCGA 59.719 45.833 0.00 0.00 0.00 3.71
2576 2806 5.046950 GGGAGGAGCTTAGATGTATTTCGAT 60.047 44.000 0.00 0.00 0.00 3.59
2577 2807 6.459923 GGAGGAGCTTAGATGTATTTCGATT 58.540 40.000 0.00 0.00 0.00 3.34
2578 2808 6.367422 GGAGGAGCTTAGATGTATTTCGATTG 59.633 42.308 0.00 0.00 0.00 2.67
2579 2809 7.055667 AGGAGCTTAGATGTATTTCGATTGA 57.944 36.000 0.00 0.00 0.00 2.57
2580 2810 7.500992 AGGAGCTTAGATGTATTTCGATTGAA 58.499 34.615 0.00 0.00 0.00 2.69
2581 2811 7.655328 AGGAGCTTAGATGTATTTCGATTGAAG 59.345 37.037 0.00 0.00 35.06 3.02
2582 2812 7.183580 AGCTTAGATGTATTTCGATTGAAGC 57.816 36.000 0.00 0.00 35.06 3.86
2583 2813 6.763135 AGCTTAGATGTATTTCGATTGAAGCA 59.237 34.615 0.00 0.00 38.38 3.91
2584 2814 7.280876 AGCTTAGATGTATTTCGATTGAAGCAA 59.719 33.333 0.00 0.00 38.38 3.91
2585 2815 8.072567 GCTTAGATGTATTTCGATTGAAGCAAT 58.927 33.333 0.00 0.00 36.72 3.56
2589 2819 9.888878 AGATGTATTTCGATTGAAGCAATAATG 57.111 29.630 0.00 0.00 33.90 1.90
2590 2820 9.669353 GATGTATTTCGATTGAAGCAATAATGT 57.331 29.630 0.00 0.00 33.90 2.71
2612 2842 9.436957 AATGTATTTAAGTCTTCATCGTGAACT 57.563 29.630 0.00 0.00 32.21 3.01
2613 2843 8.827177 TGTATTTAAGTCTTCATCGTGAACTT 57.173 30.769 0.00 8.86 33.49 2.66
2614 2844 8.922676 TGTATTTAAGTCTTCATCGTGAACTTC 58.077 33.333 7.76 0.00 31.89 3.01
2615 2845 6.780706 TTTAAGTCTTCATCGTGAACTTCC 57.219 37.500 7.76 0.00 31.89 3.46
2616 2846 2.947852 AGTCTTCATCGTGAACTTCCG 58.052 47.619 0.00 0.00 32.21 4.30
2617 2847 1.993370 GTCTTCATCGTGAACTTCCGG 59.007 52.381 0.00 0.00 32.21 5.14
2618 2848 1.616865 TCTTCATCGTGAACTTCCGGT 59.383 47.619 0.00 0.00 32.21 5.28
2619 2849 1.993370 CTTCATCGTGAACTTCCGGTC 59.007 52.381 0.00 0.00 32.21 4.79
2620 2850 0.963225 TCATCGTGAACTTCCGGTCA 59.037 50.000 0.00 0.00 0.00 4.02
2621 2851 1.548719 TCATCGTGAACTTCCGGTCAT 59.451 47.619 0.00 0.00 0.00 3.06
2622 2852 2.028476 TCATCGTGAACTTCCGGTCATT 60.028 45.455 0.00 0.00 0.00 2.57
2623 2853 3.193903 TCATCGTGAACTTCCGGTCATTA 59.806 43.478 0.00 0.00 0.00 1.90
2624 2854 3.880047 TCGTGAACTTCCGGTCATTAT 57.120 42.857 0.00 0.00 0.00 1.28
2625 2855 3.517602 TCGTGAACTTCCGGTCATTATG 58.482 45.455 0.00 0.00 0.00 1.90
2626 2856 2.030457 CGTGAACTTCCGGTCATTATGC 59.970 50.000 0.00 0.00 0.00 3.14
2627 2857 3.006940 GTGAACTTCCGGTCATTATGCA 58.993 45.455 0.00 0.00 0.00 3.96
2628 2858 3.438781 GTGAACTTCCGGTCATTATGCAA 59.561 43.478 0.00 0.00 0.00 4.08
2629 2859 4.096382 GTGAACTTCCGGTCATTATGCAAT 59.904 41.667 0.00 0.00 0.00 3.56
2630 2860 4.335315 TGAACTTCCGGTCATTATGCAATC 59.665 41.667 0.00 0.00 0.00 2.67
2631 2861 2.872245 ACTTCCGGTCATTATGCAATCG 59.128 45.455 0.00 0.00 0.00 3.34
2632 2862 1.877637 TCCGGTCATTATGCAATCGG 58.122 50.000 0.00 0.39 32.84 4.18
2633 2863 1.414550 TCCGGTCATTATGCAATCGGA 59.585 47.619 5.63 5.63 36.34 4.55
2634 2864 1.531149 CCGGTCATTATGCAATCGGAC 59.469 52.381 0.53 2.57 33.17 4.79
2635 2865 2.483876 CGGTCATTATGCAATCGGACT 58.516 47.619 0.00 0.00 0.00 3.85
2636 2866 2.476619 CGGTCATTATGCAATCGGACTC 59.523 50.000 0.00 0.00 0.00 3.36
2637 2867 2.476619 GGTCATTATGCAATCGGACTCG 59.523 50.000 0.00 0.00 37.82 4.18
2638 2868 3.123804 GTCATTATGCAATCGGACTCGT 58.876 45.455 0.00 0.00 37.69 4.18
2639 2869 3.182572 GTCATTATGCAATCGGACTCGTC 59.817 47.826 0.00 0.00 37.69 4.20
2640 2870 2.218953 TTATGCAATCGGACTCGTCC 57.781 50.000 6.01 6.01 46.18 4.79
2651 2881 2.651135 GACTCGTCCAGAACCCTAAC 57.349 55.000 0.00 0.00 0.00 2.34
2652 2882 2.169330 GACTCGTCCAGAACCCTAACT 58.831 52.381 0.00 0.00 0.00 2.24
2653 2883 3.350833 GACTCGTCCAGAACCCTAACTA 58.649 50.000 0.00 0.00 0.00 2.24
2654 2884 3.952967 GACTCGTCCAGAACCCTAACTAT 59.047 47.826 0.00 0.00 0.00 2.12
2655 2885 3.952967 ACTCGTCCAGAACCCTAACTATC 59.047 47.826 0.00 0.00 0.00 2.08
2656 2886 4.208746 CTCGTCCAGAACCCTAACTATCT 58.791 47.826 0.00 0.00 0.00 1.98
2657 2887 4.607239 TCGTCCAGAACCCTAACTATCTT 58.393 43.478 0.00 0.00 0.00 2.40
2658 2888 4.643784 TCGTCCAGAACCCTAACTATCTTC 59.356 45.833 0.00 0.00 0.00 2.87
2659 2889 4.401519 CGTCCAGAACCCTAACTATCTTCA 59.598 45.833 0.00 0.00 0.00 3.02
2660 2890 5.450688 CGTCCAGAACCCTAACTATCTTCAG 60.451 48.000 0.00 0.00 0.00 3.02
2661 2891 5.422650 GTCCAGAACCCTAACTATCTTCAGT 59.577 44.000 0.00 0.00 0.00 3.41
2662 2892 5.422331 TCCAGAACCCTAACTATCTTCAGTG 59.578 44.000 0.00 0.00 0.00 3.66
2663 2893 5.422331 CCAGAACCCTAACTATCTTCAGTGA 59.578 44.000 0.00 0.00 0.00 3.41
2664 2894 6.098982 CCAGAACCCTAACTATCTTCAGTGAT 59.901 42.308 0.00 0.00 0.00 3.06
2665 2895 6.983307 CAGAACCCTAACTATCTTCAGTGATG 59.017 42.308 0.00 0.00 0.00 3.07
2666 2896 5.283457 ACCCTAACTATCTTCAGTGATGC 57.717 43.478 0.00 0.00 0.00 3.91
2667 2897 4.202161 ACCCTAACTATCTTCAGTGATGCG 60.202 45.833 0.00 0.00 0.00 4.73
2668 2898 4.202161 CCCTAACTATCTTCAGTGATGCGT 60.202 45.833 0.00 0.00 0.00 5.24
2669 2899 4.979197 CCTAACTATCTTCAGTGATGCGTC 59.021 45.833 0.00 0.00 0.00 5.19
2670 2900 4.456280 AACTATCTTCAGTGATGCGTCA 57.544 40.909 3.97 3.97 0.00 4.35
2680 2910 1.545841 TGATGCGTCACTAGTCCTGT 58.454 50.000 3.97 0.00 0.00 4.00
2681 2911 1.472878 TGATGCGTCACTAGTCCTGTC 59.527 52.381 3.97 0.00 0.00 3.51
2682 2912 1.746220 GATGCGTCACTAGTCCTGTCT 59.254 52.381 0.00 0.00 0.00 3.41
2683 2913 1.166129 TGCGTCACTAGTCCTGTCTC 58.834 55.000 0.00 0.00 0.00 3.36
2684 2914 1.271434 TGCGTCACTAGTCCTGTCTCT 60.271 52.381 0.00 0.00 0.00 3.10
2685 2915 2.027469 TGCGTCACTAGTCCTGTCTCTA 60.027 50.000 0.00 0.00 0.00 2.43
2686 2916 3.207778 GCGTCACTAGTCCTGTCTCTAT 58.792 50.000 0.00 0.00 0.00 1.98
2687 2917 4.141779 TGCGTCACTAGTCCTGTCTCTATA 60.142 45.833 0.00 0.00 0.00 1.31
2688 2918 4.998672 GCGTCACTAGTCCTGTCTCTATAT 59.001 45.833 0.00 0.00 0.00 0.86
2689 2919 6.164876 GCGTCACTAGTCCTGTCTCTATATA 58.835 44.000 0.00 0.00 0.00 0.86
2690 2920 6.311935 GCGTCACTAGTCCTGTCTCTATATAG 59.688 46.154 3.10 3.10 0.00 1.31
2691 2921 7.604549 CGTCACTAGTCCTGTCTCTATATAGA 58.395 42.308 11.94 11.94 0.00 1.98
2692 2922 7.543172 CGTCACTAGTCCTGTCTCTATATAGAC 59.457 44.444 8.44 10.55 45.10 2.59
2705 2935 9.237187 GTCTCTATATAGACATCTGACATTGGA 57.763 37.037 17.76 5.32 44.41 3.53
2706 2936 9.460019 TCTCTATATAGACATCTGACATTGGAG 57.540 37.037 8.44 0.00 0.00 3.86
2707 2937 9.460019 CTCTATATAGACATCTGACATTGGAGA 57.540 37.037 8.44 0.00 0.00 3.71
2708 2938 9.987726 TCTATATAGACATCTGACATTGGAGAT 57.012 33.333 8.44 0.00 0.00 2.75
2711 2941 5.954153 AGACATCTGACATTGGAGATTCT 57.046 39.130 0.00 0.00 0.00 2.40
2712 2942 8.718158 ATAGACATCTGACATTGGAGATTCTA 57.282 34.615 14.02 14.02 31.01 2.10
2713 2943 7.053316 AGACATCTGACATTGGAGATTCTAG 57.947 40.000 0.00 0.00 0.00 2.43
2714 2944 5.609423 ACATCTGACATTGGAGATTCTAGC 58.391 41.667 0.00 0.00 0.00 3.42
2715 2945 5.366186 ACATCTGACATTGGAGATTCTAGCT 59.634 40.000 0.00 0.00 0.00 3.32
2716 2946 5.273674 TCTGACATTGGAGATTCTAGCTG 57.726 43.478 0.00 0.00 0.00 4.24
2717 2947 4.713814 TCTGACATTGGAGATTCTAGCTGT 59.286 41.667 0.00 0.00 0.00 4.40
2718 2948 5.893824 TCTGACATTGGAGATTCTAGCTGTA 59.106 40.000 0.00 0.00 0.00 2.74
2719 2949 5.907207 TGACATTGGAGATTCTAGCTGTAC 58.093 41.667 0.00 0.00 0.00 2.90
2720 2950 4.938080 ACATTGGAGATTCTAGCTGTACG 58.062 43.478 0.00 0.00 0.00 3.67
2721 2951 4.645136 ACATTGGAGATTCTAGCTGTACGA 59.355 41.667 0.00 0.00 0.00 3.43
2722 2952 4.902443 TTGGAGATTCTAGCTGTACGAG 57.098 45.455 0.00 0.00 0.00 4.18
2723 2953 4.152284 TGGAGATTCTAGCTGTACGAGA 57.848 45.455 0.00 0.00 0.00 4.04
2724 2954 4.130857 TGGAGATTCTAGCTGTACGAGAG 58.869 47.826 0.00 0.00 31.11 3.20
2725 2955 3.500680 GGAGATTCTAGCTGTACGAGAGG 59.499 52.174 0.00 0.00 31.11 3.69
2726 2956 4.131596 GAGATTCTAGCTGTACGAGAGGT 58.868 47.826 0.00 0.00 31.11 3.85
2727 2957 4.528920 AGATTCTAGCTGTACGAGAGGTT 58.471 43.478 0.00 0.00 31.11 3.50
2728 2958 4.951094 AGATTCTAGCTGTACGAGAGGTTT 59.049 41.667 0.00 0.00 31.11 3.27
2735 2965 2.299297 CTGTACGAGAGGTTTGGGAGTT 59.701 50.000 0.00 0.00 0.00 3.01
2736 2966 2.701951 TGTACGAGAGGTTTGGGAGTTT 59.298 45.455 0.00 0.00 0.00 2.66
2740 2970 4.576879 ACGAGAGGTTTGGGAGTTTATTC 58.423 43.478 0.00 0.00 0.00 1.75
2745 2975 6.663734 AGAGGTTTGGGAGTTTATTCCATAG 58.336 40.000 0.00 0.00 39.09 2.23
2748 2978 7.119387 AGGTTTGGGAGTTTATTCCATAGAAG 58.881 38.462 0.00 0.00 39.09 2.85
2750 2980 5.975988 TGGGAGTTTATTCCATAGAAGCT 57.024 39.130 0.00 0.00 39.09 3.74
2751 2981 6.327386 TGGGAGTTTATTCCATAGAAGCTT 57.673 37.500 0.00 0.00 39.09 3.74
2756 2986 5.817816 AGTTTATTCCATAGAAGCTTCACCG 59.182 40.000 27.57 14.43 34.86 4.94
2758 2988 3.695830 TTCCATAGAAGCTTCACCGTT 57.304 42.857 27.57 9.68 0.00 4.44
2759 2989 3.247006 TCCATAGAAGCTTCACCGTTC 57.753 47.619 27.57 0.00 0.00 3.95
2761 2991 3.119101 TCCATAGAAGCTTCACCGTTCTC 60.119 47.826 27.57 0.00 32.73 2.87
2762 2992 3.368427 CCATAGAAGCTTCACCGTTCTCA 60.368 47.826 27.57 2.33 32.73 3.27
2763 2993 2.447244 AGAAGCTTCACCGTTCTCAG 57.553 50.000 27.57 0.00 0.00 3.35
2766 2996 3.007398 AGAAGCTTCACCGTTCTCAGAAT 59.993 43.478 27.57 0.00 0.00 2.40
2767 2997 4.220821 AGAAGCTTCACCGTTCTCAGAATA 59.779 41.667 27.57 0.00 0.00 1.75
2769 2999 4.894784 AGCTTCACCGTTCTCAGAATAAA 58.105 39.130 0.00 0.00 0.00 1.40
2770 3000 4.932200 AGCTTCACCGTTCTCAGAATAAAG 59.068 41.667 0.00 0.00 0.00 1.85
2771 3001 4.691216 GCTTCACCGTTCTCAGAATAAAGT 59.309 41.667 0.00 0.00 0.00 2.66
2773 3003 6.539649 TTCACCGTTCTCAGAATAAAGTTG 57.460 37.500 0.00 0.00 0.00 3.16
2774 3004 4.451096 TCACCGTTCTCAGAATAAAGTTGC 59.549 41.667 0.00 0.00 0.00 4.17
2775 3005 4.213270 CACCGTTCTCAGAATAAAGTTGCA 59.787 41.667 0.00 0.00 0.00 4.08
2776 3006 4.452455 ACCGTTCTCAGAATAAAGTTGCAG 59.548 41.667 0.00 0.00 0.00 4.41
2777 3007 4.690748 CCGTTCTCAGAATAAAGTTGCAGA 59.309 41.667 0.00 0.00 0.00 4.26
2778 3008 5.352569 CCGTTCTCAGAATAAAGTTGCAGAT 59.647 40.000 0.00 0.00 0.00 2.90
2779 3009 6.128172 CCGTTCTCAGAATAAAGTTGCAGATT 60.128 38.462 0.00 0.00 0.00 2.40
2780 3010 6.740002 CGTTCTCAGAATAAAGTTGCAGATTG 59.260 38.462 0.00 0.00 0.00 2.67
2781 3011 7.571983 CGTTCTCAGAATAAAGTTGCAGATTGT 60.572 37.037 0.00 0.00 0.00 2.71
2782 3012 7.750229 TCTCAGAATAAAGTTGCAGATTGTT 57.250 32.000 0.00 0.00 0.00 2.83
2784 3014 9.283768 TCTCAGAATAAAGTTGCAGATTGTTTA 57.716 29.630 0.00 0.00 0.00 2.01
2785 3015 9.552114 CTCAGAATAAAGTTGCAGATTGTTTAG 57.448 33.333 0.00 0.00 0.00 1.85
2786 3016 8.023128 TCAGAATAAAGTTGCAGATTGTTTAGC 58.977 33.333 0.00 0.00 0.00 3.09
2787 3017 7.007725 CAGAATAAAGTTGCAGATTGTTTAGCG 59.992 37.037 0.00 0.00 0.00 4.26
2789 3019 4.410492 AAGTTGCAGATTGTTTAGCGAG 57.590 40.909 0.00 0.00 0.00 5.03
2790 3020 2.744202 AGTTGCAGATTGTTTAGCGAGG 59.256 45.455 0.00 0.00 0.00 4.63
2791 3021 2.472695 TGCAGATTGTTTAGCGAGGT 57.527 45.000 0.00 0.00 0.00 3.85
2793 3023 4.137116 TGCAGATTGTTTAGCGAGGTAT 57.863 40.909 0.00 0.00 0.00 2.73
2794 3024 5.270893 TGCAGATTGTTTAGCGAGGTATA 57.729 39.130 0.00 0.00 0.00 1.47
2795 3025 5.289595 TGCAGATTGTTTAGCGAGGTATAG 58.710 41.667 0.00 0.00 0.00 1.31
2796 3026 5.163447 TGCAGATTGTTTAGCGAGGTATAGT 60.163 40.000 0.00 0.00 0.00 2.12
2797 3027 5.402867 GCAGATTGTTTAGCGAGGTATAGTC 59.597 44.000 0.00 0.00 0.00 2.59
2799 3029 4.970662 TTGTTTAGCGAGGTATAGTCGT 57.029 40.909 6.35 0.00 39.69 4.34
2801 3031 5.409643 TGTTTAGCGAGGTATAGTCGTAC 57.590 43.478 6.35 0.00 39.69 3.67
2802 3032 5.118990 TGTTTAGCGAGGTATAGTCGTACT 58.881 41.667 6.35 0.00 39.69 2.73
2803 3033 5.007039 TGTTTAGCGAGGTATAGTCGTACTG 59.993 44.000 6.35 0.00 39.69 2.74
2804 3034 3.465742 AGCGAGGTATAGTCGTACTGA 57.534 47.619 6.35 0.00 39.69 3.41
