Multiple sequence alignment - TraesCS7D01G533300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G533300 chr7D 100.000 2888 0 0 1 2888 626684767 626681880 0 5334
1 TraesCS7D01G533300 chr7D 99.239 2891 17 5 1 2888 381960692 381957804 0 5212
2 TraesCS7D01G533300 chr7D 99.204 2890 19 4 1 2888 382063147 382066034 0 5206
3 TraesCS7D01G533300 chrUn 99.239 2891 18 4 1 2888 189405552 189408441 0 5214
4 TraesCS7D01G533300 chr6D 99.100 2890 20 5 1 2888 124530591 124533476 0 5188
5 TraesCS7D01G533300 chr7B 99.066 2891 23 4 1 2888 644461912 644464801 0 5186
6 TraesCS7D01G533300 chr1D 99.066 2890 22 5 1 2888 141318665 141315779 0 5182
7 TraesCS7D01G533300 chr1B 98.825 2893 29 4 1 2888 668810694 668807802 0 5149
8 TraesCS7D01G533300 chr1B 98.651 2891 34 5 1 2888 638706196 638703308 0 5118
9 TraesCS7D01G533300 chr3A 98.720 2890 33 4 1 2888 633105725 633108612 0 5129


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G533300 chr7D 626681880 626684767 2887 True 5334 5334 100.000 1 2888 1 chr7D.!!$R2 2887
1 TraesCS7D01G533300 chr7D 381957804 381960692 2888 True 5212 5212 99.239 1 2888 1 chr7D.!!$R1 2887
2 TraesCS7D01G533300 chr7D 382063147 382066034 2887 False 5206 5206 99.204 1 2888 1 chr7D.!!$F1 2887
3 TraesCS7D01G533300 chrUn 189405552 189408441 2889 False 5214 5214 99.239 1 2888 1 chrUn.!!$F1 2887
4 TraesCS7D01G533300 chr6D 124530591 124533476 2885 False 5188 5188 99.100 1 2888 1 chr6D.!!$F1 2887
5 TraesCS7D01G533300 chr7B 644461912 644464801 2889 False 5186 5186 99.066 1 2888 1 chr7B.!!$F1 2887
6 TraesCS7D01G533300 chr1D 141315779 141318665 2886 True 5182 5182 99.066 1 2888 1 chr1D.!!$R1 2887
7 TraesCS7D01G533300 chr1B 668807802 668810694 2892 True 5149 5149 98.825 1 2888 1 chr1B.!!$R2 2887
8 TraesCS7D01G533300 chr1B 638703308 638706196 2888 True 5118 5118 98.651 1 2888 1 chr1B.!!$R1 2887
9 TraesCS7D01G533300 chr3A 633105725 633108612 2887 False 5129 5129 98.720 1 2888 1 chr3A.!!$F1 2887

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
678 683 0.246086 CAGCCCTTTTTAATGCGCCA 59.754 50.0 4.18 0.0 0.0 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2419 2425 4.455877 CAGTTCTATCCAAGCTCGGTTTTT 59.544 41.667 0.0 0.0 0.0 1.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
105 106 6.838401 ACTAAAAGGAGATTGGGATCATCT 57.162 37.500 0.00 0.00 34.60 2.90
176 177 9.541143 TGAGCACGAAATGTCTATAAATGAATA 57.459 29.630 0.00 0.00 0.00 1.75
208 209 3.337358 TCGTTATTTCCGGGTCTTTTCC 58.663 45.455 0.00 0.00 0.00 3.13
678 683 0.246086 CAGCCCTTTTTAATGCGCCA 59.754 50.000 4.18 0.00 0.00 5.69
889 894 2.225727 GCGAGTTCCGATCCTTTTGTTT 59.774 45.455 0.00 0.00 41.76 2.83
1051 1056 0.734889 GAATGGGATTGTGGCACTCG 59.265 55.000 19.83 0.00 0.00 4.18
1053 1058 0.107508 ATGGGATTGTGGCACTCGAG 60.108 55.000 19.83 11.84 0.00 4.04
1401 1406 3.521937 AGGACCAGGAACCAATTCGAATA 59.478 43.478 11.83 0.00 35.48 1.75
1455 1460 0.674895 GCATCTCGCCAGGAAGTTGT 60.675 55.000 0.00 0.00 32.94 3.32
1832 1837 3.305131 CGAAGTACTCTTGTGCACCTACA 60.305 47.826 15.69 0.00 33.64 2.74
2265 2271 2.315925 ATGTAGTGGCTGGTGAATCG 57.684 50.000 0.00 0.00 0.00 3.34
2419 2425 6.016777 GCTTCTTCTTCCACAAAGATTCAGAA 60.017 38.462 0.00 0.00 43.50 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
105 106 1.065053 CCCATCATCCGGTAACCACAA 60.065 52.381 0.00 0.0 0.0 3.33
176 177 6.996282 ACCCGGAAATAACGAATAATGAGAAT 59.004 34.615 0.73 0.0 0.0 2.40
208 209 6.751425 TGTTTCTTGTTGTAAGTGAATGCAAG 59.249 34.615 0.00 0.0 34.8 4.01
678 683 5.682212 GCTCATTTTCAAAACAGGGTCAAGT 60.682 40.000 0.00 0.0 0.0 3.16
1401 1406 3.273434 CAACCGACATGTCAAGATCCAT 58.727 45.455 24.93 0.0 0.0 3.41
1455 1460 4.464008 GACCTAATTCATGATGAGCCCAA 58.536 43.478 0.00 0.0 0.0 4.12
2016 2022 7.229308 TCCAATAGATGCTCATCATAAGCTTT 58.771 34.615 3.20 0.0 40.5 3.51
2419 2425 4.455877 CAGTTCTATCCAAGCTCGGTTTTT 59.544 41.667 0.00 0.0 0.0 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.