Multiple sequence alignment - TraesCS7D01G533700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G533700 chr7D 100.000 2342 0 0 1 2342 626713042 626710701 0 4325
1 TraesCS7D01G533700 chr7D 98.721 2345 24 3 1 2342 382087952 382090293 0 4159
2 TraesCS7D01G533700 chr7D 97.996 2345 38 5 1 2342 307034495 307032157 0 4061
3 TraesCS7D01G533700 chr7A 98.639 2351 19 5 1 2342 638509517 638507171 0 4152
4 TraesCS7D01G533700 chr7A 98.128 2350 32 4 1 2342 708243774 708246119 0 4085
5 TraesCS7D01G533700 chr6B 98.426 2350 27 3 1 2342 596603711 596601364 0 4126
6 TraesCS7D01G533700 chrUn 98.299 2351 28 4 1 2342 171006434 171008781 0 4109
7 TraesCS7D01G533700 chr4D 98.253 2347 30 6 1 2342 123399672 123402012 0 4096
8 TraesCS7D01G533700 chr1B 97.915 2350 36 5 1 2342 672539372 672541716 0 4056
9 TraesCS7D01G533700 chr2B 97.577 2352 45 4 1 2342 391227096 391224747 0 4017


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G533700 chr7D 626710701 626713042 2341 True 4325 4325 100.000 1 2342 1 chr7D.!!$R2 2341
1 TraesCS7D01G533700 chr7D 382087952 382090293 2341 False 4159 4159 98.721 1 2342 1 chr7D.!!$F1 2341
2 TraesCS7D01G533700 chr7D 307032157 307034495 2338 True 4061 4061 97.996 1 2342 1 chr7D.!!$R1 2341
3 TraesCS7D01G533700 chr7A 638507171 638509517 2346 True 4152 4152 98.639 1 2342 1 chr7A.!!$R1 2341
4 TraesCS7D01G533700 chr7A 708243774 708246119 2345 False 4085 4085 98.128 1 2342 1 chr7A.!!$F1 2341
5 TraesCS7D01G533700 chr6B 596601364 596603711 2347 True 4126 4126 98.426 1 2342 1 chr6B.!!$R1 2341
6 TraesCS7D01G533700 chrUn 171006434 171008781 2347 False 4109 4109 98.299 1 2342 1 chrUn.!!$F1 2341
7 TraesCS7D01G533700 chr4D 123399672 123402012 2340 False 4096 4096 98.253 1 2342 1 chr4D.!!$F1 2341
8 TraesCS7D01G533700 chr1B 672539372 672541716 2344 False 4056 4056 97.915 1 2342 1 chr1B.!!$F1 2341
9 TraesCS7D01G533700 chr2B 391224747 391227096 2349 True 4017 4017 97.577 1 2342 1 chr2B.!!$R1 2341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
812 818 2.376518 TCTTCAATGGGGTCTGCTCTTT 59.623 45.455 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1764 1776 1.340248 TCCAAGACGACGCTCTTCTTT 59.66 47.619 8.95 0.0 33.42 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
266 272 6.596497 ACGAAGTTCTACTTTGTCTTTGGAAA 59.404 34.615 6.63 0.0 46.95 3.13
812 818 2.376518 TCTTCAATGGGGTCTGCTCTTT 59.623 45.455 0.00 0.0 0.00 2.52
813 819 3.587061 TCTTCAATGGGGTCTGCTCTTTA 59.413 43.478 0.00 0.0 0.00 1.85
1222 1232 1.447140 GCGCGGATTACAGGTGACA 60.447 57.895 8.83 0.0 0.00 3.58
1628 1640 1.396653 AAATCCTGCTGCTATGGCAC 58.603 50.000 0.00 0.0 44.28 5.01
1764 1776 9.120538 AGTAATTCAGTGAGTGCTTTCTTTTAA 57.879 29.630 0.00 0.0 0.00 1.52
1778 1790 5.978934 TTCTTTTAAAAGAAGAGCGTCGT 57.021 34.783 30.56 0.0 46.80 4.34
1829 1841 2.469826 CGCGCTGGTTGTAATAGATCA 58.530 47.619 5.56 0.0 0.00 2.92
2098 2111 5.220529 CCGTTTCATTCCTATTCGTGGTTAC 60.221 44.000 0.00 0.0 0.00 2.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 233 5.429130 AGAACTTCGTTTTGAGGAGTTTCT 58.571 37.500 0.00 0.0 0.00 2.52
228 234 5.736486 AGAACTTCGTTTTGAGGAGTTTC 57.264 39.130 0.00 0.0 0.00 2.78
266 272 6.712276 ACTTAGAGTCCGATTCTTCCAATTT 58.288 36.000 0.00 0.0 0.00 1.82
598 604 3.321111 GTCCTAAATATGGACGGAGAGCA 59.679 47.826 0.00 0.0 43.55 4.26
903 912 3.471680 GGTTTATTGCACAAAAAGGCCA 58.528 40.909 5.01 0.0 0.00 5.36
1222 1232 0.988832 TCCCCGCCATTCTTGTAACT 59.011 50.000 0.00 0.0 0.00 2.24
1628 1640 4.524328 GCCTATGAAATGGATAACCCTTGG 59.476 45.833 0.00 0.0 35.38 3.61
1764 1776 1.340248 TCCAAGACGACGCTCTTCTTT 59.660 47.619 8.95 0.0 33.42 2.52
1778 1790 8.615878 TCGTATTTCATTTTCTTCTTCCAAGA 57.384 30.769 0.00 0.0 0.00 3.02
1829 1841 2.880890 AGCAAGAAGACGCATTCAAGTT 59.119 40.909 3.37 0.0 0.00 2.66
2098 2111 6.887368 TCCGCTATTTGAATATTGAACATCG 58.113 36.000 0.00 0.0 0.00 3.84


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.