2805 3035 3.801698 AGCGAGGTATAGTCGTACTGAA 58.198 45.455 6.35 0.00 39.69 3.02
2818 3048 3.813800 CGTACTGAACGTAGCACAACTA 58.186 45.455 0.00 0.00 46.72 2.24
2819 3049 4.409570 CGTACTGAACGTAGCACAACTAT 58.590 43.478 0.00 0.00 46.72 2.12
2820 3050 4.855388 CGTACTGAACGTAGCACAACTATT 59.145 41.667 0.00 0.00 46.72 1.73
2822 3052 5.591643 ACTGAACGTAGCACAACTATTTG 57.408 39.130 0.00 0.00 38.83 2.32
2823 3053 4.451096 ACTGAACGTAGCACAACTATTTGG 59.549 41.667 0.00 0.00 37.00 3.28
2824 3054 3.187637 TGAACGTAGCACAACTATTTGGC 59.812 43.478 0.00 0.00 37.00 4.52
2826 3056 4.196626 ACGTAGCACAACTATTTGGCTA 57.803 40.909 10.08 10.08 38.98 3.93
2827 3057 3.930848 ACGTAGCACAACTATTTGGCTAC 59.069 43.478 22.44 22.44 46.28 3.58
2830 3060 4.021102 AGCACAACTATTTGGCTACACT 57.979 40.909 6.90 0.00 37.43 3.55
2831 3061 3.753272 AGCACAACTATTTGGCTACACTG 59.247 43.478 6.90 0.00 37.43 3.66
2833 3063 4.142816 GCACAACTATTTGGCTACACTGAG 60.143 45.833 0.00 0.00 37.00 3.35
2834 3064 4.393062 CACAACTATTTGGCTACACTGAGG 59.607 45.833 0.00 0.00 37.00 3.86
2835 3065 3.914426 ACTATTTGGCTACACTGAGGG 57.086 47.619 0.00 0.00 0.00 4.30
2836 3066 2.092914 ACTATTTGGCTACACTGAGGGC 60.093 50.000 0.00 0.00 0.00 5.19
2837 3067 0.034089 ATTTGGCTACACTGAGGGCC 60.034 55.000 0.00 0.00 44.31 5.80
2839 3069 1.553690 TTGGCTACACTGAGGGCCTC 61.554 60.000 26.95 26.95 44.36 4.70
2840 3070 2.736826 GGCTACACTGAGGGCCTCC 61.737 68.421 30.03 12.79 41.20 4.30
2841 3071 1.990060 GCTACACTGAGGGCCTCCA 60.990 63.158 30.03 16.91 34.83 3.86
2845 3075 0.252696 ACACTGAGGGCCTCCATGTA 60.253 55.000 28.85 13.00 34.83 2.29
2847 3077 0.043334 ACTGAGGGCCTCCATGTACT 59.957 55.000 30.03 2.20 34.83 2.73
2848 3078 0.467384 CTGAGGGCCTCCATGTACTG 59.533 60.000 30.03 4.90 34.83 2.74
2849 3079 0.042581 TGAGGGCCTCCATGTACTGA 59.957 55.000 30.03 5.67 34.83 3.41
2850 3080 1.204146 GAGGGCCTCCATGTACTGAA 58.796 55.000 23.49 0.00 34.83 3.02
2852 3082 1.204146 GGGCCTCCATGTACTGAAGA 58.796 55.000 0.84 0.00 0.00 2.87
2854 3084 1.834263 GGCCTCCATGTACTGAAGACT 59.166 52.381 0.00 0.00 0.00 3.24
2855 3085 2.237392 GGCCTCCATGTACTGAAGACTT 59.763 50.000 0.00 0.00 0.00 3.01
2856 3086 3.451178 GGCCTCCATGTACTGAAGACTTA 59.549 47.826 0.00 0.00 0.00 2.24
2859 3089 5.740513 GCCTCCATGTACTGAAGACTTATCC 60.741 48.000 0.00 0.00 0.00 2.59
2860 3090 5.221541 CCTCCATGTACTGAAGACTTATCCC 60.222 48.000 0.00 0.00 0.00 3.85
2861 3091 5.529289 TCCATGTACTGAAGACTTATCCCT 58.471 41.667 0.00 0.00 0.00 4.20
2862 3092 5.598830 TCCATGTACTGAAGACTTATCCCTC 59.401 44.000 0.00 0.00 0.00 4.30
2866 3096 6.728411 TGTACTGAAGACTTATCCCTCTACA 58.272 40.000 0.00 0.00 0.00 2.74
2867 3097 6.602406 TGTACTGAAGACTTATCCCTCTACAC 59.398 42.308 0.00 0.00 0.00 2.90
2868 3098 5.833340 ACTGAAGACTTATCCCTCTACACT 58.167 41.667 0.00 0.00 0.00 3.55
2869 3099 5.654650 ACTGAAGACTTATCCCTCTACACTG 59.345 44.000 0.00 0.00 0.00 3.66
2870 3100 5.580998 TGAAGACTTATCCCTCTACACTGT 58.419 41.667 0.00 0.00 0.00 3.55
2873 3103 7.122353 TGAAGACTTATCCCTCTACACTGTAAC 59.878 40.741 0.00 0.00 0.00 2.50
2874 3104 6.733509 AGACTTATCCCTCTACACTGTAACT 58.266 40.000 0.00 0.00 0.00 2.24
2875 3105 6.829811 AGACTTATCCCTCTACACTGTAACTC 59.170 42.308 0.00 0.00 0.00 3.01
2876 3106 6.733509 ACTTATCCCTCTACACTGTAACTCT 58.266 40.000 0.00 0.00 0.00 3.24
2878 3108 3.698289 TCCCTCTACACTGTAACTCTGG 58.302 50.000 0.00 0.00 0.00 3.86
2879 3109 3.332783 TCCCTCTACACTGTAACTCTGGA 59.667 47.826 0.00 0.00 0.00 3.86
2881 3111 4.712337 CCCTCTACACTGTAACTCTGGAAT 59.288 45.833 0.00 0.00 0.00 3.01
2882 3112 5.187967 CCCTCTACACTGTAACTCTGGAATT 59.812 44.000 0.00 0.00 0.00 2.17
2883 3113 6.295916 CCCTCTACACTGTAACTCTGGAATTT 60.296 42.308 0.00 0.00 0.00 1.82
2885 3115 7.297936 TCTACACTGTAACTCTGGAATTTCA 57.702 36.000 0.00 0.00 0.00 2.69
2886 3116 7.732025 TCTACACTGTAACTCTGGAATTTCAA 58.268 34.615 0.00 0.00 0.00 2.69
2887 3117 8.208224 TCTACACTGTAACTCTGGAATTTCAAA 58.792 33.333 0.00 0.00 0.00 2.69
2888 3118 7.639113 ACACTGTAACTCTGGAATTTCAAAA 57.361 32.000 0.00 0.00 0.00 2.44
2889 3119 8.237811 ACACTGTAACTCTGGAATTTCAAAAT 57.762 30.769 0.00 0.00 0.00 1.82
2895 3125 9.841880 GTAACTCTGGAATTTCAAAATAAGACC 57.158 33.333 0.00 0.00 0.00 3.85
2896 3126 7.468141 ACTCTGGAATTTCAAAATAAGACCC 57.532 36.000 0.00 0.00 0.00 4.46
2897 3127 6.437477 ACTCTGGAATTTCAAAATAAGACCCC 59.563 38.462 0.00 0.00 0.00 4.95
2898 3128 6.561294 TCTGGAATTTCAAAATAAGACCCCT 58.439 36.000 0.00 0.00 0.00 4.79
2899 3129 7.016296 TCTGGAATTTCAAAATAAGACCCCTT 58.984 34.615 0.00 0.00 36.43 3.95
2900 3130 7.512402 TCTGGAATTTCAAAATAAGACCCCTTT 59.488 33.333 0.00 0.00 33.94 3.11
2901 3131 8.040002 TGGAATTTCAAAATAAGACCCCTTTT 57.960 30.769 0.00 0.00 33.94 2.27
2902 3132 8.154203 TGGAATTTCAAAATAAGACCCCTTTTC 58.846 33.333 0.00 0.00 33.94 2.29
2903 3133 8.154203 GGAATTTCAAAATAAGACCCCTTTTCA 58.846 33.333 0.00 0.00 33.94 2.69
2904 3134 8.902540 AATTTCAAAATAAGACCCCTTTTCAC 57.097 30.769 0.00 0.00 33.94 3.18
2905 3135 6.413783 TTCAAAATAAGACCCCTTTTCACC 57.586 37.500 0.00 0.00 33.94 4.02
2906 3136 4.836175 TCAAAATAAGACCCCTTTTCACCC 59.164 41.667 0.00 0.00 33.94 4.61
2907 3137 3.468071 AATAAGACCCCTTTTCACCCC 57.532 47.619 0.00 0.00 33.94 4.95
2908 3138 0.694196 TAAGACCCCTTTTCACCCCG 59.306 55.000 0.00 0.00 33.94 5.73
2909 3139 2.675423 GACCCCTTTTCACCCCGC 60.675 66.667 0.00 0.00 0.00 6.13
2910 3140 3.501040 GACCCCTTTTCACCCCGCA 62.501 63.158 0.00 0.00 0.00 5.69
2911 3141 2.203567 CCCCTTTTCACCCCGCAA 60.204 61.111 0.00 0.00 0.00 4.85
2912 3142 1.834822 CCCCTTTTCACCCCGCAAA 60.835 57.895 0.00 0.00 0.00 3.68
2913 3143 1.403687 CCCCTTTTCACCCCGCAAAA 61.404 55.000 0.00 0.00 0.00 2.44
2914 3144 0.466124 CCCTTTTCACCCCGCAAAAA 59.534 50.000 0.00 0.00 0.00 1.94
2935 3165 7.533289 AAAAATAAGTTAAGTAGCAAGGCCA 57.467 32.000 5.01 0.00 0.00 5.36
2936 3166 6.759497 AAATAAGTTAAGTAGCAAGGCCAG 57.241 37.500 5.01 0.00 0.00 4.85
2937 3167 5.693769 ATAAGTTAAGTAGCAAGGCCAGA 57.306 39.130 5.01 0.00 0.00 3.86
2938 3168 4.576330 AAGTTAAGTAGCAAGGCCAGAT 57.424 40.909 5.01 0.00 0.00 2.90
2939 3169 5.693769 AAGTTAAGTAGCAAGGCCAGATA 57.306 39.130 5.01 0.00 0.00 1.98
2940 3170 5.693769 AGTTAAGTAGCAAGGCCAGATAA 57.306 39.130 5.01 0.00 0.00 1.75
2941 3171 6.062258 AGTTAAGTAGCAAGGCCAGATAAA 57.938 37.500 5.01 0.00 0.00 1.40
2942 3172 6.663734 AGTTAAGTAGCAAGGCCAGATAAAT 58.336 36.000 5.01 0.00 0.00 1.40
2943 3173 7.119387 AGTTAAGTAGCAAGGCCAGATAAATT 58.881 34.615 5.01 1.80 0.00 1.82
2944 3174 7.615757 AGTTAAGTAGCAAGGCCAGATAAATTT 59.384 33.333 5.01 0.00 0.00 1.82
2945 3175 6.857437 AAGTAGCAAGGCCAGATAAATTTT 57.143 33.333 5.01 0.00 0.00 1.82
2946 3176 6.857437 AGTAGCAAGGCCAGATAAATTTTT 57.143 33.333 5.01 0.00 0.00 1.94
2947 3177 6.867550 AGTAGCAAGGCCAGATAAATTTTTC 58.132 36.000 5.01 0.00 0.00 2.29
2948 3178 4.747810 AGCAAGGCCAGATAAATTTTTCG 58.252 39.130 5.01 0.00 0.00 3.46
2949 3179 3.306973 GCAAGGCCAGATAAATTTTTCGC 59.693 43.478 5.01 0.00 0.00 4.70
2950 3180 4.493547 CAAGGCCAGATAAATTTTTCGCA 58.506 39.130 5.01 0.00 0.00 5.10
2951 3181 4.376340 AGGCCAGATAAATTTTTCGCAG 57.624 40.909 5.01 0.00 0.00 5.18
2952 3182 3.131046 AGGCCAGATAAATTTTTCGCAGG 59.869 43.478 5.01 4.95 0.00 4.85
2953 3183 2.860136 GCCAGATAAATTTTTCGCAGGC 59.140 45.455 18.72 18.72 0.00 4.85
2954 3184 3.429410 GCCAGATAAATTTTTCGCAGGCT 60.429 43.478 22.56 0.00 35.63 4.58
2955 3185 4.107622 CCAGATAAATTTTTCGCAGGCTG 58.892 43.478 10.94 10.94 0.00 4.85
2956 3186 4.380867 CCAGATAAATTTTTCGCAGGCTGT 60.381 41.667 17.16 0.00 0.00 4.40
2957 3187 4.560035 CAGATAAATTTTTCGCAGGCTGTG 59.440 41.667 21.77 21.77 0.00 3.66
2958 3188 2.888834 AAATTTTTCGCAGGCTGTGT 57.111 40.000 25.87 5.12 0.00 3.72
2959 3189 5.414454 AGATAAATTTTTCGCAGGCTGTGTA 59.586 36.000 25.87 15.42 0.00 2.90
2960 3190 4.314740 AAATTTTTCGCAGGCTGTGTAA 57.685 36.364 25.87 20.35 0.00 2.41
2961 3191 4.519540 AATTTTTCGCAGGCTGTGTAAT 57.480 36.364 25.87 19.46 0.00 1.89
2962 3192 4.519540 ATTTTTCGCAGGCTGTGTAATT 57.480 36.364 25.87 14.77 0.00 1.40
2963 3193 2.987413 TTTCGCAGGCTGTGTAATTG 57.013 45.000 25.87 3.81 0.00 2.32
2964 3194 0.521291 TTCGCAGGCTGTGTAATTGC 59.479 50.000 25.87 4.47 0.00 3.56
2965 3195 0.321564 TCGCAGGCTGTGTAATTGCT 60.322 50.000 25.87 0.00 32.80 3.91
2966 3196 0.097674 CGCAGGCTGTGTAATTGCTC 59.902 55.000 19.69 0.00 32.80 4.26
2967 3197 1.167851 GCAGGCTGTGTAATTGCTCA 58.832 50.000 17.16 0.00 0.00 4.26
2968 3198 1.747355 GCAGGCTGTGTAATTGCTCAT 59.253 47.619 17.16 0.00 0.00 2.90
2969 3199 2.165030 GCAGGCTGTGTAATTGCTCATT 59.835 45.455 17.16 0.00 0.00 2.57
2970 3200 3.766151 CAGGCTGTGTAATTGCTCATTG 58.234 45.455 6.28 0.00 0.00 2.82
2971 3201 2.165030 AGGCTGTGTAATTGCTCATTGC 59.835 45.455 0.00 0.91 43.25 3.56
2972 3202 2.179589 GCTGTGTAATTGCTCATTGCG 58.820 47.619 0.00 0.00 46.63 4.85
2973 3203 2.159531 GCTGTGTAATTGCTCATTGCGA 60.160 45.455 0.00 0.00 46.63 5.10
2974 3204 3.677601 CTGTGTAATTGCTCATTGCGAG 58.322 45.455 0.00 0.00 46.63 5.03
2975 3205 3.333804 TGTGTAATTGCTCATTGCGAGA 58.666 40.909 0.00 0.00 45.45 4.04
2976 3206 3.940852 TGTGTAATTGCTCATTGCGAGAT 59.059 39.130 0.00 0.00 45.45 2.75
2977 3207 4.201841 TGTGTAATTGCTCATTGCGAGATG 60.202 41.667 0.00 0.00 45.45 2.90
2978 3208 3.940852 TGTAATTGCTCATTGCGAGATGT 59.059 39.130 0.00 0.00 45.45 3.06
2979 3209 3.416119 AATTGCTCATTGCGAGATGTG 57.584 42.857 0.00 0.00 45.45 3.21
2980 3210 1.089112 TTGCTCATTGCGAGATGTGG 58.911 50.000 0.00 0.00 45.45 4.17
2981 3211 1.354506 GCTCATTGCGAGATGTGGC 59.645 57.895 0.00 0.00 45.45 5.01
2982 3212 1.094073 GCTCATTGCGAGATGTGGCT 61.094 55.000 0.00 0.00 45.45 4.75
2983 3213 0.935898 CTCATTGCGAGATGTGGCTC 59.064 55.000 0.00 0.00 45.45 4.70
2984 3214 0.462581 TCATTGCGAGATGTGGCTCC 60.463 55.000 0.00 0.00 0.00 4.70
2985 3215 1.153086 ATTGCGAGATGTGGCTCCC 60.153 57.895 0.00 0.00 0.00 4.30
2986 3216 1.630126 ATTGCGAGATGTGGCTCCCT 61.630 55.000 0.00 0.00 0.00 4.20
2987 3217 2.107953 GCGAGATGTGGCTCCCTC 59.892 66.667 0.00 0.00 0.00 4.30
2988 3218 2.430610 GCGAGATGTGGCTCCCTCT 61.431 63.158 0.00 0.00 0.00 3.69
2989 3219 1.109920 GCGAGATGTGGCTCCCTCTA 61.110 60.000 0.00 0.00 0.00 2.43
2990 3220 1.626686 CGAGATGTGGCTCCCTCTAT 58.373 55.000 0.00 0.00 0.00 1.98
2991 3221 1.271934 CGAGATGTGGCTCCCTCTATG 59.728 57.143 0.00 0.00 0.00 2.23
2992 3222 2.603021 GAGATGTGGCTCCCTCTATGA 58.397 52.381 0.00 0.00 0.00 2.15
2993 3223 3.172339 GAGATGTGGCTCCCTCTATGAT 58.828 50.000 0.00 0.00 0.00 2.45
2994 3224 3.582208 GAGATGTGGCTCCCTCTATGATT 59.418 47.826 0.00 0.00 0.00 2.57
2995 3225 3.327172 AGATGTGGCTCCCTCTATGATTG 59.673 47.826 0.00 0.00 0.00 2.67
2996 3226 2.481441 TGTGGCTCCCTCTATGATTGT 58.519 47.619 0.00 0.00 0.00 2.71
2997 3227 3.653164 TGTGGCTCCCTCTATGATTGTA 58.347 45.455 0.00 0.00 0.00 2.41
2998 3228 3.643320 TGTGGCTCCCTCTATGATTGTAG 59.357 47.826 0.00 0.00 0.00 2.74
2999 3229 2.634940 TGGCTCCCTCTATGATTGTAGC 59.365 50.000 0.00 0.00 0.00 3.58
3000 3230 2.634940 GGCTCCCTCTATGATTGTAGCA 59.365 50.000 0.00 0.00 0.00 3.49
3001 3231 3.071602 GGCTCCCTCTATGATTGTAGCAA 59.928 47.826 0.00 0.00 0.00 3.91
3002 3232 4.263243 GGCTCCCTCTATGATTGTAGCAAT 60.263 45.833 0.00 0.00 0.00 3.56
3003 3233 5.046304 GGCTCCCTCTATGATTGTAGCAATA 60.046 44.000 0.00 0.00 0.00 1.90
3004 3234 6.105333 GCTCCCTCTATGATTGTAGCAATAG 58.895 44.000 0.00 0.00 0.00 1.73
3005 3235 6.295575 GCTCCCTCTATGATTGTAGCAATAGT 60.296 42.308 0.00 0.00 0.00 2.12
3006 3236 7.618019 TCCCTCTATGATTGTAGCAATAGTT 57.382 36.000 0.00 0.00 0.00 2.24
