Multiple sequence alignment - TraesCS7D01G533500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G533500 chr7D 100.000 2714 0 0 1 2714 626696994 626694281 0 4975
1 TraesCS7D01G533500 chr7D 99.232 1693 12 1 2 1693 203554849 203553157 0 3053
2 TraesCS7D01G533500 chr7D 99.506 1012 4 1 1704 2714 203553862 203552851 0 1840
3 TraesCS7D01G533500 chrUn 99.469 1694 8 1 1 1693 189394035 189395728 0 3077
4 TraesCS7D01G533500 chrUn 99.605 1012 3 1 1704 2714 189395023 189396034 0 1845
5 TraesCS7D01G533500 chr5B 99.350 1693 11 0 1 1693 679660393 679662085 0 3066
6 TraesCS7D01G533500 chr5B 99.604 1011 4 0 1704 2714 679661381 679662391 0 1845
7 TraesCS7D01G533500 chr2A 99.232 1693 13 0 1 1693 618278460 618276768 0 3055
8 TraesCS7D01G533500 chr4D 99.173 1693 14 0 1 1693 123414378 123416070 0 3049
9 TraesCS7D01G533500 chr4D 99.308 1011 7 0 1704 2714 123415366 123416376 0 1829
10 TraesCS7D01G533500 chr7B 99.055 1693 16 0 1 1693 743087695 743089387 0 3038
11 TraesCS7D01G533500 chr7B 99.505 1011 5 0 1704 2714 743088683 743089693 0 1840
12 TraesCS7D01G533500 chr5A 98.996 1693 17 0 1 1693 16601427 16599735 0 3033
13 TraesCS7D01G533500 chr5A 98.996 1693 17 0 1 1693 300074475 300076167 0 3033
14 TraesCS7D01G533500 chr5A 99.308 1011 7 0 1704 2714 16600439 16599429 0 1829
15 TraesCS7D01G533500 chr5A 99.110 1011 9 0 1704 2714 300075463 300076473 0 1818
16 TraesCS7D01G533500 chr6A 98.878 1693 19 0 1 1693 289130126 289131818 0 3022
17 TraesCS7D01G533500 chr6A 99.407 1011 6 0 1704 2714 289131114 289132124 0 1834
18 TraesCS7D01G533500 chr7A 99.407 1011 6 0 1704 2714 4962326 4963336 0 1834
19 TraesCS7D01G533500 chr3B 99.110 1011 9 0 1704 2714 92202085 92203095 0 1818


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G533500 chr7D 626694281 626696994 2713 True 4975.0 4975 100.0000 1 2714 1 chr7D.!!$R1 2713
1 TraesCS7D01G533500 chr7D 203552851 203554849 1998 True 2446.5 3053 99.3690 2 2714 2 chr7D.!!$R2 2712
2 TraesCS7D01G533500 chrUn 189394035 189396034 1999 False 2461.0 3077 99.5370 1 2714 2 chrUn.!!$F1 2713
3 TraesCS7D01G533500 chr5B 679660393 679662391 1998 False 2455.5 3066 99.4770 1 2714 2 chr5B.!!$F1 2713
4 TraesCS7D01G533500 chr2A 618276768 618278460 1692 True 3055.0 3055 99.2320 1 1693 1 chr2A.!!$R1 1692
5 TraesCS7D01G533500 chr4D 123414378 123416376 1998 False 2439.0 3049 99.2405 1 2714 2 chr4D.!!$F1 2713
6 TraesCS7D01G533500 chr7B 743087695 743089693 1998 False 2439.0 3038 99.2800 1 2714 2 chr7B.!!$F1 2713
7 TraesCS7D01G533500 chr5A 16599429 16601427 1998 True 2431.0 3033 99.1520 1 2714 2 chr5A.!!$R1 2713
8 TraesCS7D01G533500 chr5A 300074475 300076473 1998 False 2425.5 3033 99.0530 1 2714 2 chr5A.!!$F1 2713
9 TraesCS7D01G533500 chr6A 289130126 289132124 1998 False 2428.0 3022 99.1425 1 2714 2 chr6A.!!$F1 2713
10 TraesCS7D01G533500 chr7A 4962326 4963336 1010 False 1834.0 1834 99.4070 1704 2714 1 chr7A.!!$F1 1010
11 TraesCS7D01G533500 chr3B 92202085 92203095 1010 False 1818.0 1818 99.1100 1704 2714 1 chr3B.!!$F1 1010

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
66 67 5.473162 TCTCTCTCACAAGACAGAGAAAGAG 59.527 44.000 0.61 0.0 41.22 2.85 F
667 668 5.589831 TCATCGAAATATCCTCATCCCCTA 58.410 41.667 0.00 0.0 0.00 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1412 1414 1.658095 GCTTTTGAAAACGCAGTGCAA 59.342 42.857 16.83 0.0 45.0 4.08 R
2304 2307 5.314529 AGAAGGGGAAGTTAGCAAAGTTAC 58.685 41.667 0.00 0.0 0.0 2.50 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 5.473162 TCTCTCTCACAAGACAGAGAAAGAG 59.527 44.000 0.61 0.00 41.22 2.85
236 237 8.776376 AAGAAAACATAAATCCATTGCGATTT 57.224 26.923 13.83 13.83 43.29 2.17
667 668 5.589831 TCATCGAAATATCCTCATCCCCTA 58.410 41.667 0.00 0.00 0.00 3.53
757 758 9.294030 GTGCATTTTGGAAAGATAAGATTACAG 57.706 33.333 0.00 0.00 0.00 2.74
767 768 6.472686 AGATAAGATTACAGAAAGGCGAGT 57.527 37.500 0.00 0.00 0.00 4.18
1412 1414 7.027874 TCATCTTGTTCCTTATTTACCTGGT 57.972 36.000 4.05 4.05 0.00 4.00
2304 2307 3.319972 CCTATGCCCATTCCAATCTTGTG 59.680 47.826 0.00 0.00 0.00 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 6.039270 TCAAATTGGATTGGATGAATCGGTAC 59.961 38.462 0.00 0.00 41.45 3.34
236 237 2.037251 GGCTGTAGAGTCACTGGTTTCA 59.963 50.000 0.00 0.00 0.00 2.69
667 668 2.036387 CCTGTTTTCGGGTTCCCTTTT 58.964 47.619 6.31 0.00 41.26 2.27
757 758 1.086696 TTATGCTGCACTCGCCTTTC 58.913 50.000 3.57 0.00 37.32 2.62
767 768 4.887071 CCCCTAACTAACAATTATGCTGCA 59.113 41.667 4.13 4.13 0.00 4.41
869 870 1.710013 CTTAGTTTTCGCTCCGCTCA 58.290 50.000 0.00 0.00 0.00 4.26
1412 1414 1.658095 GCTTTTGAAAACGCAGTGCAA 59.342 42.857 16.83 0.00 45.00 4.08
2186 2189 9.517609 AGACTTTATTATTGGTATATCGATCGC 57.482 33.333 11.09 0.00 0.00 4.58
2304 2307 5.314529 AGAAGGGGAAGTTAGCAAAGTTAC 58.685 41.667 0.00 0.00 0.00 2.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.