Multiple sequence alignment - TraesCS7D01G551300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G551300 chr7D 100.000 2459 0 0 1 2459 634767965 634770423 0 4542
1 TraesCS7D01G551300 chr7D 97.455 2475 47 3 1 2459 112191186 112188712 0 4207
2 TraesCS7D01G551300 chr7D 97.413 2474 40 6 1 2459 538836174 538838638 0 4193
3 TraesCS7D01G551300 chr7D 97.444 2465 28 3 1 2459 426837113 426834678 0 4170
4 TraesCS7D01G551300 chr7D 97.042 1589 37 2 1 1579 445229048 445230636 0 2665
5 TraesCS7D01G551300 chr5D 98.661 2465 24 2 1 2459 422770491 422772952 0 4361
6 TraesCS7D01G551300 chr5D 98.136 2468 25 6 1 2459 282366389 282368844 0 4283
7 TraesCS7D01G551300 chr5D 97.905 2482 26 3 1 2459 52374404 52371926 0 4272
8 TraesCS7D01G551300 chr5D 97.769 2465 23 3 1 2459 356119373 356116935 0 4218
9 TraesCS7D01G551300 chr4D 98.424 2474 22 4 1 2459 392724723 392722252 0 4337
10 TraesCS7D01G551300 chr3D 98.256 2466 26 5 1 2459 52842565 52845020 0 4300
11 TraesCS7D01G551300 chr3D 98.188 1269 19 2 199 1467 534219379 534218115 0 2213
12 TraesCS7D01G551300 chr3D 98.411 944 9 1 1522 2459 534218112 534217169 0 1655
13 TraesCS7D01G551300 chr7A 95.759 2476 88 4 1 2459 731435274 731437749 0 3975


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G551300 chr7D 634767965 634770423 2458 False 4542 4542 100.0000 1 2459 1 chr7D.!!$F3 2458
1 TraesCS7D01G551300 chr7D 112188712 112191186 2474 True 4207 4207 97.4550 1 2459 1 chr7D.!!$R1 2458
2 TraesCS7D01G551300 chr7D 538836174 538838638 2464 False 4193 4193 97.4130 1 2459 1 chr7D.!!$F2 2458
3 TraesCS7D01G551300 chr7D 426834678 426837113 2435 True 4170 4170 97.4440 1 2459 1 chr7D.!!$R2 2458
4 TraesCS7D01G551300 chr7D 445229048 445230636 1588 False 2665 2665 97.0420 1 1579 1 chr7D.!!$F1 1578
5 TraesCS7D01G551300 chr5D 422770491 422772952 2461 False 4361 4361 98.6610 1 2459 1 chr5D.!!$F2 2458
6 TraesCS7D01G551300 chr5D 282366389 282368844 2455 False 4283 4283 98.1360 1 2459 1 chr5D.!!$F1 2458
7 TraesCS7D01G551300 chr5D 52371926 52374404 2478 True 4272 4272 97.9050 1 2459 1 chr5D.!!$R1 2458
8 TraesCS7D01G551300 chr5D 356116935 356119373 2438 True 4218 4218 97.7690 1 2459 1 chr5D.!!$R2 2458
9 TraesCS7D01G551300 chr4D 392722252 392724723 2471 True 4337 4337 98.4240 1 2459 1 chr4D.!!$R1 2458
10 TraesCS7D01G551300 chr3D 52842565 52845020 2455 False 4300 4300 98.2560 1 2459 1 chr3D.!!$F1 2458
11 TraesCS7D01G551300 chr3D 534217169 534219379 2210 True 1934 2213 98.2995 199 2459 2 chr3D.!!$R1 2260
12 TraesCS7D01G551300 chr7A 731435274 731437749 2475 False 3975 3975 95.7590 1 2459 1 chr7A.!!$F1 2458

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
46 47 1.561542 CTTAACTGACAGGGATGGCCT 59.438 52.381 3.32 0.0 0.0 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1806 1864 5.105554 TCAGTGTTACCAAGTTTGTGCAATT 60.106 36.0 0.0 0.0 0.0 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 1.561542 CTTAACTGACAGGGATGGCCT 59.438 52.381 3.32 0.0 0.00 5.19
48 49 1.898863 AACTGACAGGGATGGCCTAT 58.101 50.000 3.32 0.0 0.00 2.57
216 223 2.422235 CCCGAGCTCTCTTCTTCCTCTA 60.422 54.545 12.85 0.0 0.00 2.43
1806 1864 8.300286 TGAGAAGTTTGTTGTAACATTTCACAA 58.700 29.630 14.15 1.2 38.95 3.33
2423 2507 1.421268 TGCATCTACCAGCCCAATAGG 59.579 52.381 0.00 0.0 39.47 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 3.056458 CCGTCGGCCTGCCATATA 58.944 61.111 9.17 0.0 35.37 0.86
365 372 4.490706 CCTAACCCTAACCCTAGCATAGT 58.509 47.826 0.00 0.0 36.82 2.12
824 831 7.604549 ACATATCAATGTTTGTCTGAATGCAA 58.395 30.769 0.00 0.0 44.07 4.08
1806 1864 5.105554 TCAGTGTTACCAAGTTTGTGCAATT 60.106 36.000 0.00 0.0 0.00 2.32
2423 2507 1.452108 GCCATGAGGTACACCAGCC 60.452 63.158 0.38 0.0 38.89 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.