3007 3237 7.445121 TCCCTCTATGATTGTAGCAATAGTTG 58.555 38.462 0.00 0.00 0.00 3.16
3008 3238 7.071196 TCCCTCTATGATTGTAGCAATAGTTGT 59.929 37.037 0.00 0.00 0.00 3.32
3009 3239 7.716998 CCCTCTATGATTGTAGCAATAGTTGTT 59.283 37.037 0.00 0.00 0.00 2.83
3010 3240 9.113838 CCTCTATGATTGTAGCAATAGTTGTTT 57.886 33.333 0.00 0.00 0.00 2.83
3012 3242 9.665719 TCTATGATTGTAGCAATAGTTGTTTCA 57.334 29.630 0.00 0.00 0.00 2.69
3017 3247 9.226345 GATTGTAGCAATAGTTGTTTCATTAGC 57.774 33.333 0.00 0.00 0.00 3.09
3018 3248 7.680442 TGTAGCAATAGTTGTTTCATTAGCA 57.320 32.000 0.00 0.00 0.00 3.49
3019 3249 8.105097 TGTAGCAATAGTTGTTTCATTAGCAA 57.895 30.769 0.00 0.00 0.00 3.91
3020 3250 8.572185 TGTAGCAATAGTTGTTTCATTAGCAAA 58.428 29.630 0.00 0.00 0.00 3.68
3021 3251 7.873739 AGCAATAGTTGTTTCATTAGCAAAC 57.126 32.000 0.00 0.00 34.79 2.93
3022 3252 7.661040 AGCAATAGTTGTTTCATTAGCAAACT 58.339 30.769 0.00 0.00 35.19 2.66
3023 3253 8.143835 AGCAATAGTTGTTTCATTAGCAAACTT 58.856 29.630 0.00 0.00 35.19 2.66
3024 3254 8.427774 GCAATAGTTGTTTCATTAGCAAACTTC 58.572 33.333 0.00 0.00 35.19 3.01
3025 3255 9.683069 CAATAGTTGTTTCATTAGCAAACTTCT 57.317 29.630 0.00 0.00 35.19 2.85
3027 3257 9.899226 ATAGTTGTTTCATTAGCAAACTTCTTC 57.101 29.630 0.00 0.00 35.19 2.87
3028 3258 7.203218 AGTTGTTTCATTAGCAAACTTCTTCC 58.797 34.615 0.00 0.00 35.19 3.46
3029 3259 5.757886 TGTTTCATTAGCAAACTTCTTCCG 58.242 37.500 0.00 0.00 35.19 4.30
3030 3260 5.154222 GTTTCATTAGCAAACTTCTTCCGG 58.846 41.667 0.00 0.00 32.01 5.14
3031 3261 2.747446 TCATTAGCAAACTTCTTCCGGC 59.253 45.455 0.00 0.00 0.00 6.13
3032 3262 2.264005 TTAGCAAACTTCTTCCGGCA 57.736 45.000 0.00 0.00 0.00 5.69
3033 3263 1.519408 TAGCAAACTTCTTCCGGCAC 58.481 50.000 0.00 0.00 0.00 5.01
3034 3264 0.465460 AGCAAACTTCTTCCGGCACA 60.465 50.000 0.00 0.00 0.00 4.57
3035 3265 0.383949 GCAAACTTCTTCCGGCACAA 59.616 50.000 0.00 0.00 0.00 3.33
3036 3266 1.202359 GCAAACTTCTTCCGGCACAAA 60.202 47.619 0.00 0.00 0.00 2.83
3037 3267 2.737039 GCAAACTTCTTCCGGCACAAAA 60.737 45.455 0.00 0.00 0.00 2.44
3038 3268 3.716601 CAAACTTCTTCCGGCACAAAAT 58.283 40.909 0.00 0.00 0.00 1.82
3039 3269 4.794655 GCAAACTTCTTCCGGCACAAAATA 60.795 41.667 0.00 0.00 0.00 1.40
3040 3270 4.766404 AACTTCTTCCGGCACAAAATAG 57.234 40.909 0.00 0.00 0.00 1.73
3041 3271 2.488153 ACTTCTTCCGGCACAAAATAGC 59.512 45.455 0.00 0.00 0.00 2.97
3042 3272 1.083489 TCTTCCGGCACAAAATAGCG 58.917 50.000 0.00 0.00 0.00 4.26
3043 3273 1.083489 CTTCCGGCACAAAATAGCGA 58.917 50.000 0.00 0.00 0.00 4.93
3044 3274 1.466950 CTTCCGGCACAAAATAGCGAA 59.533 47.619 0.00 0.00 0.00 4.70
3045 3275 1.083489 TCCGGCACAAAATAGCGAAG 58.917 50.000 0.00 0.00 0.00 3.79
3046 3276 0.802494 CCGGCACAAAATAGCGAAGT 59.198 50.000 0.00 0.00 0.00 3.01
3047 3277 1.199097 CCGGCACAAAATAGCGAAGTT 59.801 47.619 0.00 0.00 0.00 2.66
3048 3278 2.417239 CCGGCACAAAATAGCGAAGTTA 59.583 45.455 0.00 0.00 0.00 2.24
3049 3279 3.413558 CGGCACAAAATAGCGAAGTTAC 58.586 45.455 0.00 0.00 0.00 2.50
3050 3280 3.124636 CGGCACAAAATAGCGAAGTTACT 59.875 43.478 0.00 0.00 0.00 2.24
3051 3281 4.378046 CGGCACAAAATAGCGAAGTTACTT 60.378 41.667 0.00 0.00 0.00 2.24
3052 3282 5.458015 GGCACAAAATAGCGAAGTTACTTT 58.542 37.500 0.00 0.00 0.00 2.66
3053 3283 5.918576 GGCACAAAATAGCGAAGTTACTTTT 59.081 36.000 0.00 0.00 0.00 2.27
3054 3284 6.129194 GGCACAAAATAGCGAAGTTACTTTTG 60.129 38.462 0.00 0.72 37.51 2.44
3055 3285 6.635239 GCACAAAATAGCGAAGTTACTTTTGA 59.365 34.615 11.28 0.00 36.41 2.69
3056 3286 7.326063 GCACAAAATAGCGAAGTTACTTTTGAT 59.674 33.333 11.28 3.21 36.41 2.57
3057 3287 8.629986 CACAAAATAGCGAAGTTACTTTTGATG 58.370 33.333 11.28 2.43 36.41 3.07
3058 3288 8.349983 ACAAAATAGCGAAGTTACTTTTGATGT 58.650 29.630 11.28 2.90 36.41 3.06
3059 3289 9.820229 CAAAATAGCGAAGTTACTTTTGATGTA 57.180 29.630 0.00 0.00 35.76 2.29
3061 3291 5.532025 AGCGAAGTTACTTTTGATGTAGC 57.468 39.130 0.00 0.00 0.00 3.58
3062 3292 5.238583 AGCGAAGTTACTTTTGATGTAGCT 58.761 37.500 0.00 0.00 33.89 3.32
3063 3293 5.348997 AGCGAAGTTACTTTTGATGTAGCTC 59.651 40.000 0.00 0.00 31.84 4.09
3064 3294 5.120208 GCGAAGTTACTTTTGATGTAGCTCA 59.880 40.000 0.00 0.00 31.84 4.26
3065 3295 6.183360 GCGAAGTTACTTTTGATGTAGCTCAT 60.183 38.462 0.00 0.00 39.77 2.90
3076 3306 2.964740 TGTAGCTCATCTGAAGTGTGC 58.035 47.619 0.00 0.00 36.59 4.57
3077 3307 2.275318 GTAGCTCATCTGAAGTGTGCC 58.725 52.381 0.00 0.00 36.91 5.01
3078 3308 0.689055 AGCTCATCTGAAGTGTGCCA 59.311 50.000 2.66 0.00 36.91 4.92
3079 3309 1.281287 AGCTCATCTGAAGTGTGCCAT 59.719 47.619 2.66 0.00 36.91 4.40
3080 3310 2.502947 AGCTCATCTGAAGTGTGCCATA 59.497 45.455 2.66 0.00 36.91 2.74
3081 3311 3.054875 AGCTCATCTGAAGTGTGCCATAA 60.055 43.478 2.66 0.00 36.91 1.90
3082 3312 3.064545 GCTCATCTGAAGTGTGCCATAAC 59.935 47.826 0.00 0.00 31.76 1.89
3083 3313 4.511527 CTCATCTGAAGTGTGCCATAACT 58.488 43.478 0.00 0.00 0.00 2.24
3084 3314 4.507710 TCATCTGAAGTGTGCCATAACTC 58.492 43.478 0.00 0.00 0.00 3.01
3085 3315 4.020307 TCATCTGAAGTGTGCCATAACTCA 60.020 41.667 0.00 0.00 0.00 3.41
3086 3316 4.558226 TCTGAAGTGTGCCATAACTCAT 57.442 40.909 0.00 0.00 0.00 2.90
3087 3317 5.675684 TCTGAAGTGTGCCATAACTCATA 57.324 39.130 0.00 0.00 0.00 2.15
3088 3318 6.048732 TCTGAAGTGTGCCATAACTCATAA 57.951 37.500 0.00 0.00 0.00 1.90
3089 3319 6.108687 TCTGAAGTGTGCCATAACTCATAAG 58.891 40.000 0.00 0.00 0.00 1.73
3090 3320 5.804639 TGAAGTGTGCCATAACTCATAAGT 58.195 37.500 0.00 0.00 37.32 2.24
3091 3321 5.643348 TGAAGTGTGCCATAACTCATAAGTG 59.357 40.000 0.00 0.00 35.36 3.16
3092 3322 5.420725 AGTGTGCCATAACTCATAAGTGA 57.579 39.130 0.00 0.00 35.36 3.41
3093 3323 5.994250 AGTGTGCCATAACTCATAAGTGAT 58.006 37.500 0.00 0.00 35.36 3.06
3094 3324 5.819379 AGTGTGCCATAACTCATAAGTGATG 59.181 40.000 0.00 0.00 42.19 3.07
3095 3325 5.586243 GTGTGCCATAACTCATAAGTGATGT 59.414 40.000 0.00 0.00 41.30 3.06
3096 3326 6.761242 GTGTGCCATAACTCATAAGTGATGTA 59.239 38.462 0.00 0.00 41.30 2.29
3097 3327 6.986231 TGTGCCATAACTCATAAGTGATGTAG 59.014 38.462 0.00 0.00 41.30 2.74
3098 3328 5.991606 TGCCATAACTCATAAGTGATGTAGC 59.008 40.000 0.00 0.00 41.30 3.58
3099 3329 6.183361 TGCCATAACTCATAAGTGATGTAGCT 60.183 38.462 0.00 0.00 41.30 3.32
3100 3330 6.708054 GCCATAACTCATAAGTGATGTAGCTT 59.292 38.462 0.00 0.00 41.30 3.74
3101 3331 7.872993 GCCATAACTCATAAGTGATGTAGCTTA 59.127 37.037 0.00 0.00 41.30 3.09
3102 3332 9.935241 CCATAACTCATAAGTGATGTAGCTTAT 57.065 33.333 0.00 0.00 41.30 1.73
3106 3336 8.470657 ACTCATAAGTGATGTAGCTTATCTGA 57.529 34.615 0.00 0.00 36.20 3.27
3107 3337 8.918116 ACTCATAAGTGATGTAGCTTATCTGAA 58.082 33.333 0.00 0.00 36.20 3.02
3108 3338 9.409312 CTCATAAGTGATGTAGCTTATCTGAAG 57.591 37.037 0.00 0.00 36.20 3.02
3109 3339 8.918116 TCATAAGTGATGTAGCTTATCTGAAGT 58.082 33.333 0.00 0.00 36.20 3.01
3110 3340 8.976471 CATAAGTGATGTAGCTTATCTGAAGTG 58.024 37.037 0.00 0.00 36.20 3.16
3111 3341 5.355596 AGTGATGTAGCTTATCTGAAGTGC 58.644 41.667 0.00 0.00 0.00 4.40
3112 3342 4.208047 GTGATGTAGCTTATCTGAAGTGCG 59.792 45.833 0.00 0.00 0.00 5.34
3113 3343 2.540515 TGTAGCTTATCTGAAGTGCGC 58.459 47.619 0.00 0.00 0.00 6.09
3114 3344 1.861575 GTAGCTTATCTGAAGTGCGCC 59.138 52.381 4.18 0.00 0.00 6.53
3115 3345 0.250234 AGCTTATCTGAAGTGCGCCA 59.750 50.000 4.18 0.00 0.00 5.69
3116 3346 0.375106 GCTTATCTGAAGTGCGCCAC 59.625 55.000 4.18 3.02 34.10 5.01
3117 3347 1.725641 CTTATCTGAAGTGCGCCACA 58.274 50.000 4.18 0.00 36.74 4.17
3118 3348 2.076100 CTTATCTGAAGTGCGCCACAA 58.924 47.619 4.18 0.00 36.74 3.33
3119 3349 1.725641 TATCTGAAGTGCGCCACAAG 58.274 50.000 4.18 3.36 36.74 3.16
3120 3350 0.250467 ATCTGAAGTGCGCCACAAGT 60.250 50.000 4.18 0.00 36.74 3.16
3121 3351 1.159713 TCTGAAGTGCGCCACAAGTG 61.160 55.000 4.18 0.00 36.74 3.16
3122 3352 1.153269 TGAAGTGCGCCACAAGTGA 60.153 52.632 4.18 0.00 36.74 3.41
3123 3353 1.279840 GAAGTGCGCCACAAGTGAC 59.720 57.895 4.18 0.00 36.74 3.67
3124 3354 2.430080 GAAGTGCGCCACAAGTGACG 62.430 60.000 4.18 4.52 39.46 4.35
3125 3355 2.916502 AAGTGCGCCACAAGTGACGA 62.917 55.000 12.98 0.00 38.76 4.20
3126 3356 2.030412 TGCGCCACAAGTGACGAT 59.970 55.556 12.98 0.00 38.76 3.73
3127 3357 2.027073 TGCGCCACAAGTGACGATC 61.027 57.895 12.98 0.00 38.76 3.69
3128 3358 2.740714 GCGCCACAAGTGACGATCC 61.741 63.158 12.98 0.00 38.76 3.36
3129 3359 2.444624 CGCCACAAGTGACGATCCG 61.445 63.158 2.68 0.00 38.76 4.18
3130 3360 1.374252 GCCACAAGTGACGATCCGT 60.374 57.895 0.94 0.00 45.10 4.69
3131 3361 0.108992 GCCACAAGTGACGATCCGTA 60.109 55.000 0.94 0.00 41.37 4.02
3132 3362 1.909376 CCACAAGTGACGATCCGTAG 58.091 55.000 0.94 0.00 41.37 3.51
3133 3363 1.471287 CCACAAGTGACGATCCGTAGA 59.529 52.381 0.94 0.00 41.37 2.59
3134 3364 2.094906 CCACAAGTGACGATCCGTAGAA 60.095 50.000 0.94 0.00 41.37 2.10
3135 3365 3.428999 CCACAAGTGACGATCCGTAGAAT 60.429 47.826 0.94 0.00 41.37 2.40
3136 3366 3.547868 CACAAGTGACGATCCGTAGAATG 59.452 47.826 0.00 0.00 41.37 2.67
3137 3367 3.442625 ACAAGTGACGATCCGTAGAATGA 59.557 43.478 0.00 0.00 41.37 2.57
3138 3368 3.972950 AGTGACGATCCGTAGAATGAG 57.027 47.619 0.00 0.00 41.37 2.90
3139 3369 3.542648 AGTGACGATCCGTAGAATGAGA 58.457 45.455 0.00 0.00 41.37 3.27
3140 3370 3.562141 AGTGACGATCCGTAGAATGAGAG 59.438 47.826 0.00 0.00 41.37 3.20
3141 3371 3.312973 GTGACGATCCGTAGAATGAGAGT 59.687 47.826 0.00 0.00 41.37 3.24
3142 3372 3.312697 TGACGATCCGTAGAATGAGAGTG 59.687 47.826 0.00 0.00 41.37 3.51
3143 3373 3.280295 ACGATCCGTAGAATGAGAGTGT 58.720 45.455 0.00 0.00 38.73 3.55
3144 3374 3.065510 ACGATCCGTAGAATGAGAGTGTG 59.934 47.826 0.00 0.00 38.73 3.82
3145 3375 3.312697 CGATCCGTAGAATGAGAGTGTGA 59.687 47.826 0.00 0.00 0.00 3.58
3146 3376 4.023622 CGATCCGTAGAATGAGAGTGTGAT 60.024 45.833 0.00 0.00 0.00 3.06
3147 3377 5.506483 CGATCCGTAGAATGAGAGTGTGATT 60.506 44.000 0.00 0.00 0.00 2.57
3148 3378 5.250235 TCCGTAGAATGAGAGTGTGATTC 57.750 43.478 0.00 0.00 0.00 2.52
3149 3379 4.098044 TCCGTAGAATGAGAGTGTGATTCC 59.902 45.833 0.00 0.00 0.00 3.01
3150 3380 4.098654 CCGTAGAATGAGAGTGTGATTCCT 59.901 45.833 0.00 0.00 0.00 3.36
3151 3381 5.039984 CGTAGAATGAGAGTGTGATTCCTG 58.960 45.833 0.00 0.00 0.00 3.86
3152 3382 5.163612 CGTAGAATGAGAGTGTGATTCCTGA 60.164 44.000 0.00 0.00 0.00 3.86
3153 3383 5.954153 AGAATGAGAGTGTGATTCCTGAT 57.046 39.130 0.00 0.00 0.00 2.90
3154 3384 7.255277 CGTAGAATGAGAGTGTGATTCCTGATA 60.255 40.741 0.00 0.00 0.00 2.15
3155 3385 7.615039 AGAATGAGAGTGTGATTCCTGATAT 57.385 36.000 0.00 0.00 0.00 1.63
3156 3386 8.032045 AGAATGAGAGTGTGATTCCTGATATT 57.968 34.615 0.00 0.00 0.00 1.28
3157 3387 8.149647 AGAATGAGAGTGTGATTCCTGATATTC 58.850 37.037 0.00 0.00 0.00 1.75
3158 3388 6.796785 TGAGAGTGTGATTCCTGATATTCA 57.203 37.500 0.00 0.00 0.00 2.57
3159 3389 6.577103 TGAGAGTGTGATTCCTGATATTCAC 58.423 40.000 0.00 0.00 39.11 3.18
3160 3390 6.155049 TGAGAGTGTGATTCCTGATATTCACA 59.845 38.462 2.26 2.26 44.44 3.58
3164 3394 6.947644 TGTGATTCCTGATATTCACATTGG 57.052 37.500 2.26 0.00 42.46 3.16
3165 3395 5.300034 TGTGATTCCTGATATTCACATTGGC 59.700 40.000 2.26 0.00 42.46 4.52
3166 3396 5.533903 GTGATTCCTGATATTCACATTGGCT 59.466 40.000 0.00 0.00 38.63 4.75
3167 3397 6.712095 GTGATTCCTGATATTCACATTGGCTA 59.288 38.462 0.00 0.00 38.63 3.93
3168 3398 6.712095 TGATTCCTGATATTCACATTGGCTAC 59.288 38.462 0.00 0.00 0.00 3.58
3169 3399 5.628797 TCCTGATATTCACATTGGCTACA 57.371 39.130 0.00 0.00 0.00 2.74
3170 3400 5.368145 TCCTGATATTCACATTGGCTACAC 58.632 41.667 0.00 0.00 0.00 2.90
3171 3401 5.130975 TCCTGATATTCACATTGGCTACACT 59.869 40.000 0.00 0.00 0.00 3.55
