Multiple sequence alignment - TraesCS7D01G533600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G533600 chr7D 100.000 2319 0 0 1 2319 626698489 626696171 0 4283
1 TraesCS7D01G533600 chr7D 98.922 2319 24 1 1 2319 203556344 203554027 0 4143
2 TraesCS7D01G533600 chrUn 99.310 2319 16 0 1 2319 189392540 189394858 0 4194
3 TraesCS7D01G533600 chr5A 99.224 2319 18 0 1 2319 300072980 300075298 0 4183
4 TraesCS7D01G533600 chr5A 98.793 2319 24 2 1 2319 16602918 16600604 0 4124
5 TraesCS7D01G533600 chr2A 99.181 2319 19 0 1 2319 618279955 618277637 0 4178
6 TraesCS7D01G533600 chr7B 98.966 2320 22 2 1 2319 743086200 743088518 0 4150
7 TraesCS7D01G533600 chr6A 98.922 2319 23 2 1 2319 289128633 289130949 0 4143
8 TraesCS7D01G533600 chr7A 98.752 2324 23 2 1 2319 4959839 4962161 0 4126
9 TraesCS7D01G533600 chr3B 98.663 2319 28 3 1 2319 92199605 92201920 0 4108


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G533600 chr7D 626696171 626698489 2318 True 4283 4283 100.000 1 2319 1 chr7D.!!$R2 2318
1 TraesCS7D01G533600 chr7D 203554027 203556344 2317 True 4143 4143 98.922 1 2319 1 chr7D.!!$R1 2318
2 TraesCS7D01G533600 chrUn 189392540 189394858 2318 False 4194 4194 99.310 1 2319 1 chrUn.!!$F1 2318
3 TraesCS7D01G533600 chr5A 300072980 300075298 2318 False 4183 4183 99.224 1 2319 1 chr5A.!!$F1 2318
4 TraesCS7D01G533600 chr5A 16600604 16602918 2314 True 4124 4124 98.793 1 2319 1 chr5A.!!$R1 2318
5 TraesCS7D01G533600 chr2A 618277637 618279955 2318 True 4178 4178 99.181 1 2319 1 chr2A.!!$R1 2318
6 TraesCS7D01G533600 chr7B 743086200 743088518 2318 False 4150 4150 98.966 1 2319 1 chr7B.!!$F1 2318
7 TraesCS7D01G533600 chr6A 289128633 289130949 2316 False 4143 4143 98.922 1 2319 1 chr6A.!!$F1 2318
8 TraesCS7D01G533600 chr7A 4959839 4962161 2322 False 4126 4126 98.752 1 2319 1 chr7A.!!$F1 2318
9 TraesCS7D01G533600 chr3B 92199605 92201920 2315 False 4108 4108 98.663 1 2319 1 chr3B.!!$F1 2318

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
172 173 0.907486 CCCAGCATCTCTCCTGAACA 59.093 55.0 0.0 0.0 0.0 3.18 F
874 875 0.960861 GAACCCTTTCCTGCTTCCCG 60.961 60.0 0.0 0.0 0.0 5.14 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1148 1151 0.391661 TGAGATCCGCTTGGTCTTGC 60.392 55.0 0.00 0.0 0.00 4.01 R
2252 2260 1.086696 TTATGCTGCACTCGCCTTTC 58.913 50.0 3.57 0.0 37.32 2.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
172 173 0.907486 CCCAGCATCTCTCCTGAACA 59.093 55.000 0.00 0.00 0.00 3.18
477 478 6.262496 GCTAACTAAAGTCCAACTTCCTTTGT 59.738 38.462 0.00 0.00 37.47 2.83
874 875 0.960861 GAACCCTTTCCTGCTTCCCG 60.961 60.000 0.00 0.00 0.00 5.14
1148 1151 0.470080 TCCTCCTCAAGCCCCTATCG 60.470 60.000 0.00 0.00 0.00 2.92
1561 1564 5.473162 TCTCTCTCACAAGACAGAGAAAGAG 59.527 44.000 0.61 0.00 41.22 2.85
1731 1739 8.776376 AAGAAAACATAAATCCATTGCGATTT 57.224 26.923 13.83 13.83 43.29 2.17
2162 2170 5.589831 TCATCGAAATATCCTCATCCCCTA 58.410 41.667 0.00 0.00 0.00 3.53
2252 2260 9.294030 GTGCATTTTGGAAAGATAAGATTACAG 57.706 33.333 0.00 0.00 0.00 2.74
2262 2270 6.472686 AGATAAGATTACAGAAAGGCGAGT 57.527 37.500 0.00 0.00 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 0.537371 CAAACCCCTTGTCGAAGCCT 60.537 55.000 0.00 0.00 0.00 4.58
172 173 3.006323 CAGTAGAGTCTGCAGAAGGTGTT 59.994 47.826 20.19 3.93 0.00 3.32
477 478 3.194755 TGATCCGTTTCATCCTCTTTCGA 59.805 43.478 0.00 0.00 0.00 3.71
874 875 2.963432 TCGAGTCCGATGGGTAAAAAC 58.037 47.619 0.00 0.00 40.30 2.43
1148 1151 0.391661 TGAGATCCGCTTGGTCTTGC 60.392 55.000 0.00 0.00 0.00 4.01
1561 1564 6.039270 TCAAATTGGATTGGATGAATCGGTAC 59.961 38.462 0.00 0.00 41.45 3.34
1731 1739 2.037251 GGCTGTAGAGTCACTGGTTTCA 59.963 50.000 0.00 0.00 0.00 2.69
2162 2170 2.036387 CCTGTTTTCGGGTTCCCTTTT 58.964 47.619 6.31 0.00 41.26 2.27
2252 2260 1.086696 TTATGCTGCACTCGCCTTTC 58.913 50.000 3.57 0.00 37.32 2.62
2262 2270 4.887071 CCCCTAACTAACAATTATGCTGCA 59.113 41.667 4.13 4.13 0.00 4.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.