Multiple sequence alignment - TraesCS7D01G533100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G533100 chr7D 100.000 1332 0 0 1 1332 626650265 626648934 0 2460
1 TraesCS7D01G533100 chr7D 100.000 1066 0 0 1398 2463 626648868 626647803 0 1969
2 TraesCS7D01G533100 chr2D 99.550 1332 6 0 1 1332 644703264 644701933 0 2427
3 TraesCS7D01G533100 chr2D 96.527 1094 9 3 1398 2463 635069142 635070234 0 1783
4 TraesCS7D01G533100 chr2D 95.222 879 14 8 1398 2249 644701919 644701042 0 1365
5 TraesCS7D01G533100 chrUn 99.474 1332 7 0 1 1332 45100792 45099461 0 2422
6 TraesCS7D01G533100 chrUn 99.324 1332 9 0 1 1332 261513064 261514395 0 2410
7 TraesCS7D01G533100 chrUn 96.077 1096 12 5 1398 2463 45099451 45098357 0 1757
8 TraesCS7D01G533100 chrUn 95.898 1097 13 5 1398 2463 261514407 261515502 0 1748
9 TraesCS7D01G533100 chrUn 95.104 1103 15 13 1398 2463 186162441 186161341 0 1701
10 TraesCS7D01G533100 chr5B 99.474 1332 7 0 1 1332 130614901 130613570 0 2422
11 TraesCS7D01G533100 chr5B 99.099 1332 12 0 1 1332 130568755 130570086 0 2394
12 TraesCS7D01G533100 chr5B 99.099 1332 12 0 1 1332 130609877 130608546 0 2394
13 TraesCS7D01G533100 chr5B 95.719 1098 15 4 1398 2463 130613560 130612463 0 1738
14 TraesCS7D01G533100 chr5B 95.195 1103 14 13 1398 2463 130608536 130607436 0 1707
15 TraesCS7D01G533100 chr5B 97.796 862 14 3 1607 2463 130570336 130571197 0 1482
16 TraesCS7D01G533100 chr3A 99.174 1332 11 0 1 1332 66030313 66031644 0 2399
17 TraesCS7D01G533100 chr3A 95.985 1096 13 5 1398 2463 66031655 66032749 0 1751
18 TraesCS7D01G533100 chr5A 99.024 1332 13 0 1 1332 238861455 238860124 0 2388
19 TraesCS7D01G533100 chr5A 95.537 1098 17 2 1398 2463 238829368 238830465 0 1727
20 TraesCS7D01G533100 chr2B 99.024 1332 13 0 1 1332 112869113 112867782 0 2388
21 TraesCS7D01G533100 chr1D 96.256 1095 12 3 1398 2463 493803111 493802017 0 1768
22 TraesCS7D01G533100 chr7B 95.277 1101 16 13 1398 2463 743035042 743036141 0 1712
23 TraesCS7D01G533100 chr7A 95.425 1071 17 4 1422 2463 60355235 60356302 0 1677


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G533100 chr7D 626647803 626650265 2462 True 2214.50 2460 100.00000 1 2463 2 chr7D.!!$R1 2462
1 TraesCS7D01G533100 chr2D 644701042 644703264 2222 True 1896.00 2427 97.38600 1 2249 2 chr2D.!!$R1 2248
2 TraesCS7D01G533100 chr2D 635069142 635070234 1092 False 1783.00 1783 96.52700 1398 2463 1 chr2D.!!$F1 1065
3 TraesCS7D01G533100 chrUn 45098357 45100792 2435 True 2089.50 2422 97.77550 1 2463 2 chrUn.!!$R2 2462
4 TraesCS7D01G533100 chrUn 261513064 261515502 2438 False 2079.00 2410 97.61100 1 2463 2 chrUn.!!$F1 2462
5 TraesCS7D01G533100 chrUn 186161341 186162441 1100 True 1701.00 1701 95.10400 1398 2463 1 chrUn.!!$R1 1065
6 TraesCS7D01G533100 chr5B 130607436 130614901 7465 True 2065.25 2422 97.37175 1 2463 4 chr5B.!!$R1 2462
7 TraesCS7D01G533100 chr5B 130568755 130571197 2442 False 1938.00 2394 98.44750 1 2463 2 chr5B.!!$F1 2462
8 TraesCS7D01G533100 chr3A 66030313 66032749 2436 False 2075.00 2399 97.57950 1 2463 2 chr3A.!!$F1 2462
9 TraesCS7D01G533100 chr5A 238860124 238861455 1331 True 2388.00 2388 99.02400 1 1332 1 chr5A.!!$R1 1331
10 TraesCS7D01G533100 chr5A 238829368 238830465 1097 False 1727.00 1727 95.53700 1398 2463 1 chr5A.!!$F1 1065
11 TraesCS7D01G533100 chr2B 112867782 112869113 1331 True 2388.00 2388 99.02400 1 1332 1 chr2B.!!$R1 1331
12 TraesCS7D01G533100 chr1D 493802017 493803111 1094 True 1768.00 1768 96.25600 1398 2463 1 chr1D.!!$R1 1065
13 TraesCS7D01G533100 chr7B 743035042 743036141 1099 False 1712.00 1712 95.27700 1398 2463 1 chr7B.!!$F1 1065
14 TraesCS7D01G533100 chr7A 60355235 60356302 1067 False 1677.00 1677 95.42500 1422 2463 1 chr7A.!!$F1 1041

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
186 187 0.74845 TAGTTGAAGTATCGGGCCCG 59.252 55.0 39.13 39.13 41.35 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1710 1742 0.600518 TTACTTAGTGTTGCGCGCCA 60.601 50.0 30.77 16.58 0.0 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 187 0.748450 TAGTTGAAGTATCGGGCCCG 59.252 55.000 39.13 39.13 41.35 6.13
746 747 4.921470 CGAAACACATCGAAATGGTACT 57.079 40.909 0.00 0.00 45.48 2.73
1093 1094 1.153539 TCATGTCCCCTTCCCAACAA 58.846 50.000 0.00 0.00 0.00 2.83
1664 1696 0.534427 GGCCGCATTAGGTTAGGGAC 60.534 60.000 0.00 0.00 0.00 4.46
1771 1803 9.706691 ATTACTAACTAACGGTGGATAATCATG 57.293 33.333 0.00 0.00 0.00 3.07
2186 7242 0.459899 TCGCTCAGCAATGATACCGT 59.540 50.000 0.00 0.00 0.00 4.83
2371 7430 0.036875 CACGCCCCTTCCTTTTCTCT 59.963 55.000 0.00 0.00 0.00 3.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 187 4.530388 GTGTAACCTAGGCAACGAAAAAC 58.470 43.478 9.30 0.00 46.39 2.43
465 466 1.028868 GGTGCGACCGGACTACTACT 61.029 60.000 9.46 0.00 36.67 2.57
1093 1094 2.026262 ACGCCCCAAGACAAGATACAAT 60.026 45.455 0.00 0.00 0.00 2.71
1664 1696 2.354203 GGAGGAGCTATTATCGCCCAAG 60.354 54.545 0.00 0.00 0.00 3.61
1710 1742 0.600518 TTACTTAGTGTTGCGCGCCA 60.601 50.000 30.77 16.58 0.00 5.69
2186 7242 1.027357 GATAGGTACTTCGTCCGGCA 58.973 55.000 0.00 0.00 41.75 5.69
2401 7460 8.525290 TGAATTAGAAAGAAGGGGATGAATTC 57.475 34.615 0.00 0.00 33.45 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.