3172 3402 6.326323 TCCTGATATTCACATTGGCTACACTA 59.674 38.462 0.00 0.00 0.00 2.74
3173 3403 6.992123 CCTGATATTCACATTGGCTACACTAA 59.008 38.462 0.00 0.00 0.00 2.24
3174 3404 7.041780 CCTGATATTCACATTGGCTACACTAAC 60.042 40.741 0.00 0.00 0.00 2.34
3175 3405 6.765989 TGATATTCACATTGGCTACACTAACC 59.234 38.462 0.00 0.00 0.00 2.85
3176 3406 4.359434 TTCACATTGGCTACACTAACCA 57.641 40.909 0.00 0.00 0.00 3.67
3177 3407 4.359434 TCACATTGGCTACACTAACCAA 57.641 40.909 0.00 0.00 46.87 3.67
3178 3408 4.720046 TCACATTGGCTACACTAACCAAA 58.280 39.130 0.00 0.00 46.01 3.28
3179 3409 4.517453 TCACATTGGCTACACTAACCAAAC 59.483 41.667 0.00 0.00 46.01 2.93
3180 3410 4.518970 CACATTGGCTACACTAACCAAACT 59.481 41.667 0.00 0.00 46.01 2.66
3181 3411 5.009610 CACATTGGCTACACTAACCAAACTT 59.990 40.000 0.00 0.00 46.01 2.66
3182 3412 6.205853 CACATTGGCTACACTAACCAAACTTA 59.794 38.462 0.00 0.00 46.01 2.24
3183 3413 6.946009 ACATTGGCTACACTAACCAAACTTAT 59.054 34.615 0.00 0.00 46.01 1.73
3184 3414 7.450323 ACATTGGCTACACTAACCAAACTTATT 59.550 33.333 0.00 0.00 46.01 1.40
3185 3415 7.826918 TTGGCTACACTAACCAAACTTATTT 57.173 32.000 0.00 0.00 40.42 1.40
3186 3416 7.826918 TGGCTACACTAACCAAACTTATTTT 57.173 32.000 0.00 0.00 0.00 1.82
3187 3417 7.878036 TGGCTACACTAACCAAACTTATTTTC 58.122 34.615 0.00 0.00 0.00 2.29
3188 3418 7.722285 TGGCTACACTAACCAAACTTATTTTCT 59.278 33.333 0.00 0.00 0.00 2.52
3189 3419 8.021396 GGCTACACTAACCAAACTTATTTTCTG 58.979 37.037 0.00 0.00 0.00 3.02
3190 3420 8.780249 GCTACACTAACCAAACTTATTTTCTGA 58.220 33.333 0.00 0.00 0.00 3.27
3193 3423 8.793592 ACACTAACCAAACTTATTTTCTGATCC 58.206 33.333 0.00 0.00 0.00 3.36
3194 3424 8.792633 CACTAACCAAACTTATTTTCTGATCCA 58.207 33.333 0.00 0.00 0.00 3.41
3195 3425 8.793592 ACTAACCAAACTTATTTTCTGATCCAC 58.206 33.333 0.00 0.00 0.00 4.02
3196 3426 7.595819 AACCAAACTTATTTTCTGATCCACA 57.404 32.000 0.00 0.00 0.00 4.17
3197 3427 6.981722 ACCAAACTTATTTTCTGATCCACAC 58.018 36.000 0.00 0.00 0.00 3.82
3198 3428 6.015434 ACCAAACTTATTTTCTGATCCACACC 60.015 38.462 0.00 0.00 0.00 4.16
3199 3429 5.880054 AACTTATTTTCTGATCCACACCG 57.120 39.130 0.00 0.00 0.00 4.94
3200 3430 5.160607 ACTTATTTTCTGATCCACACCGA 57.839 39.130 0.00 0.00 0.00 4.69
3201 3431 5.745227 ACTTATTTTCTGATCCACACCGAT 58.255 37.500 0.00 0.00 0.00 4.18
3202 3432 6.884832 ACTTATTTTCTGATCCACACCGATA 58.115 36.000 0.00 0.00 0.00 2.92
3203 3433 7.335627 ACTTATTTTCTGATCCACACCGATAA 58.664 34.615 0.00 0.00 0.00 1.75
3204 3434 7.495934 ACTTATTTTCTGATCCACACCGATAAG 59.504 37.037 0.00 0.00 0.00 1.73
3205 3435 5.414789 TTTTCTGATCCACACCGATAAGA 57.585 39.130 0.00 0.00 29.18 2.10
3206 3436 5.614324 TTTCTGATCCACACCGATAAGAT 57.386 39.130 0.00 0.00 31.05 2.40
3207 3437 6.724893 TTTCTGATCCACACCGATAAGATA 57.275 37.500 0.00 0.00 31.05 1.98
3208 3438 6.918067 TTCTGATCCACACCGATAAGATAT 57.082 37.500 0.00 0.00 31.05 1.63
3209 3439 6.272822 TCTGATCCACACCGATAAGATATG 57.727 41.667 0.00 0.00 26.46 1.78
3210 3440 6.010219 TCTGATCCACACCGATAAGATATGA 58.990 40.000 0.00 0.00 26.46 2.15
3211 3441 6.665248 TCTGATCCACACCGATAAGATATGAT 59.335 38.462 0.00 0.00 26.46 2.45
3212 3442 6.867550 TGATCCACACCGATAAGATATGATC 58.132 40.000 0.00 0.00 0.00 2.92
3213 3443 5.661056 TCCACACCGATAAGATATGATCC 57.339 43.478 0.00 0.00 0.00 3.36
3214 3444 4.466370 TCCACACCGATAAGATATGATCCC 59.534 45.833 0.00 0.00 0.00 3.85
3215 3445 4.222810 CCACACCGATAAGATATGATCCCA 59.777 45.833 0.00 0.00 0.00 4.37
3216 3446 5.279960 CCACACCGATAAGATATGATCCCAA 60.280 44.000 0.00 0.00 0.00 4.12
3217 3447 6.230472 CACACCGATAAGATATGATCCCAAA 58.770 40.000 0.00 0.00 0.00 3.28
3218 3448 6.147821 CACACCGATAAGATATGATCCCAAAC 59.852 42.308 0.00 0.00 0.00 2.93
3219 3449 6.183361 ACACCGATAAGATATGATCCCAAACA 60.183 38.462 0.00 0.00 0.00 2.83
3220 3450 6.147821 CACCGATAAGATATGATCCCAAACAC 59.852 42.308 0.00 0.00 0.00 3.32
3221 3451 6.183361 ACCGATAAGATATGATCCCAAACACA 60.183 38.462 0.00 0.00 0.00 3.72
3222 3452 6.710295 CCGATAAGATATGATCCCAAACACAA 59.290 38.462 0.00 0.00 0.00 3.33
3223 3453 7.228507 CCGATAAGATATGATCCCAAACACAAA 59.771 37.037 0.00 0.00 0.00 2.83
3224 3454 8.620416 CGATAAGATATGATCCCAAACACAAAA 58.380 33.333 0.00 0.00 0.00 2.44
3225 3455 9.956720 GATAAGATATGATCCCAAACACAAAAG 57.043 33.333 0.00 0.00 0.00 2.27
3226 3456 6.212888 AGATATGATCCCAAACACAAAAGC 57.787 37.500 0.00 0.00 0.00 3.51
3227 3457 5.716228 AGATATGATCCCAAACACAAAAGCA 59.284 36.000 0.00 0.00 0.00 3.91
3228 3458 4.686191 ATGATCCCAAACACAAAAGCAA 57.314 36.364 0.00 0.00 0.00 3.91
3229 3459 4.478206 TGATCCCAAACACAAAAGCAAA 57.522 36.364 0.00 0.00 0.00 3.68
3230 3460 4.187694 TGATCCCAAACACAAAAGCAAAC 58.812 39.130 0.00 0.00 0.00 2.93
3231 3461 3.685139 TCCCAAACACAAAAGCAAACA 57.315 38.095 0.00 0.00 0.00 2.83
3232 3462 4.213564 TCCCAAACACAAAAGCAAACAT 57.786 36.364 0.00 0.00 0.00 2.71
3233 3463 5.344743 TCCCAAACACAAAAGCAAACATA 57.655 34.783 0.00 0.00 0.00 2.29
3234 3464 5.112686 TCCCAAACACAAAAGCAAACATAC 58.887 37.500 0.00 0.00 0.00 2.39
3235 3465 4.872691 CCCAAACACAAAAGCAAACATACA 59.127 37.500 0.00 0.00 0.00 2.29
3236 3466 5.352569 CCCAAACACAAAAGCAAACATACAA 59.647 36.000 0.00 0.00 0.00 2.41
3237 3467 6.247176 CCAAACACAAAAGCAAACATACAAC 58.753 36.000 0.00 0.00 0.00 3.32
3238 3468 6.128445 CCAAACACAAAAGCAAACATACAACA 60.128 34.615 0.00 0.00 0.00 3.33
3239 3469 7.413877 CCAAACACAAAAGCAAACATACAACAT 60.414 33.333 0.00 0.00 0.00 2.71
3240 3470 8.598924 CAAACACAAAAGCAAACATACAACATA 58.401 29.630 0.00 0.00 0.00 2.29
3241 3471 8.709386 AACACAAAAGCAAACATACAACATAA 57.291 26.923 0.00 0.00 0.00 1.90
3242 3472 8.125728 ACACAAAAGCAAACATACAACATAAC 57.874 30.769 0.00 0.00 0.00 1.89
3243 3473 7.761704 ACACAAAAGCAAACATACAACATAACA 59.238 29.630 0.00 0.00 0.00 2.41
3244 3474 8.598924 CACAAAAGCAAACATACAACATAACAA 58.401 29.630 0.00 0.00 0.00 2.83
3245 3475 9.323985 ACAAAAGCAAACATACAACATAACAAT 57.676 25.926 0.00 0.00 0.00 2.71
3249 3479 9.973450 AAGCAAACATACAACATAACAATAACA 57.027 25.926 0.00 0.00 0.00 2.41
3250 3480 9.973450 AGCAAACATACAACATAACAATAACAA 57.027 25.926 0.00 0.00 0.00 2.83
3262 3492 9.453325 ACATAACAATAACAAACAAACTAACGG 57.547 29.630 0.00 0.00 0.00 4.44
3263 3493 9.666626 CATAACAATAACAAACAAACTAACGGA 57.333 29.630 0.00 0.00 0.00 4.69
3264 3494 7.974243 AACAATAACAAACAAACTAACGGAC 57.026 32.000 0.00 0.00 0.00 4.79
3265 3495 7.086230 ACAATAACAAACAAACTAACGGACA 57.914 32.000 0.00 0.00 0.00 4.02
3266 3496 7.708998 ACAATAACAAACAAACTAACGGACAT 58.291 30.769 0.00 0.00 0.00 3.06
3267 3497 7.646130 ACAATAACAAACAAACTAACGGACATG 59.354 33.333 0.00 0.00 0.00 3.21
3268 3498 4.561735 ACAAACAAACTAACGGACATGG 57.438 40.909 0.00 0.00 0.00 3.66
3269 3499 4.200874 ACAAACAAACTAACGGACATGGA 58.799 39.130 0.00 0.00 0.00 3.41
3270 3500 4.825085 ACAAACAAACTAACGGACATGGAT 59.175 37.500 0.00 0.00 0.00 3.41
3271 3501 5.300792 ACAAACAAACTAACGGACATGGATT 59.699 36.000 0.00 0.00 0.00 3.01
3272 3502 6.183360 ACAAACAAACTAACGGACATGGATTT 60.183 34.615 0.00 0.00 0.00 2.17
3273 3503 6.399639 AACAAACTAACGGACATGGATTTT 57.600 33.333 0.00 0.00 0.00 1.82
3274 3504 6.399639 ACAAACTAACGGACATGGATTTTT 57.600 33.333 0.00 0.00 0.00 1.94
3275 3505 6.443792 ACAAACTAACGGACATGGATTTTTC 58.556 36.000 0.00 0.00 0.00 2.29
3276 3506 4.939509 ACTAACGGACATGGATTTTTCG 57.060 40.909 0.00 0.00 0.00 3.46
3277 3507 4.571919 ACTAACGGACATGGATTTTTCGA 58.428 39.130 0.00 0.00 0.00 3.71
3278 3508 5.183228 ACTAACGGACATGGATTTTTCGAT 58.817 37.500 0.00 0.00 0.00 3.59
3279 3509 5.646360 ACTAACGGACATGGATTTTTCGATT 59.354 36.000 0.00 0.00 0.00 3.34
3280 3510 6.819649 ACTAACGGACATGGATTTTTCGATTA 59.180 34.615 0.00 0.00 0.00 1.75
3281 3511 6.503589 AACGGACATGGATTTTTCGATTAA 57.496 33.333 0.00 0.00 0.00 1.40
3282 3512 5.875930 ACGGACATGGATTTTTCGATTAAC 58.124 37.500 0.00 0.00 0.00 2.01
3283 3513 5.413213 ACGGACATGGATTTTTCGATTAACA 59.587 36.000 0.00 0.00 0.00 2.41
3284 3514 5.965334 CGGACATGGATTTTTCGATTAACAG 59.035 40.000 0.00 0.00 0.00 3.16
3285 3515 6.183360 CGGACATGGATTTTTCGATTAACAGA 60.183 38.462 0.00 0.00 0.00 3.41
3286 3516 7.535139 GGACATGGATTTTTCGATTAACAGAA 58.465 34.615 0.00 0.00 0.00 3.02
3287 3517 8.190784 GGACATGGATTTTTCGATTAACAGAAT 58.809 33.333 0.00 0.00 0.00 2.40
3292 3522 8.846211 TGGATTTTTCGATTAACAGAATATCCC 58.154 33.333 19.77 11.23 37.26 3.85
3293 3523 8.846211 GGATTTTTCGATTAACAGAATATCCCA 58.154 33.333 16.06 0.00 34.88 4.37
3294 3524 9.884465 GATTTTTCGATTAACAGAATATCCCAG 57.116 33.333 0.00 0.00 0.00 4.45
3295 3525 7.801716 TTTTCGATTAACAGAATATCCCAGG 57.198 36.000 0.00 0.00 0.00 4.45
3296 3526 4.894784 TCGATTAACAGAATATCCCAGGC 58.105 43.478 0.00 0.00 0.00 4.85
3297 3527 4.593206 TCGATTAACAGAATATCCCAGGCT 59.407 41.667 0.00 0.00 0.00 4.58
3298 3528 5.778241 TCGATTAACAGAATATCCCAGGCTA 59.222 40.000 0.00 0.00 0.00 3.93
3299 3529 6.269077 TCGATTAACAGAATATCCCAGGCTAA 59.731 38.462 0.00 0.00 0.00 3.09
3300 3530 6.934645 CGATTAACAGAATATCCCAGGCTAAA 59.065 38.462 0.00 0.00 0.00 1.85
3301 3531 7.444183 CGATTAACAGAATATCCCAGGCTAAAA 59.556 37.037 0.00 0.00 0.00 1.52
3302 3532 9.131791 GATTAACAGAATATCCCAGGCTAAAAA 57.868 33.333 0.00 0.00 0.00 1.94
3303 3533 9.660544 ATTAACAGAATATCCCAGGCTAAAAAT 57.339 29.630 0.00 0.00 0.00 1.82
3304 3534 7.588497 AACAGAATATCCCAGGCTAAAAATC 57.412 36.000 0.00 0.00 0.00 2.17
3305 3535 6.071320 ACAGAATATCCCAGGCTAAAAATCC 58.929 40.000 0.00 0.00 0.00 3.01
3306 3536 6.070656 CAGAATATCCCAGGCTAAAAATCCA 58.929 40.000 0.00 0.00 0.00 3.41
3307 3537 6.723052 CAGAATATCCCAGGCTAAAAATCCAT 59.277 38.462 0.00 0.00 0.00 3.41
3308 3538 7.234166 CAGAATATCCCAGGCTAAAAATCCATT 59.766 37.037 0.00 0.00 0.00 3.16
3309 3539 6.923199 ATATCCCAGGCTAAAAATCCATTG 57.077 37.500 0.00 0.00 0.00 2.82
3310 3540 4.329638 TCCCAGGCTAAAAATCCATTGA 57.670 40.909 0.00 0.00 0.00 2.57
3311 3541 4.882559 TCCCAGGCTAAAAATCCATTGAT 58.117 39.130 0.00 0.00 0.00 2.57
3312 3542 4.895297 TCCCAGGCTAAAAATCCATTGATC 59.105 41.667 0.00 0.00 0.00 2.92
3313 3543 4.650588 CCCAGGCTAAAAATCCATTGATCA 59.349 41.667 0.00 0.00 0.00 2.92
3314 3544 5.452356 CCCAGGCTAAAAATCCATTGATCAC 60.452 44.000 0.00 0.00 0.00 3.06
3315 3545 5.361857 CCAGGCTAAAAATCCATTGATCACT 59.638 40.000 0.00 0.00 0.00 3.41
3316 3546 6.127253 CCAGGCTAAAAATCCATTGATCACTT 60.127 38.462 0.00 0.00 0.00 3.16
3317 3547 6.755141 CAGGCTAAAAATCCATTGATCACTTG 59.245 38.462 0.00 0.00 0.00 3.16
3318 3548 6.664816 AGGCTAAAAATCCATTGATCACTTGA 59.335 34.615 0.00 0.00 0.00 3.02
3319 3549 7.178983 AGGCTAAAAATCCATTGATCACTTGAA 59.821 33.333 0.00 0.00 0.00 2.69
3320 3550 7.818930 GGCTAAAAATCCATTGATCACTTGAAA 59.181 33.333 0.00 0.00 0.00 2.69
3321 3551 9.206870 GCTAAAAATCCATTGATCACTTGAAAA 57.793 29.630 0.00 0.00 0.00 2.29
3338 3568 6.660887 TTGAAAAGGAAAACATTGACAAGC 57.339 33.333 0.00 0.00 0.00 4.01
3339 3569 5.976458 TGAAAAGGAAAACATTGACAAGCT 58.024 33.333 0.00 0.00 0.00 3.74
3340 3570 6.405538 TGAAAAGGAAAACATTGACAAGCTT 58.594 32.000 0.00 0.00 0.00 3.74
3341 3571 6.313411 TGAAAAGGAAAACATTGACAAGCTTG 59.687 34.615 24.84 24.84 0.00 4.01
3342 3572 5.343307 AAGGAAAACATTGACAAGCTTGT 57.657 34.783 31.57 31.57 45.65 3.16
3343 3573 6.463995 AAGGAAAACATTGACAAGCTTGTA 57.536 33.333 31.20 17.94 42.43 2.41
3344 3574 6.463995 AGGAAAACATTGACAAGCTTGTAA 57.536 33.333 31.20 22.56 42.43 2.41
3345 3575 6.872920 AGGAAAACATTGACAAGCTTGTAAA 58.127 32.000 31.20 29.38 42.43 2.01
3363 3593 7.739498 TTGTAAAGTTCCTTTCACAGATACC 57.261 36.000 0.00 0.00 35.21 2.73
