Multiple sequence alignment - TraesCS7D01G533800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G533800 chr7D 100.000 2314 0 0 1 2314 626724464 626726777 0.000000e+00 4274
1 TraesCS7D01G533800 chr7D 99.222 2315 17 1 1 2314 626630212 626632526 0.000000e+00 4174
2 TraesCS7D01G533800 chr7D 99.136 2316 18 2 1 2314 382073380 382071065 0.000000e+00 4165
3 TraesCS7D01G533800 chr1D 99.093 2315 19 2 1 2314 212458838 212461151 0.000000e+00 4157
4 TraesCS7D01G533800 chr4D 98.920 2314 25 0 1 2314 123545919 123543606 0.000000e+00 4135
5 TraesCS7D01G533800 chr4D 98.402 2315 35 2 1 2314 123388257 123385944 0.000000e+00 4069
6 TraesCS7D01G533800 chr3D 98.618 2316 29 3 1 2314 602873031 602875345 0.000000e+00 4096
7 TraesCS7D01G533800 chr7B 99.241 2239 16 1 1 2238 743095874 743098112 0.000000e+00 4039
8 TraesCS7D01G533800 chr7B 99.151 2239 18 1 1 2238 644446411 644448649 0.000000e+00 4028
9 TraesCS7D01G533800 chrUn 99.196 2239 16 2 1 2238 170995033 170992796 0.000000e+00 4034
10 TraesCS7D01G533800 chr6B 100.000 89 0 0 2226 2314 394408748 394408660 5.110000e-37 165
11 TraesCS7D01G533800 chr6B 100.000 89 0 0 2226 2314 394517936 394517848 5.110000e-37 165
12 TraesCS7D01G533800 chr5A 98.876 89 1 0 2226 2314 16593835 16593923 2.380000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G533800 chr7D 626724464 626726777 2313 False 4274 4274 100.000 1 2314 1 chr7D.!!$F2 2313
1 TraesCS7D01G533800 chr7D 626630212 626632526 2314 False 4174 4174 99.222 1 2314 1 chr7D.!!$F1 2313
2 TraesCS7D01G533800 chr7D 382071065 382073380 2315 True 4165 4165 99.136 1 2314 1 chr7D.!!$R1 2313
3 TraesCS7D01G533800 chr1D 212458838 212461151 2313 False 4157 4157 99.093 1 2314 1 chr1D.!!$F1 2313
4 TraesCS7D01G533800 chr4D 123543606 123545919 2313 True 4135 4135 98.920 1 2314 1 chr4D.!!$R2 2313
5 TraesCS7D01G533800 chr4D 123385944 123388257 2313 True 4069 4069 98.402 1 2314 1 chr4D.!!$R1 2313
6 TraesCS7D01G533800 chr3D 602873031 602875345 2314 False 4096 4096 98.618 1 2314 1 chr3D.!!$F1 2313
7 TraesCS7D01G533800 chr7B 743095874 743098112 2238 False 4039 4039 99.241 1 2238 1 chr7B.!!$F2 2237
8 TraesCS7D01G533800 chr7B 644446411 644448649 2238 False 4028 4028 99.151 1 2238 1 chr7B.!!$F1 2237
9 TraesCS7D01G533800 chrUn 170992796 170995033 2237 True 4034 4034 99.196 1 2238 1 chrUn.!!$R1 2237

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
187 188 1.604693 CCGCCTGAAGTCGTGTAAACT 60.605 52.381 0.0 0.0 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1607 1612 2.002586 CCGTCTTGCATAACTGACCAG 58.997 52.381 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
187 188 1.604693 CCGCCTGAAGTCGTGTAAACT 60.605 52.381 0.0 0.0 0.0 2.66
899 902 9.004717 TCCTTAGATAGAGTTATTCAGTCGATG 57.995 37.037 0.0 0.0 0.0 3.84
1607 1612 2.721090 GCACTTTCGACTTGATTTGCAC 59.279 45.455 0.0 0.0 0.0 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
873 876 9.004717 CATCGACTGAATAACTCTATCTAAGGA 57.995 37.037 0.00 0.0 0.00 3.36
899 902 1.063174 CCACTTTAAGCGCATCTCTGC 59.937 52.381 11.47 0.0 45.31 4.26
1607 1612 2.002586 CCGTCTTGCATAACTGACCAG 58.997 52.381 0.00 0.0 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.