Multiple sequence alignment - TraesCS7D01G533200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G533200 chr7D 100.000 2255 0 0 1 2255 626681056 626678802 0 4165
1 TraesCS7D01G533200 chr7D 99.320 1617 8 2 640 2255 382000221 381998607 0 2922
2 TraesCS7D01G533200 chrUn 99.424 2256 10 2 1 2255 189409266 189411519 0 4091
3 TraesCS7D01G533200 chrUn 99.200 1876 12 2 1 1875 251407330 251405457 0 3378
4 TraesCS7D01G533200 chrUn 99.004 1004 8 1 1252 2255 86477659 86476658 0 1797
5 TraesCS7D01G533200 chr6D 98.892 2256 22 2 1 2255 124534302 124536555 0 4024
6 TraesCS7D01G533200 chr6D 99.203 1004 6 1 1252 2255 458963670 458962669 0 1808
7 TraesCS7D01G533200 chr1D 99.365 1259 6 2 1 1258 141314952 141313695 0 2279
8 TraesCS7D01G533200 chr3A 99.047 1259 11 1 1 1258 633109437 633110695 0 2257
9 TraesCS7D01G533200 chr1B 99.047 1259 11 1 1 1258 668806978 668805720 0 2257
10 TraesCS7D01G533200 chr7B 98.968 1260 11 1 1 1258 644465626 644466885 0 2254
11 TraesCS7D01G533200 chr7B 98.805 1004 10 1 1252 2255 743004783 743003782 0 1786
12 TraesCS7D01G533200 chr6B 98.967 1259 12 1 1 1258 306997807 306996549 0 2252
13 TraesCS7D01G533200 chr4B 98.967 1258 13 0 1 1258 209079334 209078077 0 2252
14 TraesCS7D01G533200 chr1A 99.303 1004 5 1 1252 2255 22566051 22565050 0 1814
15 TraesCS7D01G533200 chr7A 98.805 1004 10 1 1252 2255 60243430 60244431 0 1786


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G533200 chr7D 626678802 626681056 2254 True 4165 4165 100.000 1 2255 1 chr7D.!!$R2 2254
1 TraesCS7D01G533200 chr7D 381998607 382000221 1614 True 2922 2922 99.320 640 2255 1 chr7D.!!$R1 1615
2 TraesCS7D01G533200 chrUn 189409266 189411519 2253 False 4091 4091 99.424 1 2255 1 chrUn.!!$F1 2254
3 TraesCS7D01G533200 chrUn 251405457 251407330 1873 True 3378 3378 99.200 1 1875 1 chrUn.!!$R2 1874
4 TraesCS7D01G533200 chrUn 86476658 86477659 1001 True 1797 1797 99.004 1252 2255 1 chrUn.!!$R1 1003
5 TraesCS7D01G533200 chr6D 124534302 124536555 2253 False 4024 4024 98.892 1 2255 1 chr6D.!!$F1 2254
6 TraesCS7D01G533200 chr6D 458962669 458963670 1001 True 1808 1808 99.203 1252 2255 1 chr6D.!!$R1 1003
7 TraesCS7D01G533200 chr1D 141313695 141314952 1257 True 2279 2279 99.365 1 1258 1 chr1D.!!$R1 1257
8 TraesCS7D01G533200 chr3A 633109437 633110695 1258 False 2257 2257 99.047 1 1258 1 chr3A.!!$F1 1257
9 TraesCS7D01G533200 chr1B 668805720 668806978 1258 True 2257 2257 99.047 1 1258 1 chr1B.!!$R1 1257
10 TraesCS7D01G533200 chr7B 644465626 644466885 1259 False 2254 2254 98.968 1 1258 1 chr7B.!!$F1 1257
11 TraesCS7D01G533200 chr7B 743003782 743004783 1001 True 1786 1786 98.805 1252 2255 1 chr7B.!!$R1 1003
12 TraesCS7D01G533200 chr6B 306996549 306997807 1258 True 2252 2252 98.967 1 1258 1 chr6B.!!$R1 1257
13 TraesCS7D01G533200 chr4B 209078077 209079334 1257 True 2252 2252 98.967 1 1258 1 chr4B.!!$R1 1257
14 TraesCS7D01G533200 chr1A 22565050 22566051 1001 True 1814 1814 99.303 1252 2255 1 chr1A.!!$R1 1003
15 TraesCS7D01G533200 chr7A 60243430 60244431 1001 False 1786 1786 98.805 1252 2255 1 chr7A.!!$F1 1003

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
464 465 1.173043 TTGCAATGACGGGTGGATTC 58.827 50.0 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1741 1744 1.234821 TGTGGTGCCTTTCGATCAAC 58.765 50.0 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
437 438 7.685481 TGGACATACAATCAAAGAGTAAGGAA 58.315 34.615 0.0 0.0 0.00 3.36
464 465 1.173043 TTGCAATGACGGGTGGATTC 58.827 50.000 0.0 0.0 0.00 2.52
950 953 7.172532 TGTGTGCTCGAATAAGATTGTTTTAGT 59.827 33.333 0.0 0.0 0.00 2.24
1741 1744 4.286297 TGGATCAACCAAAGTAGACCTG 57.714 45.455 0.0 0.0 46.75 4.00
1742 1745 3.650942 TGGATCAACCAAAGTAGACCTGT 59.349 43.478 0.0 0.0 46.75 4.00
1844 1847 2.517484 GAAAGGGCTTCCGCTACCGT 62.517 60.000 0.0 0.0 36.09 4.83
1903 1906 6.410942 TCACTCATCTGTAATGGTATCCTG 57.589 41.667 0.0 0.0 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
437 438 3.057596 CACCCGTCATTGCAAATAACTGT 60.058 43.478 1.71 0.0 0.00 3.55
464 465 0.458197 CTCTCCTTGCAGCTCTGACG 60.458 60.000 0.29 0.0 0.00 4.35
1615 1618 2.162681 GCCAGTGCTTCTACAACCAAT 58.837 47.619 0.00 0.0 33.53 3.16
1741 1744 1.234821 TGTGGTGCCTTTCGATCAAC 58.765 50.000 0.00 0.0 0.00 3.18
1742 1745 1.879380 CTTGTGGTGCCTTTCGATCAA 59.121 47.619 0.00 0.0 0.00 2.57
1844 1847 2.442272 GGAGCTCCCGAGGTAGCA 60.442 66.667 23.19 0.0 41.32 3.49
1903 1906 3.351794 ACCCACTTTAGCTAGCTTTCC 57.648 47.619 24.88 0.0 0.00 3.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.