3364 3594 6.235664 TGTAAAGTTCCTTTCACAGATACCC 58.764 40.000 0.00 0.00 35.21 3.69
3365 3595 3.611766 AGTTCCTTTCACAGATACCCG 57.388 47.619 0.00 0.00 0.00 5.28
3366 3596 2.904434 AGTTCCTTTCACAGATACCCGT 59.096 45.455 0.00 0.00 0.00 5.28
3367 3597 3.000727 GTTCCTTTCACAGATACCCGTG 58.999 50.000 0.00 0.00 34.34 4.94
3368 3598 2.253610 TCCTTTCACAGATACCCGTGT 58.746 47.619 0.00 0.00 34.66 4.49
3369 3599 2.232941 TCCTTTCACAGATACCCGTGTC 59.767 50.000 0.00 0.00 34.66 3.67
3370 3600 2.233922 CCTTTCACAGATACCCGTGTCT 59.766 50.000 0.00 0.00 34.66 3.41
3371 3601 3.446161 CCTTTCACAGATACCCGTGTCTA 59.554 47.826 0.00 0.00 34.66 2.59
3372 3602 4.421948 CTTTCACAGATACCCGTGTCTAC 58.578 47.826 0.00 0.00 34.66 2.59
3373 3603 3.076079 TCACAGATACCCGTGTCTACA 57.924 47.619 0.00 0.00 34.66 2.74
3374 3604 3.014623 TCACAGATACCCGTGTCTACAG 58.985 50.000 0.00 0.00 34.66 2.74
3375 3605 2.753452 CACAGATACCCGTGTCTACAGT 59.247 50.000 0.00 0.00 29.63 3.55
3376 3606 3.943381 CACAGATACCCGTGTCTACAGTA 59.057 47.826 0.00 0.00 29.63 2.74
3377 3607 3.944015 ACAGATACCCGTGTCTACAGTAC 59.056 47.826 0.00 0.00 29.63 2.73
3378 3608 3.314635 CAGATACCCGTGTCTACAGTACC 59.685 52.174 0.00 0.00 29.63 3.34
3379 3609 2.128771 TACCCGTGTCTACAGTACCC 57.871 55.000 0.00 0.00 0.00 3.69
3380 3610 0.112995 ACCCGTGTCTACAGTACCCA 59.887 55.000 0.00 0.00 0.00 4.51
3381 3611 0.529378 CCCGTGTCTACAGTACCCAC 59.471 60.000 0.00 0.00 0.00 4.61
3382 3612 0.529378 CCGTGTCTACAGTACCCACC 59.471 60.000 0.00 0.00 0.00 4.61
3383 3613 1.542492 CGTGTCTACAGTACCCACCT 58.458 55.000 0.00 0.00 0.00 4.00
3384 3614 2.618816 CCGTGTCTACAGTACCCACCTA 60.619 54.545 0.00 0.00 0.00 3.08
3385 3615 3.084039 CGTGTCTACAGTACCCACCTAA 58.916 50.000 0.00 0.00 0.00 2.69
3386 3616 3.698040 CGTGTCTACAGTACCCACCTAAT 59.302 47.826 0.00 0.00 0.00 1.73
3387 3617 4.159135 CGTGTCTACAGTACCCACCTAATT 59.841 45.833 0.00 0.00 0.00 1.40
3388 3618 5.337009 CGTGTCTACAGTACCCACCTAATTT 60.337 44.000 0.00 0.00 0.00 1.82
3389 3619 6.470278 GTGTCTACAGTACCCACCTAATTTT 58.530 40.000 0.00 0.00 0.00 1.82
3390 3620 6.592994 GTGTCTACAGTACCCACCTAATTTTC 59.407 42.308 0.00 0.00 0.00 2.29
3391 3621 5.809051 GTCTACAGTACCCACCTAATTTTCG 59.191 44.000 0.00 0.00 0.00 3.46
3392 3622 4.895668 ACAGTACCCACCTAATTTTCGA 57.104 40.909 0.00 0.00 0.00 3.71
3393 3623 5.231702 ACAGTACCCACCTAATTTTCGAA 57.768 39.130 0.00 0.00 0.00 3.71
3394 3624 4.999311 ACAGTACCCACCTAATTTTCGAAC 59.001 41.667 0.00 0.00 0.00 3.95
3395 3625 4.998672 CAGTACCCACCTAATTTTCGAACA 59.001 41.667 0.00 0.00 0.00 3.18
3396 3626 5.646360 CAGTACCCACCTAATTTTCGAACAT 59.354 40.000 0.00 0.00 0.00 2.71
3397 3627 6.819649 CAGTACCCACCTAATTTTCGAACATA 59.180 38.462 0.00 0.00 0.00 2.29
3398 3628 7.497909 CAGTACCCACCTAATTTTCGAACATAT 59.502 37.037 0.00 0.00 0.00 1.78
3399 3629 8.050930 AGTACCCACCTAATTTTCGAACATATT 58.949 33.333 0.00 1.00 0.00 1.28
3400 3630 9.328845 GTACCCACCTAATTTTCGAACATATTA 57.671 33.333 0.00 2.18 0.00 0.98
3401 3631 8.217131 ACCCACCTAATTTTCGAACATATTAC 57.783 34.615 0.00 0.00 0.00 1.89
3402 3632 8.050930 ACCCACCTAATTTTCGAACATATTACT 58.949 33.333 0.00 0.00 0.00 2.24
3403 3633 9.550406 CCCACCTAATTTTCGAACATATTACTA 57.450 33.333 0.00 0.00 0.00 1.82
3411 3641 9.712305 ATTTTCGAACATATTACTAGATGGAGG 57.288 33.333 0.00 0.00 0.00 4.30
3412 3642 8.473358 TTTCGAACATATTACTAGATGGAGGA 57.527 34.615 0.00 0.00 0.00 3.71
3413 3643 7.689446 TCGAACATATTACTAGATGGAGGAG 57.311 40.000 0.00 0.00 0.00 3.69
3414 3644 6.151312 TCGAACATATTACTAGATGGAGGAGC 59.849 42.308 0.00 0.00 0.00 4.70
3415 3645 6.613153 AACATATTACTAGATGGAGGAGCC 57.387 41.667 0.00 0.00 37.10 4.70
3425 3655 1.489481 TGGAGGAGCCAGATGTAGTG 58.511 55.000 0.00 0.00 43.33 2.74
3426 3656 1.273267 TGGAGGAGCCAGATGTAGTGT 60.273 52.381 0.00 0.00 43.33 3.55
3427 3657 1.410882 GGAGGAGCCAGATGTAGTGTC 59.589 57.143 0.00 0.00 36.34 3.67
3428 3658 1.410882 GAGGAGCCAGATGTAGTGTCC 59.589 57.143 0.00 0.00 0.00 4.02
3429 3659 1.007721 AGGAGCCAGATGTAGTGTCCT 59.992 52.381 0.00 0.00 0.00 3.85
3430 3660 1.137872 GGAGCCAGATGTAGTGTCCTG 59.862 57.143 0.00 0.00 0.00 3.86
3431 3661 0.539051 AGCCAGATGTAGTGTCCTGC 59.461 55.000 0.00 0.00 0.00 4.85
3432 3662 0.250234 GCCAGATGTAGTGTCCTGCA 59.750 55.000 0.00 0.00 37.72 4.41
3433 3663 1.339055 GCCAGATGTAGTGTCCTGCAA 60.339 52.381 0.00 0.00 36.85 4.08
3434 3664 2.875672 GCCAGATGTAGTGTCCTGCAAA 60.876 50.000 0.00 0.00 36.85 3.68
3435 3665 3.411446 CCAGATGTAGTGTCCTGCAAAA 58.589 45.455 0.00 0.00 36.85 2.44
3436 3666 3.438087 CCAGATGTAGTGTCCTGCAAAAG 59.562 47.826 0.00 0.00 36.85 2.27
3437 3667 4.318332 CAGATGTAGTGTCCTGCAAAAGA 58.682 43.478 0.00 0.00 36.85 2.52
3438 3668 4.756642 CAGATGTAGTGTCCTGCAAAAGAA 59.243 41.667 0.00 0.00 36.85 2.52
3439 3669 5.239306 CAGATGTAGTGTCCTGCAAAAGAAA 59.761 40.000 0.00 0.00 36.85 2.52
3440 3670 5.827797 AGATGTAGTGTCCTGCAAAAGAAAA 59.172 36.000 0.00 0.00 36.85 2.29
3441 3671 5.906113 TGTAGTGTCCTGCAAAAGAAAAA 57.094 34.783 0.00 0.00 29.69 1.94
3442 3672 5.646606 TGTAGTGTCCTGCAAAAGAAAAAC 58.353 37.500 0.00 0.00 29.69 2.43
3443 3673 4.123497 AGTGTCCTGCAAAAGAAAAACC 57.877 40.909 0.00 0.00 0.00 3.27
3444 3674 3.118775 AGTGTCCTGCAAAAGAAAAACCC 60.119 43.478 0.00 0.00 0.00 4.11
3445 3675 2.159170 TGTCCTGCAAAAGAAAAACCCG 60.159 45.455 0.00 0.00 0.00 5.28
3446 3676 1.410882 TCCTGCAAAAGAAAAACCCGG 59.589 47.619 0.00 0.00 0.00 5.73
3447 3677 1.138069 CCTGCAAAAGAAAAACCCGGT 59.862 47.619 0.00 0.00 0.00 5.28
3448 3678 2.362717 CCTGCAAAAGAAAAACCCGGTA 59.637 45.455 0.00 0.00 0.00 4.02
3449 3679 3.006430 CCTGCAAAAGAAAAACCCGGTAT 59.994 43.478 0.00 0.00 0.00 2.73
3450 3680 4.218852 CCTGCAAAAGAAAAACCCGGTATA 59.781 41.667 0.00 0.00 0.00 1.47
3451 3681 5.279056 CCTGCAAAAGAAAAACCCGGTATAA 60.279 40.000 0.00 0.00 0.00 0.98
3452 3682 6.347859 TGCAAAAGAAAAACCCGGTATAAT 57.652 33.333 0.00 0.00 0.00 1.28
3453 3683 6.391537 TGCAAAAGAAAAACCCGGTATAATC 58.608 36.000 0.00 0.00 0.00 1.75
3454 3684 6.015350 TGCAAAAGAAAAACCCGGTATAATCA 60.015 34.615 0.00 0.00 0.00 2.57
3455 3685 6.869388 GCAAAAGAAAAACCCGGTATAATCAA 59.131 34.615 0.00 0.00 0.00 2.57
3456 3686 7.148705 GCAAAAGAAAAACCCGGTATAATCAAC 60.149 37.037 0.00 0.00 0.00 3.18
3457 3687 7.527568 AAAGAAAAACCCGGTATAATCAACA 57.472 32.000 0.00 0.00 0.00 3.33
3458 3688 7.712204 AAGAAAAACCCGGTATAATCAACAT 57.288 32.000 0.00 0.00 0.00 2.71
3459 3689 7.329588 AGAAAAACCCGGTATAATCAACATC 57.670 36.000 0.00 0.00 0.00 3.06
3460 3690 6.320418 AGAAAAACCCGGTATAATCAACATCC 59.680 38.462 0.00 0.00 0.00 3.51
3461 3691 3.782656 ACCCGGTATAATCAACATCCC 57.217 47.619 0.00 0.00 0.00 3.85
3462 3692 3.323775 ACCCGGTATAATCAACATCCCT 58.676 45.455 0.00 0.00 0.00 4.20
3463 3693 4.495565 ACCCGGTATAATCAACATCCCTA 58.504 43.478 0.00 0.00 0.00 3.53
3464 3694 4.285260 ACCCGGTATAATCAACATCCCTAC 59.715 45.833 0.00 0.00 0.00 3.18
3465 3695 4.285003 CCCGGTATAATCAACATCCCTACA 59.715 45.833 0.00 0.00 0.00 2.74
3466 3696 5.045869 CCCGGTATAATCAACATCCCTACAT 60.046 44.000 0.00 0.00 0.00 2.29
3467 3697 6.155565 CCCGGTATAATCAACATCCCTACATA 59.844 42.308 0.00 0.00 0.00 2.29
3468 3698 7.147549 CCCGGTATAATCAACATCCCTACATAT 60.148 40.741 0.00 0.00 0.00 1.78
3469 3699 7.926555 CCGGTATAATCAACATCCCTACATATC 59.073 40.741 0.00 0.00 0.00 1.63
3470 3700 7.648112 CGGTATAATCAACATCCCTACATATCG 59.352 40.741 0.00 0.00 0.00 2.92
3471 3701 8.692710 GGTATAATCAACATCCCTACATATCGA 58.307 37.037 0.00 0.00 0.00 3.59
3472 3702 9.737427 GTATAATCAACATCCCTACATATCGAG 57.263 37.037 0.00 0.00 0.00 4.04
3473 3703 6.918067 AATCAACATCCCTACATATCGAGA 57.082 37.500 0.00 0.00 0.00 4.04
3474 3704 6.918067 ATCAACATCCCTACATATCGAGAA 57.082 37.500 0.00 0.00 0.00 2.87
3475 3705 6.724893 TCAACATCCCTACATATCGAGAAA 57.275 37.500 0.00 0.00 0.00 2.52
3476 3706 6.513180 TCAACATCCCTACATATCGAGAAAC 58.487 40.000 0.00 0.00 0.00 2.78
3477 3707 5.470047 ACATCCCTACATATCGAGAAACC 57.530 43.478 0.00 0.00 0.00 3.27
3478 3708 4.899457 ACATCCCTACATATCGAGAAACCA 59.101 41.667 0.00 0.00 0.00 3.67
3479 3709 5.011125 ACATCCCTACATATCGAGAAACCAG 59.989 44.000 0.00 0.00 0.00 4.00
3480 3710 4.543689 TCCCTACATATCGAGAAACCAGT 58.456 43.478 0.00 0.00 0.00 4.00
3481 3711 4.583489 TCCCTACATATCGAGAAACCAGTC 59.417 45.833 0.00 0.00 0.00 3.51
3482 3712 4.341235 CCCTACATATCGAGAAACCAGTCA 59.659 45.833 0.00 0.00 0.00 3.41
3483 3713 5.282510 CCTACATATCGAGAAACCAGTCAC 58.717 45.833 0.00 0.00 0.00 3.67
3484 3714 5.067936 CCTACATATCGAGAAACCAGTCACT 59.932 44.000 0.00 0.00 0.00 3.41
3485 3715 6.262496 CCTACATATCGAGAAACCAGTCACTA 59.738 42.308 0.00 0.00 0.00 2.74
3486 3716 6.716934 ACATATCGAGAAACCAGTCACTAT 57.283 37.500 0.00 0.00 0.00 2.12
3487 3717 6.507900 ACATATCGAGAAACCAGTCACTATG 58.492 40.000 0.00 0.00 0.00 2.23
3488 3718 3.868757 TCGAGAAACCAGTCACTATGG 57.131 47.619 0.00 0.00 43.87 2.74
3509 3739 5.500234 TGGTACAGATGGAAATTTCTCAGG 58.500 41.667 17.42 7.59 0.00 3.86
3510 3740 5.250543 TGGTACAGATGGAAATTTCTCAGGA 59.749 40.000 17.42 0.00 0.00 3.86
3511 3741 6.180472 GGTACAGATGGAAATTTCTCAGGAA 58.820 40.000 17.42 0.00 0.00 3.36
3512 3742 6.659242 GGTACAGATGGAAATTTCTCAGGAAA 59.341 38.462 17.42 0.00 44.26 3.13
<
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.565210 TGGTCATGATCGCATTTTGC 57.435 45.000 0.00 0.00 40.69 3.68
1 2 4.674475 TCAATGGTCATGATCGCATTTTG 58.326 39.130 0.00 0.00 30.68 2.44
2 3 4.987408 TCAATGGTCATGATCGCATTTT 57.013 36.364 0.00 0.00 30.68 1.82
3 4 4.641541 TCTTCAATGGTCATGATCGCATTT 59.358 37.500 0.00 0.00 30.68 2.32
4 5 4.201657 TCTTCAATGGTCATGATCGCATT 58.798 39.130 0.00 0.00 30.68 3.56
5 6 3.812262 TCTTCAATGGTCATGATCGCAT 58.188 40.909 0.00 0.00 34.29 4.73
6 7 3.264998 TCTTCAATGGTCATGATCGCA 57.735 42.857 0.00 0.00 0.00 5.10
7 8 4.825546 AATCTTCAATGGTCATGATCGC 57.174 40.909 0.00 0.00 0.00 4.58
8 9 7.662604 TCATAATCTTCAATGGTCATGATCG 57.337 36.000 0.00 0.00 0.00 3.69
28 29 9.630098 GTTGCATTGAGAGAAAGAAAAATCATA 57.370 29.630 0.00 0.00 0.00 2.15
29 30 8.365647 AGTTGCATTGAGAGAAAGAAAAATCAT 58.634 29.630 0.00 0.00 0.00 2.45
30 31 7.719483 AGTTGCATTGAGAGAAAGAAAAATCA 58.281 30.769 0.00 0.00 0.00 2.57
31 32 7.864379 TGAGTTGCATTGAGAGAAAGAAAAATC 59.136 33.333 0.00 0.00 0.00 2.17
32 33 7.650903 GTGAGTTGCATTGAGAGAAAGAAAAAT 59.349 33.333 0.00 0.00 0.00 1.82
33 34 6.974622 GTGAGTTGCATTGAGAGAAAGAAAAA 59.025 34.615 0.00 0.00 0.00 1.94
34 35 6.498304 GTGAGTTGCATTGAGAGAAAGAAAA 58.502 36.000 0.00 0.00 0.00 2.29
35 36 5.277490 CGTGAGTTGCATTGAGAGAAAGAAA 60.277 40.000 0.00 0.00 0.00 2.52
36 37 4.212004 CGTGAGTTGCATTGAGAGAAAGAA 59.788 41.667 0.00 0.00 0.00 2.52
37 38 3.742882 CGTGAGTTGCATTGAGAGAAAGA 59.257 43.478 0.00 0.00 0.00 2.52
38 39 3.120408 CCGTGAGTTGCATTGAGAGAAAG 60.120 47.826 0.00 0.00 0.00 2.62
39 40 2.807967 CCGTGAGTTGCATTGAGAGAAA 59.192 45.455 0.00 0.00 0.00 2.52
40 41 2.416747 CCGTGAGTTGCATTGAGAGAA 58.583 47.619 0.00 0.00 0.00 2.87
41 42 1.338105 CCCGTGAGTTGCATTGAGAGA 60.338 52.381 0.00 0.00 0.00 3.10
42 43 1.081892 CCCGTGAGTTGCATTGAGAG 58.918 55.000 0.00 0.00 0.00 3.20
43 44 0.955428 GCCCGTGAGTTGCATTGAGA 60.955 55.000 0.00 0.00 0.00 3.27
44 45 1.503542 GCCCGTGAGTTGCATTGAG 59.496 57.895 0.00 0.00 0.00 3.02
45 46 1.971167 GGCCCGTGAGTTGCATTGA 60.971 57.895 0.00 0.00 0.00 2.57
46 47 2.568090 GGCCCGTGAGTTGCATTG 59.432 61.111 0.00 0.00 0.00 2.82
47 48 2.676471 GGGCCCGTGAGTTGCATT 60.676 61.111 5.69 0.00 0.00 3.56
48 49 2.713531 AAAGGGCCCGTGAGTTGCAT 62.714 55.000 18.44 0.00 0.00 3.96
49 50 2.920076 AAAAGGGCCCGTGAGTTGCA 62.920 55.000 18.44 0.00 0.00 4.08
50 51 2.142357 GAAAAGGGCCCGTGAGTTGC 62.142 60.000 18.44 1.55 0.00 4.17
51 52 1.524008 GGAAAAGGGCCCGTGAGTTG 61.524 60.000 18.44 0.00 0.00 3.16
52 53 1.228459 GGAAAAGGGCCCGTGAGTT 60.228 57.895 18.44 4.10 0.00 3.01
53 54 0.838987 TAGGAAAAGGGCCCGTGAGT 60.839 55.000 18.44 1.68 0.00 3.41
54 55 0.392595 GTAGGAAAAGGGCCCGTGAG 60.393 60.000 18.44 0.00 0.00 3.51
55 56 0.838987 AGTAGGAAAAGGGCCCGTGA 60.839 55.000 18.44 0.00 0.00 4.35
56 57 0.392595 GAGTAGGAAAAGGGCCCGTG 60.393 60.000 18.44 0.00 0.00 4.94
57 58 0.546988 AGAGTAGGAAAAGGGCCCGT 60.547 55.000 18.44 11.44 0.00 5.28
58 59 1.492764 TAGAGTAGGAAAAGGGCCCG 58.507 55.000 18.44 0.00 0.00 6.13
59 60 5.548446 AGATATTAGAGTAGGAAAAGGGCCC 59.452 44.000 16.46 16.46 0.00 5.80
60 61 6.689663 AGATATTAGAGTAGGAAAAGGGCC 57.310 41.667 0.00 0.00 0.00 5.80
61 62 7.820386 GCTAAGATATTAGAGTAGGAAAAGGGC 59.180 40.741 11.29 0.00 0.00 5.19
62 63 8.315482 GGCTAAGATATTAGAGTAGGAAAAGGG 58.685 40.741 11.29 0.00 0.00 3.95
63 64 8.871125 TGGCTAAGATATTAGAGTAGGAAAAGG 58.129 37.037 11.29 0.00 0.00 3.11
64 65 9.921637 CTGGCTAAGATATTAGAGTAGGAAAAG 57.078 37.037 11.29 0.00 0.00 2.27
65 66 9.656323 TCTGGCTAAGATATTAGAGTAGGAAAA 57.344 33.333 11.29 0.00 0.00 2.29
66 67 9.080097 GTCTGGCTAAGATATTAGAGTAGGAAA 57.920 37.037 11.29 0.00 37.23 3.13
67 68 8.225416 TGTCTGGCTAAGATATTAGAGTAGGAA 58.775 37.037 11.29 0.00 37.23 3.36
68 69 7.666388 GTGTCTGGCTAAGATATTAGAGTAGGA 59.334 40.741 11.29 0.00 37.23 2.94
69 70 7.448777 TGTGTCTGGCTAAGATATTAGAGTAGG 59.551 40.741 11.29 0.00 37.23 3.18
70 71 8.397575 TGTGTCTGGCTAAGATATTAGAGTAG 57.602 38.462 11.29 5.56 37.23 2.57
71 72 8.630917 GTTGTGTCTGGCTAAGATATTAGAGTA 58.369 37.037 11.29 0.00 37.23 2.59
72 73 7.343316 AGTTGTGTCTGGCTAAGATATTAGAGT 59.657 37.037 11.29 0.00 37.23 3.24
73 74 7.721402 AGTTGTGTCTGGCTAAGATATTAGAG 58.279 38.462 11.29 0.83 37.23 2.43
74 75 7.661536 AGTTGTGTCTGGCTAAGATATTAGA 57.338 36.000 11.29 0.00 37.23 2.10
75 76 7.439655 GGAAGTTGTGTCTGGCTAAGATATTAG 59.560 40.741 2.62 2.62 37.23 1.73
76 77 7.125811 AGGAAGTTGTGTCTGGCTAAGATATTA 59.874 37.037 0.00 0.00 37.23 0.98
77 78 6.069963 AGGAAGTTGTGTCTGGCTAAGATATT 60.070 38.462 0.00 0.00 37.23 1.28
78 79 5.426833 AGGAAGTTGTGTCTGGCTAAGATAT 59.573 40.000 0.00 0.00 37.23 1.63
79 80 4.777896 AGGAAGTTGTGTCTGGCTAAGATA 59.222 41.667 0.00 0.00 37.23 1.98
80 81 3.584848 AGGAAGTTGTGTCTGGCTAAGAT 59.415 43.478 0.00 0.00 37.23 2.40
81 82 2.972713 AGGAAGTTGTGTCTGGCTAAGA 59.027 45.455 0.00 0.00 0.00 2.10
82 83 3.409026 AGGAAGTTGTGTCTGGCTAAG 57.591 47.619 0.00 0.00 0.00 2.18
83 84 4.347000 ACTTAGGAAGTTGTGTCTGGCTAA 59.653 41.667 0.00 0.00 39.04 3.09
84 85 3.901844 ACTTAGGAAGTTGTGTCTGGCTA 59.098 43.478 0.00 0.00 39.04 3.93
85 86 2.706190 ACTTAGGAAGTTGTGTCTGGCT 59.294 45.455 0.00 0.00 39.04 4.75
86 87 3.127425 ACTTAGGAAGTTGTGTCTGGC 57.873 47.619 0.00 0.00 39.04 4.85
96 97 7.557358 GGAGAGTACTAGCTTAACTTAGGAAGT 59.443 40.741 0.00 0.00 45.46 3.01
97 98 7.556996 TGGAGAGTACTAGCTTAACTTAGGAAG 59.443 40.741 0.00 0.00 0.00 3.46
98 99 7.408543 TGGAGAGTACTAGCTTAACTTAGGAA 58.591 38.462 0.00 0.00 0.00 3.36
99 100 6.966751 TGGAGAGTACTAGCTTAACTTAGGA 58.033 40.000 0.00 0.00 0.00 2.94
100 101 7.642082 TTGGAGAGTACTAGCTTAACTTAGG 57.358 40.000 0.00 0.00 0.00 2.69
104 105 8.145122 GCATTATTGGAGAGTACTAGCTTAACT 58.855 37.037 0.00 0.00 0.00 2.24
105 106 8.145122 AGCATTATTGGAGAGTACTAGCTTAAC 58.855 37.037 0.00 0.00 0.00 2.01
106 107 8.251383 AGCATTATTGGAGAGTACTAGCTTAA 57.749 34.615 0.00 0.00 0.00 1.85
107 108 7.841282 AGCATTATTGGAGAGTACTAGCTTA 57.159 36.000 0.00 0.00 0.00 3.09
108 109 6.739331 AGCATTATTGGAGAGTACTAGCTT 57.261 37.500 0.00 0.00 0.00 3.74
109 110 7.841282 TTAGCATTATTGGAGAGTACTAGCT 57.159 36.000 0.00 0.00 0.00 3.32
110 111 7.926555 TGTTTAGCATTATTGGAGAGTACTAGC 59.073 37.037 0.00 0.00 0.00 3.42
111 112 9.988815 ATGTTTAGCATTATTGGAGAGTACTAG 57.011 33.333 0.00 0.00 33.14 2.57
113 114 9.765795 GTATGTTTAGCATTATTGGAGAGTACT 57.234 33.333 0.00 0.00 38.94 2.73
114 115 9.542462 TGTATGTTTAGCATTATTGGAGAGTAC 57.458 33.333 0.00 0.00 38.94 2.73
116 117 9.461312 TTTGTATGTTTAGCATTATTGGAGAGT 57.539 29.630 0.00 0.00 38.94 3.24
117 118 9.941664 CTTTGTATGTTTAGCATTATTGGAGAG 57.058 33.333 0.00 0.00 38.94 3.20
118 119 9.679661 TCTTTGTATGTTTAGCATTATTGGAGA 57.320 29.630 0.00 0.00 38.94 3.71
119 120 9.941664 CTCTTTGTATGTTTAGCATTATTGGAG 57.058 33.333 0.00 0.00 38.94 3.86
120 121 9.461312 ACTCTTTGTATGTTTAGCATTATTGGA 57.539 29.630 0.00 0.00 38.94 3.53
126 127 8.227791 CGTGTAACTCTTTGTATGTTTAGCATT 58.772 33.333 0.00 0.00 35.02 3.56
127 128 7.623506 GCGTGTAACTCTTTGTATGTTTAGCAT 60.624 37.037 0.00 0.00 36.70 3.79
128 129 6.347079 GCGTGTAACTCTTTGTATGTTTAGCA 60.347 38.462 0.00 0.00 31.75 3.49
129 130 6.013689 GCGTGTAACTCTTTGTATGTTTAGC 58.986 40.000 0.00 0.00 31.75 3.09
130 131 7.112528 TGCGTGTAACTCTTTGTATGTTTAG 57.887 36.000 0.00 0.00 31.75 1.85
131 132 7.479897 TTGCGTGTAACTCTTTGTATGTTTA 57.520 32.000 0.00 0.00 31.75 2.01
132 133 5.994887 TGCGTGTAACTCTTTGTATGTTT 57.005 34.783 0.00 0.00 31.75 2.83
133 134 5.994887 TTGCGTGTAACTCTTTGTATGTT 57.005 34.783 0.00 0.00 31.75 2.71
134 135 6.554334 AATTGCGTGTAACTCTTTGTATGT 57.446 33.333 0.00 0.00 31.75 2.29
135 136 7.477422 GTGTAATTGCGTGTAACTCTTTGTATG 59.523 37.037 0.00 0.00 31.75 2.39
136 137 7.515643 GTGTAATTGCGTGTAACTCTTTGTAT 58.484 34.615 0.00 0.00 31.75 2.29
137 138 6.345961 CGTGTAATTGCGTGTAACTCTTTGTA 60.346 38.462 0.00 0.00 31.75 2.41
138 139 5.557514 CGTGTAATTGCGTGTAACTCTTTGT 60.558 40.000 0.00 0.00 31.75 2.83
139 140 4.838642 CGTGTAATTGCGTGTAACTCTTTG 59.161 41.667 0.00 0.00 31.75 2.77
140 141 4.609783 GCGTGTAATTGCGTGTAACTCTTT 60.610 41.667 0.00 0.00 31.75 2.52
141 142 3.120786 GCGTGTAATTGCGTGTAACTCTT 60.121 43.478 0.00 0.00 31.75 2.85
142 143 2.410730 GCGTGTAATTGCGTGTAACTCT 59.589 45.455 0.00 0.00 31.75 3.24
143 144 2.410730 AGCGTGTAATTGCGTGTAACTC 59.589 45.455 0.00 0.00 35.87 3.01
144 145 2.156891 CAGCGTGTAATTGCGTGTAACT 59.843 45.455 0.00 0.00 35.87 2.24
145 146 2.156117 TCAGCGTGTAATTGCGTGTAAC 59.844 45.455 0.00 0.00 35.87 2.50
146 147 2.156117 GTCAGCGTGTAATTGCGTGTAA 59.844 45.455 0.00 0.00 35.87 2.41
147 148 1.722464 GTCAGCGTGTAATTGCGTGTA 59.278 47.619 0.00 0.00 35.87 2.90
148 149 0.511221 GTCAGCGTGTAATTGCGTGT 59.489 50.000 0.00 0.00 35.87 4.49
149 150 0.790207 AGTCAGCGTGTAATTGCGTG 59.210 50.000 0.00 0.00 35.87 5.34
150 151 2.259618 CTAGTCAGCGTGTAATTGCGT 58.740 47.619 0.00 0.00 35.87 5.24
151 152 1.588404 CCTAGTCAGCGTGTAATTGCG 59.412 52.381 0.00 0.00 35.87 4.85
152 153 2.888594 TCCTAGTCAGCGTGTAATTGC 58.111 47.619 0.00 0.00 0.00 3.56
153 154 6.422776 AAAATCCTAGTCAGCGTGTAATTG 57.577 37.500 0.00 0.00 0.00 2.32
174 175 6.321945 GGGGAGTGGTTAGTTAGAAACAAAAA 59.678 38.462 0.00 0.00 0.00 1.94
175 176 5.829391 GGGGAGTGGTTAGTTAGAAACAAAA 59.171 40.000 0.00 0.00 0.00 2.44
176 177 5.379187 GGGGAGTGGTTAGTTAGAAACAAA 58.621 41.667 0.00 0.00 0.00 2.83
177 178 4.202493 GGGGGAGTGGTTAGTTAGAAACAA 60.202 45.833 0.00 0.00 0.00 2.83
178 179 3.328637 GGGGGAGTGGTTAGTTAGAAACA 59.671 47.826 0.00 0.00 0.00 2.83
179 180 3.947868 GGGGGAGTGGTTAGTTAGAAAC 58.052 50.000 0.00 0.00 0.00 2.78
201 202 2.167075 GCTCATCCCCATGAAAAACAGG 59.833 50.000 0.00 0.00 38.63 4.00
202 203 2.167075 GGCTCATCCCCATGAAAAACAG 59.833 50.000 0.00 0.00 38.63 3.16
203 204 2.178580 GGCTCATCCCCATGAAAAACA 58.821 47.619 0.00 0.00 38.63 2.83
204 205 2.967599 GGCTCATCCCCATGAAAAAC 57.032 50.000 0.00 0.00 38.63 2.43
216 217 2.851588 GGGGAGGAGGGGCTCATC 60.852 72.222 0.00 0.00 40.09 2.92
217 218 1.613284 TAAGGGGAGGAGGGGCTCAT 61.613 60.000 0.00 0.00 31.08 2.90
218 219 1.833055 TTAAGGGGAGGAGGGGCTCA 61.833 60.000 0.00 0.00 31.08 4.26
219 220 1.004361 TTAAGGGGAGGAGGGGCTC 59.996 63.158 0.00 0.00 0.00 4.70
220 221 1.307953 GTTAAGGGGAGGAGGGGCT 60.308 63.158 0.00 0.00 0.00 5.19
221 222 2.384433 GGTTAAGGGGAGGAGGGGC 61.384 68.421 0.00 0.00 0.00 5.80
222 223 0.694783 GAGGTTAAGGGGAGGAGGGG 60.695 65.000 0.00 0.00 0.00 4.79
223 224 0.694783 GGAGGTTAAGGGGAGGAGGG 60.695 65.000 0.00 0.00 0.00 4.30
224 225 0.044244 TGGAGGTTAAGGGGAGGAGG 59.956 60.000 0.00 0.00 0.00 4.30
225 226 1.966845 TTGGAGGTTAAGGGGAGGAG 58.033 55.000 0.00 0.00 0.00 3.69
226 227 2.226039 TGATTGGAGGTTAAGGGGAGGA 60.226 50.000 0.00 0.00 0.00 3.71
227 228 2.205342 TGATTGGAGGTTAAGGGGAGG 58.795 52.381 0.00 0.00 0.00 4.30
228 229 5.646692 TTATGATTGGAGGTTAAGGGGAG 57.353 43.478 0.00 0.00 0.00 4.30
229 230 5.340528 GGTTTATGATTGGAGGTTAAGGGGA 60.341 44.000 0.00 0.00 0.00 4.81
230 231 4.893524 GGTTTATGATTGGAGGTTAAGGGG 59.106 45.833 0.00 0.00 0.00 4.79
231 232 4.893524 GGGTTTATGATTGGAGGTTAAGGG 59.106 45.833 0.00 0.00 0.00 3.95
232 233 5.515106 TGGGTTTATGATTGGAGGTTAAGG 58.485 41.667 0.00 0.00 0.00 2.69
233 234 8.796475 CATATGGGTTTATGATTGGAGGTTAAG 58.204 37.037 0.00 0.00 32.36 1.85
234 235 8.285891 ACATATGGGTTTATGATTGGAGGTTAA 58.714 33.333 7.80 0.00 34.37 2.01
235 236 7.821566 ACATATGGGTTTATGATTGGAGGTTA 58.178 34.615 7.80 0.00 34.37 2.85
236 237 6.682537 ACATATGGGTTTATGATTGGAGGTT 58.317 36.000 7.80 0.00 34.37 3.50
237 238 6.279813 ACATATGGGTTTATGATTGGAGGT 57.720 37.500 7.80 0.00 34.37 3.85
238 239 7.069826 ACAAACATATGGGTTTATGATTGGAGG 59.930 37.037 7.80 0.00 42.26 4.30
239 240 8.010733 ACAAACATATGGGTTTATGATTGGAG 57.989 34.615 7.80 0.00 42.26 3.86
240 241 7.969690 ACAAACATATGGGTTTATGATTGGA 57.030 32.000 7.80 0.00 42.26 3.53
245 246 8.532819 GGGTTTTACAAACATATGGGTTTATGA 58.467 33.333 7.80 0.00 38.86 2.15
246 247 8.314751 TGGGTTTTACAAACATATGGGTTTATG 58.685 33.333 7.80 0.00 38.86 1.90
247 248 8.437274 TGGGTTTTACAAACATATGGGTTTAT 57.563 30.769 7.80 0.00 38.86 1.40
248 249 7.850935 TGGGTTTTACAAACATATGGGTTTA 57.149 32.000 7.80 0.00 38.86 2.01
249 250 6.749036 TGGGTTTTACAAACATATGGGTTT 57.251 33.333 7.80 0.00 41.44 3.27
250 251 6.271159 ACATGGGTTTTACAAACATATGGGTT 59.729 34.615 7.80 0.00 0.00 4.11
251 252 5.782845 ACATGGGTTTTACAAACATATGGGT 59.217 36.000 7.80 5.03 0.00 4.51
252 253 6.293004 ACATGGGTTTTACAAACATATGGG 57.707 37.500 7.80 0.00 0.00 4.00
253 254 9.145865 GTTTACATGGGTTTTACAAACATATGG 57.854 33.333 7.80 0.00 0.00 2.74
254 255 9.921637 AGTTTACATGGGTTTTACAAACATATG 57.078 29.630 0.00 0.00 0.00 1.78
258 259 9.751542 CATAAGTTTACATGGGTTTTACAAACA 57.248 29.630 0.00 0.00 0.00 2.83
259 260 9.752961 ACATAAGTTTACATGGGTTTTACAAAC 57.247 29.630 0.00 0.00 0.00 2.93
265 266 9.084533 ACACATACATAAGTTTACATGGGTTTT 57.915 29.630 0.00 0.00 25.53 2.43
266 267 8.644374 ACACATACATAAGTTTACATGGGTTT 57.356 30.769 0.00 0.00 25.53 3.27
267 268 9.391006 CTACACATACATAAGTTTACATGGGTT 57.609 33.333 0.00 0.00 32.57 4.11
268 269 8.764558 TCTACACATACATAAGTTTACATGGGT 58.235 33.333 0.00 0.00 34.57 4.51
269 270 9.778741 ATCTACACATACATAAGTTTACATGGG 57.221 33.333 0.00 0.00 0.00 4.00
283 284 9.682465 AGAGTACTGAGTAAATCTACACATACA 57.318 33.333 0.00 0.00 29.69 2.29
285 286 9.043079 CGAGAGTACTGAGTAAATCTACACATA 57.957 37.037 0.00 0.00 29.69 2.29
286 287 7.012515 CCGAGAGTACTGAGTAAATCTACACAT 59.987 40.741 0.00 0.00 29.69 3.21
287 288 6.315642 CCGAGAGTACTGAGTAAATCTACACA 59.684 42.308 0.00 0.00 0.00 3.72
288 289 6.315891 ACCGAGAGTACTGAGTAAATCTACAC 59.684 42.308 0.00 0.00 0.00 2.90
289 290 6.315642 CACCGAGAGTACTGAGTAAATCTACA 59.684 42.308 0.00 0.00 0.00 2.74
290 291 6.717413 CACCGAGAGTACTGAGTAAATCTAC 58.283 44.000 0.00 3.50 0.00 2.59
291 292 5.296283 GCACCGAGAGTACTGAGTAAATCTA 59.704 44.000 0.00 0.00 0.00 1.98
292 293 4.096682 GCACCGAGAGTACTGAGTAAATCT 59.903 45.833 0.00 7.99 0.00 2.40
293 294 4.142447 TGCACCGAGAGTACTGAGTAAATC 60.142 45.833 0.00 0.00 0.00 2.17
294 295 3.762288 TGCACCGAGAGTACTGAGTAAAT 59.238 43.478 0.00 0.00 0.00 1.40
295 296 3.057736 GTGCACCGAGAGTACTGAGTAAA 60.058 47.826 5.22 0.00 0.00 2.01
296 297 2.486982 GTGCACCGAGAGTACTGAGTAA 59.513 50.000 5.22 0.00 0.00 2.24
297 298 2.082231 GTGCACCGAGAGTACTGAGTA 58.918 52.381 5.22 0.00 0.00 2.59
298 299 0.882474 GTGCACCGAGAGTACTGAGT 59.118 55.000 5.22 0.00 0.00 3.41
299 300 0.881796 TGTGCACCGAGAGTACTGAG 59.118 55.000 15.69 0.00 0.00 3.35
300 301 0.596577 GTGTGCACCGAGAGTACTGA 59.403 55.000 15.69 0.00 0.00 3.41
301 302 0.313987 TGTGTGCACCGAGAGTACTG 59.686 55.000 15.69 0.00 0.00 2.74
302 303 0.314302 GTGTGTGCACCGAGAGTACT 59.686 55.000 15.69 0.00 39.61 2.73
303 304 2.810486 GTGTGTGCACCGAGAGTAC 58.190 57.895 15.69 4.20 39.61 2.73
312 313 0.303493 CTTGTACGTGGTGTGTGCAC 59.697 55.000 10.75 10.75 44.53 4.57
313 314 0.108089 ACTTGTACGTGGTGTGTGCA 60.108 50.000 0.00 0.00 0.00 4.57
314 315 0.580104 GACTTGTACGTGGTGTGTGC 59.420 55.000 0.00 0.00 0.00 4.57
315 316 1.214367 GGACTTGTACGTGGTGTGTG 58.786 55.000 0.00 0.00 0.00 3.82
316 317 0.825410 TGGACTTGTACGTGGTGTGT 59.175 50.000 0.00 0.00 0.00 3.72
317 318 1.942677 TTGGACTTGTACGTGGTGTG 58.057 50.000 0.00 0.00 0.00 3.82
318 319 2.282407 GTTTGGACTTGTACGTGGTGT 58.718 47.619 0.00 0.00 0.00 4.16
319 320 1.600485 GGTTTGGACTTGTACGTGGTG 59.400 52.381 0.00 0.00 0.00 4.17
320 321 1.209990 TGGTTTGGACTTGTACGTGGT 59.790 47.619 0.00 0.00 0.00 4.16
321 322 1.871039 CTGGTTTGGACTTGTACGTGG 59.129 52.381 0.00 0.00 0.00 4.94
322 323 2.542595 GTCTGGTTTGGACTTGTACGTG 59.457 50.000 0.00 0.00 0.00 4.49
323 324 2.433239 AGTCTGGTTTGGACTTGTACGT 59.567 45.455 0.00 0.00 40.65 3.57
324 325 2.800544 CAGTCTGGTTTGGACTTGTACG 59.199 50.000 0.00 0.00 41.45 3.67
325 326 4.067972 TCAGTCTGGTTTGGACTTGTAC 57.932 45.455 0.00 0.00 41.45 2.90
326 327 4.764050 TTCAGTCTGGTTTGGACTTGTA 57.236 40.909 0.00 0.00 41.45 2.41
327 328 3.644966 TTCAGTCTGGTTTGGACTTGT 57.355 42.857 0.00 0.00 41.45 3.16
328 329 3.304928 GCATTCAGTCTGGTTTGGACTTG 60.305 47.826 0.00 0.00 41.45 3.16
329 330 2.887152 GCATTCAGTCTGGTTTGGACTT 59.113 45.455 0.00 0.00 41.45 3.01
330 331 2.107204 AGCATTCAGTCTGGTTTGGACT 59.893 45.455 0.00 0.00 43.81 3.85
331 332 2.508526 AGCATTCAGTCTGGTTTGGAC 58.491 47.619 0.00 0.00 0.00 4.02
332 333 2.957402 AGCATTCAGTCTGGTTTGGA 57.043 45.000 0.00 0.00 0.00 3.53
333 334 3.411446 TGTAGCATTCAGTCTGGTTTGG 58.589 45.455 0.00 0.00 0.00 3.28
334 335 5.215160 GTTTGTAGCATTCAGTCTGGTTTG 58.785 41.667 0.00 0.00 0.00 2.93
335 336 4.278419 GGTTTGTAGCATTCAGTCTGGTTT 59.722 41.667 0.00 0.00 0.00 3.27
336 337 3.821033 GGTTTGTAGCATTCAGTCTGGTT 59.179 43.478 0.00 0.00 0.00 3.67
337 338 3.412386 GGTTTGTAGCATTCAGTCTGGT 58.588 45.455 0.00 0.00 0.00 4.00
338 339 2.749621 GGGTTTGTAGCATTCAGTCTGG 59.250 50.000 0.00 0.00 0.00 3.86
339 340 3.189287 GTGGGTTTGTAGCATTCAGTCTG 59.811 47.826 0.00 0.00 0.00 3.51
340 341 3.412386 GTGGGTTTGTAGCATTCAGTCT 58.588 45.455 0.00 0.00 0.00 3.24
341 342 2.159627 CGTGGGTTTGTAGCATTCAGTC 59.840 50.000 0.00 0.00 0.00 3.51
342 343 2.151202 CGTGGGTTTGTAGCATTCAGT 58.849 47.619 0.00 0.00 0.00 3.41
343 344 2.151202 ACGTGGGTTTGTAGCATTCAG 58.849 47.619 0.00 0.00 0.00 3.02
344 345 2.264005 ACGTGGGTTTGTAGCATTCA 57.736 45.000 0.00 0.00 0.00 2.57
345 346 3.068560 TGTACGTGGGTTTGTAGCATTC 58.931 45.455 0.00 0.00 0.00 2.67
346 347 3.128852 TGTACGTGGGTTTGTAGCATT 57.871 42.857 0.00 0.00 0.00 3.56
347 348 2.843401 TGTACGTGGGTTTGTAGCAT 57.157 45.000 0.00 0.00 0.00 3.79
348 349 2.613133 GTTTGTACGTGGGTTTGTAGCA 59.387 45.455 0.00 0.00 0.00 3.49
349 350 2.031769 GGTTTGTACGTGGGTTTGTAGC 60.032 50.000 0.00 0.00 0.00 3.58
350 351 3.249080 CAGGTTTGTACGTGGGTTTGTAG 59.751 47.826 0.00 0.00 36.70 2.74
351 352 3.118482 TCAGGTTTGTACGTGGGTTTGTA 60.118 43.478 0.00 0.00 39.88 2.41
352 353 2.018515 CAGGTTTGTACGTGGGTTTGT 58.981 47.619 0.00 0.00 36.70 2.83
353 354 2.290464 TCAGGTTTGTACGTGGGTTTG 58.710 47.619 0.00 0.00 39.88 2.93
354 355 2.684374 GTTCAGGTTTGTACGTGGGTTT 59.316 45.455 0.00 0.00 39.88 3.27
355 356 2.291365 GTTCAGGTTTGTACGTGGGTT 58.709 47.619 0.00 0.00 39.88 4.11
356 357 1.209990 TGTTCAGGTTTGTACGTGGGT 59.790 47.619 0.00 0.00 39.88 4.51
357 358 1.600485 GTGTTCAGGTTTGTACGTGGG 59.400 52.381 0.00 0.00 39.88 4.61
358 359 2.281517 TGTGTTCAGGTTTGTACGTGG 58.718 47.619 0.00 0.00 39.88 4.94
359 360 3.125487 TGTTGTGTTCAGGTTTGTACGTG 59.875 43.478 0.00 0.00 40.60 4.49
360 361 3.125658 GTGTTGTGTTCAGGTTTGTACGT 59.874 43.478 0.00 0.00 0.00 3.57
361 362 3.372822 AGTGTTGTGTTCAGGTTTGTACG 59.627 43.478 0.00 0.00 0.00 3.67
362 363 4.155280 ACAGTGTTGTGTTCAGGTTTGTAC 59.845 41.667 0.00 0.00 35.83 2.90
363 364 4.328536 ACAGTGTTGTGTTCAGGTTTGTA 58.671 39.130 0.00 0.00 35.83 2.41
364 365 3.153919 ACAGTGTTGTGTTCAGGTTTGT 58.846 40.909 0.00 0.00 35.83 2.83
365 366 3.848272 ACAGTGTTGTGTTCAGGTTTG 57.152 42.857 0.00 0.00 35.83 2.93
366 367 5.007682 AGTAACAGTGTTGTGTTCAGGTTT 58.992 37.500 18.90 0.00 41.06 3.27
367 368 4.585879 AGTAACAGTGTTGTGTTCAGGTT 58.414 39.130 18.90 0.00 41.06 3.50
368 369 4.216411 AGTAACAGTGTTGTGTTCAGGT 57.784 40.909 18.90 0.00 41.06 4.00
369 370 5.560966 AAAGTAACAGTGTTGTGTTCAGG 57.439 39.130 18.90 0.00 41.06 3.86
370 371 7.305474 AGAAAAAGTAACAGTGTTGTGTTCAG 58.695 34.615 18.90 0.00 41.06 3.02
371 372 7.209471 AGAAAAAGTAACAGTGTTGTGTTCA 57.791 32.000 18.90 0.00 41.06 3.18
372 373 9.783256 ATTAGAAAAAGTAACAGTGTTGTGTTC 57.217 29.630 18.90 13.17 41.06 3.18
373 374 9.783256 GATTAGAAAAAGTAACAGTGTTGTGTT 57.217 29.630 18.90 6.18 43.22 3.32
374 375 9.174166 AGATTAGAAAAAGTAACAGTGTTGTGT 57.826 29.630 18.90 0.00 37.67 3.72
383 384 9.582431 CGGATGAGTAGATTAGAAAAAGTAACA 57.418 33.333 0.00 0.00 0.00 2.41
384 385 9.032420 CCGGATGAGTAGATTAGAAAAAGTAAC 57.968 37.037 0.00 0.00 0.00 2.50
385 386 7.709613 GCCGGATGAGTAGATTAGAAAAAGTAA 59.290 37.037 5.05 0.00 0.00 2.24
386 387 7.147794 TGCCGGATGAGTAGATTAGAAAAAGTA 60.148 37.037 5.05 0.00 0.00 2.24
387 388 6.049790 GCCGGATGAGTAGATTAGAAAAAGT 58.950 40.000 5.05 0.00 0.00 2.66
388 389 6.049149 TGCCGGATGAGTAGATTAGAAAAAG 58.951 40.000 5.05 0.00 0.00 2.27
389 390 5.984725 TGCCGGATGAGTAGATTAGAAAAA 58.015 37.500 5.05 0.00 0.00 1.94
390 391 5.607939 TGCCGGATGAGTAGATTAGAAAA 57.392 39.130 5.05 0.00 0.00 2.29
391 392 5.357257 GTTGCCGGATGAGTAGATTAGAAA 58.643 41.667 5.05 0.00 0.00 2.52
392 393 4.202223 GGTTGCCGGATGAGTAGATTAGAA 60.202 45.833 5.05 0.00 0.00 2.10
393 394 3.321111 GGTTGCCGGATGAGTAGATTAGA 59.679 47.826 5.05 0.00 0.00 2.10
394 395 3.322254 AGGTTGCCGGATGAGTAGATTAG 59.678 47.826 5.05 0.00 0.00 1.73
395 396 3.305720 AGGTTGCCGGATGAGTAGATTA 58.694 45.455 5.05 0.00 0.00 1.75
396 397 2.119495 AGGTTGCCGGATGAGTAGATT 58.881 47.619 5.05 0.00 0.00 2.40
397 398 1.794714 AGGTTGCCGGATGAGTAGAT 58.205 50.000 5.05 0.00 0.00 1.98
398 399 1.207089 CAAGGTTGCCGGATGAGTAGA 59.793 52.381 5.05 0.00 0.00 2.59
399 400 1.207089 TCAAGGTTGCCGGATGAGTAG 59.793 52.381 5.05 0.00 0.00 2.57
400 401 1.271856 TCAAGGTTGCCGGATGAGTA 58.728 50.000 5.05 0.00 0.00 2.59
401 402 0.620556 ATCAAGGTTGCCGGATGAGT 59.379 50.000 5.05 0.00 0.00 3.41
402 403 1.303309 GATCAAGGTTGCCGGATGAG 58.697 55.000 5.05 0.00 0.00 2.90
403 404 0.617935 TGATCAAGGTTGCCGGATGA 59.382 50.000 5.05 0.00 0.00 2.92
404 405 1.133025 GTTGATCAAGGTTGCCGGATG 59.867 52.381 8.80 0.00 0.00 3.51
405 406 1.004745 AGTTGATCAAGGTTGCCGGAT 59.995 47.619 8.80 0.00 0.00 4.18
406 407 0.400213 AGTTGATCAAGGTTGCCGGA 59.600 50.000 8.80 0.00 0.00 5.14
407 408 1.068333 CAAGTTGATCAAGGTTGCCGG 60.068 52.381 8.80 0.00 0.00 6.13
408 409 1.666888 GCAAGTTGATCAAGGTTGCCG 60.667 52.381 29.31 10.92 36.32 5.69
409 410 1.615392 AGCAAGTTGATCAAGGTTGCC 59.385 47.619 32.59 22.32 40.03 4.52
410 411 4.503741 TTAGCAAGTTGATCAAGGTTGC 57.496 40.909 30.89 30.89 39.73 4.17
411 412 5.183713 TGGATTAGCAAGTTGATCAAGGTTG 59.816 40.000 19.61 19.61 0.00 3.77
412 413 5.324409 TGGATTAGCAAGTTGATCAAGGTT 58.676 37.500 8.80 2.65 0.00 3.50
413 414 4.922206 TGGATTAGCAAGTTGATCAAGGT 58.078 39.130 8.80 5.76 0.00 3.50
414 415 5.065731 GTCTGGATTAGCAAGTTGATCAAGG 59.934 44.000 8.80 2.86 0.00 3.61
415 416 5.645067 TGTCTGGATTAGCAAGTTGATCAAG 59.355 40.000 8.80 4.19 0.00 3.02
416 417 5.559770 TGTCTGGATTAGCAAGTTGATCAA 58.440 37.500 7.16 3.38 0.00 2.57
417 418 5.164620 TGTCTGGATTAGCAAGTTGATCA 57.835 39.130 7.16 0.00 0.00 2.92
418 419 6.500684 TTTGTCTGGATTAGCAAGTTGATC 57.499 37.500 7.16 0.63 0.00 2.92
419 420 6.899393 TTTTGTCTGGATTAGCAAGTTGAT 57.101 33.333 7.16 2.05 0.00 2.57
420 421 6.899393 ATTTTGTCTGGATTAGCAAGTTGA 57.101 33.333 7.16 0.00 0.00 3.18
421 422 7.965107 GTCTATTTTGTCTGGATTAGCAAGTTG 59.035 37.037 0.00 0.00 0.00 3.16
422 423 7.885399 AGTCTATTTTGTCTGGATTAGCAAGTT 59.115 33.333 0.00 0.00 0.00 2.66
423 424 7.398024 AGTCTATTTTGTCTGGATTAGCAAGT 58.602 34.615 0.00 0.00 0.00 3.16
424 425 7.856145 AGTCTATTTTGTCTGGATTAGCAAG 57.144 36.000 0.00 0.00 0.00 4.01
425 426 7.121168 CCAAGTCTATTTTGTCTGGATTAGCAA 59.879 37.037 0.00 0.00 0.00 3.91
426 427 6.599244 CCAAGTCTATTTTGTCTGGATTAGCA 59.401 38.462 0.00 0.00 0.00 3.49
427 428 6.038714 CCCAAGTCTATTTTGTCTGGATTAGC 59.961 42.308 0.00 0.00 0.00 3.09
428 429 6.038714 GCCCAAGTCTATTTTGTCTGGATTAG 59.961 42.308 0.00 0.00 0.00 1.73
429 430 5.885912 GCCCAAGTCTATTTTGTCTGGATTA 59.114 40.000 0.00 0.00 0.00 1.75
430 431 4.706962 GCCCAAGTCTATTTTGTCTGGATT 59.293 41.667 0.00 0.00 0.00 3.01
431 432 4.263905 TGCCCAAGTCTATTTTGTCTGGAT 60.264 41.667 0.00 0.00 0.00 3.41
432 433 3.073798 TGCCCAAGTCTATTTTGTCTGGA 59.926 43.478 0.00 0.00 0.00 3.86
433 434 3.420893 TGCCCAAGTCTATTTTGTCTGG 58.579 45.455 0.00 0.00 0.00 3.86
434 435 5.221224 TGTTTGCCCAAGTCTATTTTGTCTG 60.221 40.000 0.00 0.00 0.00 3.51
435 436 4.892934 TGTTTGCCCAAGTCTATTTTGTCT 59.107 37.500 0.00 0.00 0.00 3.41
436 437 4.982295 GTGTTTGCCCAAGTCTATTTTGTC 59.018 41.667 0.00 0.00 0.00 3.18
437 438 4.649218 AGTGTTTGCCCAAGTCTATTTTGT 59.351 37.500 0.00 0.00 0.00 2.83
438 439 4.984161 CAGTGTTTGCCCAAGTCTATTTTG 59.016 41.667 0.00 0.00 0.00 2.44
439 440 4.892934 TCAGTGTTTGCCCAAGTCTATTTT 59.107 37.500 0.00 0.00 0.00 1.82
440 441 4.278419 GTCAGTGTTTGCCCAAGTCTATTT 59.722 41.667 0.00 0.00 0.00 1.40
441 442 3.821033 GTCAGTGTTTGCCCAAGTCTATT 59.179 43.478 0.00 0.00 0.00 1.73
442 443 3.073062 AGTCAGTGTTTGCCCAAGTCTAT 59.927 43.478 0.00 0.00 0.00 1.98
443 444 2.438021 AGTCAGTGTTTGCCCAAGTCTA 59.562 45.455 0.00 0.00 0.00 2.59
444 445 1.212935 AGTCAGTGTTTGCCCAAGTCT 59.787 47.619 0.00 0.00 0.00 3.24
445 446 1.604278 GAGTCAGTGTTTGCCCAAGTC 59.396 52.381 0.00 0.00 0.00 3.01
446 447 1.064758 TGAGTCAGTGTTTGCCCAAGT 60.065 47.619 0.00 0.00 0.00 3.16
447 448 1.679139 TGAGTCAGTGTTTGCCCAAG 58.321 50.000 0.00 0.00 0.00 3.61
448 449 1.955778 CATGAGTCAGTGTTTGCCCAA 59.044 47.619 0.00 0.00 0.00 4.12
449 450 1.142667 TCATGAGTCAGTGTTTGCCCA 59.857 47.619 0.00 0.00 0.00 5.36
450 451 1.896220 TCATGAGTCAGTGTTTGCCC 58.104 50.000 0.00 0.00 0.00 5.36
451 452 5.575957 CATAATCATGAGTCAGTGTTTGCC 58.424 41.667 0.00 0.00 33.67 4.52
452 453 5.032863 GCATAATCATGAGTCAGTGTTTGC 58.967 41.667 0.00 0.26 33.67 3.68
453 454 6.432607 AGCATAATCATGAGTCAGTGTTTG 57.567 37.500 0.00 0.00 33.67 2.93
454 455 7.607607 TGTTAGCATAATCATGAGTCAGTGTTT 59.392 33.333 0.00 2.35 33.67 2.83
455 456 7.105588 TGTTAGCATAATCATGAGTCAGTGTT 58.894 34.615 0.00 0.00 33.67 3.32
456 457 6.643388 TGTTAGCATAATCATGAGTCAGTGT 58.357 36.000 0.00 0.00 33.67 3.55
457 458 6.292757 GCTGTTAGCATAATCATGAGTCAGTG 60.293 42.308 0.00 0.00 41.89 3.66
458 459 5.757320 GCTGTTAGCATAATCATGAGTCAGT 59.243 40.000 0.00 0.00 41.89 3.41
459 460 6.225703 GCTGTTAGCATAATCATGAGTCAG 57.774 41.667 0.00 0.00 41.89 3.51
474 475 1.133407 AGTCTCGTAGCTGCTGTTAGC 59.867 52.381 13.43 3.50 44.01 3.09
475 476 3.544440 CGTAGTCTCGTAGCTGCTGTTAG 60.544 52.174 13.43 6.53 0.00 2.34
476 477 2.350804 CGTAGTCTCGTAGCTGCTGTTA 59.649 50.000 13.43 0.00 0.00 2.41
477 478 1.130749 CGTAGTCTCGTAGCTGCTGTT 59.869 52.381 13.43 0.00 0.00 3.16
478 479 0.727970 CGTAGTCTCGTAGCTGCTGT 59.272 55.000 13.43 0.00 0.00 4.40
479 480 0.028242 CCGTAGTCTCGTAGCTGCTG 59.972 60.000 13.43 0.00 0.00 4.41
480 481 1.716826 GCCGTAGTCTCGTAGCTGCT 61.717 60.000 7.57 7.57 0.00 4.24
481 482 1.298488 GCCGTAGTCTCGTAGCTGC 60.298 63.158 0.00 0.00 0.00 5.25
482 483 0.305313 GAGCCGTAGTCTCGTAGCTG 59.695 60.000 0.00 0.00 0.00 4.24
483 484 0.178533 AGAGCCGTAGTCTCGTAGCT 59.821 55.000 0.00 0.00 37.72 3.32
484 485 0.582960 GAGAGCCGTAGTCTCGTAGC 59.417 60.000 0.00 0.00 37.72 3.58
485 486 1.937278 TGAGAGCCGTAGTCTCGTAG 58.063 55.000 0.00 0.00 37.72 3.51
486 487 2.210961 CATGAGAGCCGTAGTCTCGTA 58.789 52.381 0.00 0.00 37.72 3.43
487 488 1.018148 CATGAGAGCCGTAGTCTCGT 58.982 55.000 0.00 0.00 37.72 4.18
488 489 0.309302 CCATGAGAGCCGTAGTCTCG 59.691 60.000 0.00 0.00 37.72 4.04
489 490 0.031449 GCCATGAGAGCCGTAGTCTC 59.969 60.000 0.00 0.00 29.55 3.36
490 491 1.395826 GGCCATGAGAGCCGTAGTCT 61.396 60.000 0.00 0.00 41.41 3.24
491 492 1.068250 GGCCATGAGAGCCGTAGTC 59.932 63.158 0.00 0.00 41.41 2.59
492 493 3.221222 GGCCATGAGAGCCGTAGT 58.779 61.111 0.00 0.00 41.41 2.73
498 499 2.203181 GCTCCTGGCCATGAGAGC 60.203 66.667 34.41 30.53 44.36 4.09
509 510 2.338015 ATTTGCGTGCTGGCTCCTG 61.338 57.895 1.46 0.00 0.00 3.86
510 511 2.034687 ATTTGCGTGCTGGCTCCT 59.965 55.556 1.46 0.00 0.00 3.69
511 512 2.180017 CATTTGCGTGCTGGCTCC 59.820 61.111 1.46 0.00 0.00 4.70
512 513 1.154150 GTCATTTGCGTGCTGGCTC 60.154 57.895 1.46 0.00 0.00 4.70
513 514 1.580845 GAGTCATTTGCGTGCTGGCT 61.581 55.000 1.46 0.00 0.00 4.75
514 515 1.154150 GAGTCATTTGCGTGCTGGC 60.154 57.895 0.00 0.00 0.00 4.85
515 516 1.133253 CGAGTCATTTGCGTGCTGG 59.867 57.895 0.00 0.00 0.00 4.85
516 517 1.067693 TACGAGTCATTTGCGTGCTG 58.932 50.000 0.00 0.00 38.84 4.41
517 518 1.459592 GTTACGAGTCATTTGCGTGCT 59.540 47.619 0.00 0.00 38.84 4.40
518 519 1.463528 GGTTACGAGTCATTTGCGTGC 60.464 52.381 0.00 0.00 38.84 5.34
519 520 1.201769 CGGTTACGAGTCATTTGCGTG 60.202 52.381 0.00 0.00 44.60 5.34
520 521 1.065358 CGGTTACGAGTCATTTGCGT 58.935 50.000 0.00 0.00 44.60 5.24
521 522 1.058695 GACGGTTACGAGTCATTTGCG 59.941 52.381 0.00 0.00 44.60 4.85
522 523 1.392510 GGACGGTTACGAGTCATTTGC 59.607 52.381 10.64 0.00 44.60 3.68
523 524 2.679450 TGGACGGTTACGAGTCATTTG 58.321 47.619 10.64 0.00 44.60 2.32
524 525 3.259064 CATGGACGGTTACGAGTCATTT 58.741 45.455 10.64 0.00 44.60 2.32
525 526 2.888594 CATGGACGGTTACGAGTCATT 58.111 47.619 10.64 0.00 44.60 2.57
526 527 1.470979 GCATGGACGGTTACGAGTCAT 60.471 52.381 10.64 2.18 44.60 3.06
527 528 0.108992 GCATGGACGGTTACGAGTCA 60.109 55.000 10.64 0.34 44.60 3.41
528 529 0.172803 AGCATGGACGGTTACGAGTC 59.827 55.000 0.00 1.91 44.60 3.36
529 530 0.108804 CAGCATGGACGGTTACGAGT 60.109 55.000 0.00 0.00 44.60 4.18
530 531 0.108804 ACAGCATGGACGGTTACGAG 60.109 55.000 0.00 0.00 43.62 4.18
531 532 0.108992 GACAGCATGGACGGTTACGA 60.109 55.000 0.00 0.00 43.62 3.43
532 533 0.108804 AGACAGCATGGACGGTTACG 60.109 55.000 0.00 0.00 43.62 3.18
533 534 1.359848 CAGACAGCATGGACGGTTAC 58.640 55.000 0.00 0.00 43.62 2.50
534 535 0.391130 GCAGACAGCATGGACGGTTA 60.391 55.000 0.00 0.00 43.62 2.85
535 536 1.672356 GCAGACAGCATGGACGGTT 60.672 57.895 0.00 0.00 43.62 4.44
536 537 2.046892 GCAGACAGCATGGACGGT 60.047 61.111 0.00 0.00 43.62 4.83
545 546 4.767255 CCGACCTGGGCAGACAGC 62.767 72.222 0.00 0.00 44.65 4.40
554 555 3.687102 TGCGTGTACCCGACCTGG 61.687 66.667 0.63 0.00 37.55 4.45
555 556 2.431942 GTGCGTGTACCCGACCTG 60.432 66.667 0.63 0.00 0.00 4.00
556 557 4.047059 CGTGCGTGTACCCGACCT 62.047 66.667 0.63 0.00 0.00 3.85
558 559 4.347453 ACCGTGCGTGTACCCGAC 62.347 66.667 0.63 0.00 0.00 4.79
559 560 4.345962 CACCGTGCGTGTACCCGA 62.346 66.667 0.63 0.00 37.73 5.14
567 568 2.126228 CATACCGACACCGTGCGT 60.126 61.111 12.28 3.94 0.00 5.24
568 569 1.286354 AAACATACCGACACCGTGCG 61.286 55.000 0.00 3.53 0.00 5.34
569 570 0.165079 CAAACATACCGACACCGTGC 59.835 55.000 0.00 0.00 0.00 5.34
570 571 0.793861 CCAAACATACCGACACCGTG 59.206 55.000 0.00 0.00 0.00 4.94
571 572 0.393820 ACCAAACATACCGACACCGT 59.606 50.000 0.00 0.00 0.00 4.83
572 573 0.793861 CACCAAACATACCGACACCG 59.206 55.000 0.00 0.00 0.00 4.94
573 574 0.519961 GCACCAAACATACCGACACC 59.480 55.000 0.00 0.00 0.00 4.16
574 575 1.069500 GTGCACCAAACATACCGACAC 60.069 52.381 5.22 0.00 0.00 3.67
575 576 1.231221 GTGCACCAAACATACCGACA 58.769 50.000 5.22 0.00 0.00 4.35
576 577 1.231221 TGTGCACCAAACATACCGAC 58.769 50.000 15.69 0.00 0.00 4.79
577 578 1.809547 CATGTGCACCAAACATACCGA 59.190 47.619 15.69 0.00 36.10 4.69
578 579 1.135431 CCATGTGCACCAAACATACCG 60.135 52.381 15.69 0.00 36.10 4.02
579 580 1.892474 ACCATGTGCACCAAACATACC 59.108 47.619 15.69 0.00 36.10 2.73
580 581 2.352617 CCACCATGTGCACCAAACATAC 60.353 50.000 15.69 0.00 36.10 2.39
581 582 1.891811 CCACCATGTGCACCAAACATA 59.108 47.619 15.69 0.00 36.10 2.29
582 583 0.680618 CCACCATGTGCACCAAACAT 59.319 50.000 15.69 0.00 38.81 2.71
583 584 2.025767 GCCACCATGTGCACCAAACA 62.026 55.000 15.69 0.00 31.34 2.83
584 585 1.300853 GCCACCATGTGCACCAAAC 60.301 57.895 15.69 0.00 31.34 2.93
585 586 1.759692 TGCCACCATGTGCACCAAA 60.760 52.632 15.69 0.00 31.34 3.28
586 587 2.123554 TGCCACCATGTGCACCAA 60.124 55.556 15.69 0.00 31.34 3.67
587 588 2.911509 GTGCCACCATGTGCACCA 60.912 61.111 15.69 2.61 35.88 4.17
588 589 4.041917 CGTGCCACCATGTGCACC 62.042 66.667 15.69 0.00 37.32 5.01
589 590 2.969806 CTCGTGCCACCATGTGCAC 61.970 63.158 10.75 10.75 37.29 4.57
590 591 2.669229 CTCGTGCCACCATGTGCA 60.669 61.111 0.00 0.00 31.34 4.57
591 592 3.434319 CCTCGTGCCACCATGTGC 61.434 66.667 0.00 0.00 31.34 4.57
592 593 2.032528 ACCTCGTGCCACCATGTG 59.967 61.111 0.00 0.00 0.00 3.21
593 594 2.050836 TTGACCTCGTGCCACCATGT 62.051 55.000 0.00 0.00 0.00 3.21
594 595 0.677731 ATTGACCTCGTGCCACCATG 60.678 55.000 0.00 0.00 0.00 3.66
595 596 0.677731 CATTGACCTCGTGCCACCAT 60.678 55.000 0.00 0.00 0.00 3.55
596 597 1.302431 CATTGACCTCGTGCCACCA 60.302 57.895 0.00 0.00 0.00 4.17
597 598 2.040544 CCATTGACCTCGTGCCACC 61.041 63.158 0.00 0.00 0.00 4.61
598 599 1.302511 ACCATTGACCTCGTGCCAC 60.303 57.895 0.00 0.00 0.00 5.01
599 600 1.302431 CACCATTGACCTCGTGCCA 60.302 57.895 0.00 0.00 0.00 4.92
600 601 2.040544 CCACCATTGACCTCGTGCC 61.041 63.158 0.00 0.00 0.00 5.01
601 602 2.690778 GCCACCATTGACCTCGTGC 61.691 63.158 0.00 0.00 0.00 5.34
602 603 1.302431 TGCCACCATTGACCTCGTG 60.302 57.895 0.00 0.00 0.00 4.35
603 604 1.302511 GTGCCACCATTGACCTCGT 60.303 57.895 0.00 0.00 0.00 4.18
604 605 2.390599 CGTGCCACCATTGACCTCG 61.391 63.158 0.00 0.00 0.00 4.63
605 606 2.040544 CCGTGCCACCATTGACCTC 61.041 63.158 0.00 0.00 0.00 3.85
606 607 2.034066 CCGTGCCACCATTGACCT 59.966 61.111 0.00 0.00 0.00 3.85
607 608 2.282180 ACCGTGCCACCATTGACC 60.282 61.111 0.00 0.00 0.00 4.02
608 609 2.625823 CCACCGTGCCACCATTGAC 61.626 63.158 0.00 0.00 0.00 3.18
609 610 2.282110 CCACCGTGCCACCATTGA 60.282 61.111 0.00 0.00 0.00 2.57
610 611 4.054825 GCCACCGTGCCACCATTG 62.055 66.667 0.00 0.00 0.00 2.82
611 612 4.594854 TGCCACCGTGCCACCATT 62.595 61.111 0.00 0.00 0.00 3.16
618 619 4.794648 TATGGGCTGCCACCGTGC 62.795 66.667 22.05 1.86 0.00 5.34
619 620 2.824041 GTATGGGCTGCCACCGTG 60.824 66.667 22.05 0.00 0.00 4.94
620 621 4.467084 CGTATGGGCTGCCACCGT 62.467 66.667 22.05 7.95 0.00 4.83
622 623 3.757248 CTCCGTATGGGCTGCCACC 62.757 68.421 22.05 4.31 35.24 4.61
623 624 2.203070 CTCCGTATGGGCTGCCAC 60.203 66.667 22.05 9.34 35.24 5.01
624 625 4.175337 GCTCCGTATGGGCTGCCA 62.175 66.667 22.05 7.16 35.24 4.92
625 626 4.175337 TGCTCCGTATGGGCTGCC 62.175 66.667 11.05 11.05 35.17 4.85
626 627 2.897350 GTGCTCCGTATGGGCTGC 60.897 66.667 13.51 10.44 36.13 5.25
627 628 2.586079 CGTGCTCCGTATGGGCTG 60.586 66.667 13.51 5.05 33.90 4.85
628 629 3.849951 CCGTGCTCCGTATGGGCT 61.850 66.667 13.51 0.00 33.90 5.19
629 630 4.157120 ACCGTGCTCCGTATGGGC 62.157 66.667 0.00 4.36 35.24 5.36
630 631 2.202878 CACCGTGCTCCGTATGGG 60.203 66.667 0.00 0.00 35.24 4.00
631 632 2.890474 GCACCGTGCTCCGTATGG 60.890 66.667 16.51 0.00 40.96 2.74
632 633 2.890474 GGCACCGTGCTCCGTATG 60.890 66.667 22.41 0.00 44.28 2.39
633 634 2.949909 TTGGCACCGTGCTCCGTAT 61.950 57.895 22.41 0.00 44.28 3.06
634 635 3.617735 TTGGCACCGTGCTCCGTA 61.618 61.111 22.41 2.67 44.28 4.02
648 649 4.680237 TGAGCTCGGCGTGGTTGG 62.680 66.667 15.07 0.00 0.00 3.77
649 650 3.414700 GTGAGCTCGGCGTGGTTG 61.415 66.667 15.07 0.00 0.00 3.77
650 651 4.681978 GGTGAGCTCGGCGTGGTT 62.682 66.667 15.07 3.48 0.00 3.67
652 653 4.457496 ATGGTGAGCTCGGCGTGG 62.457 66.667 9.64 2.22 0.00 4.94
653 654 2.913054 ATCATGGTGAGCTCGGCGTG 62.913 60.000 9.64 5.49 0.00 5.34
654 655 2.725312 ATCATGGTGAGCTCGGCGT 61.725 57.895 9.64 0.00 0.00 5.68
655 656 2.107750 ATCATGGTGAGCTCGGCG 59.892 61.111 9.64 0.00 0.00 6.46
656 657 2.541120 GCATCATGGTGAGCTCGGC 61.541 63.158 11.02 4.32 0.00 5.54
657 658 1.153309 TGCATCATGGTGAGCTCGG 60.153 57.895 11.02 0.00 0.00 4.63
658 659 0.741927 TGTGCATCATGGTGAGCTCG 60.742 55.000 11.02 0.00 0.00 5.03
659 660 1.676746 ATGTGCATCATGGTGAGCTC 58.323 50.000 11.02 6.82 35.19 4.09
660 661 3.896854 ATGTGCATCATGGTGAGCT 57.103 47.368 11.02 0.00 35.19 4.09
704 705 9.211485 GGGATCCGAATCGATTAATTTAACTAA 57.789 33.333 11.38 0.00 32.24 2.24
705 706 8.369424 TGGGATCCGAATCGATTAATTTAACTA 58.631 33.333 11.38 0.00 32.24 2.24
706 707 7.221450 TGGGATCCGAATCGATTAATTTAACT 58.779 34.615 11.38 0.00 32.24 2.24
707 708 7.429636 TGGGATCCGAATCGATTAATTTAAC 57.570 36.000 11.38 1.04 32.24 2.01
708 709 8.630054 AATGGGATCCGAATCGATTAATTTAA 57.370 30.769 11.38 0.00 32.24 1.52
709 710 9.727859 TTAATGGGATCCGAATCGATTAATTTA 57.272 29.630 11.38 0.00 30.03 1.40
710 711 8.630054 TTAATGGGATCCGAATCGATTAATTT 57.370 30.769 11.38 0.00 30.03 1.82
711 712 8.630054 TTTAATGGGATCCGAATCGATTAATT 57.370 30.769 11.38 4.36 32.49 1.40
712 713 8.630054 TTTTAATGGGATCCGAATCGATTAAT 57.370 30.769 11.38 5.28 32.49 1.40
713 714 8.453238 TTTTTAATGGGATCCGAATCGATTAA 57.547 30.769 11.38 2.67 31.52 1.40
715 716 6.952773 TTTTTAATGGGATCCGAATCGATT 57.047 33.333 11.20 11.20 32.24 3.34
735 736 7.494625 TGATCCGTATCGCTTAGAAAGATTTTT 59.505 33.333 0.00 0.00 34.60 1.94
736 737 6.984474 TGATCCGTATCGCTTAGAAAGATTTT 59.016 34.615 0.00 0.00 34.60 1.82
737 738 6.513180 TGATCCGTATCGCTTAGAAAGATTT 58.487 36.000 0.00 0.00 34.60 2.17
738 739 6.085555 TGATCCGTATCGCTTAGAAAGATT 57.914 37.500 0.00 0.00 34.60 2.40
739 740 5.241949 ACTGATCCGTATCGCTTAGAAAGAT 59.758 40.000 0.00 0.00 34.60 2.40
740 741 4.579340 ACTGATCCGTATCGCTTAGAAAGA 59.421 41.667 0.00 0.00 34.60 2.52
741 742 4.677378 CACTGATCCGTATCGCTTAGAAAG 59.323 45.833 0.00 0.00 34.60 2.62
742 743