Multiple sequence alignment - TraesCS7D01G526900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G526900 chr7D 100.000 2609 0 0 1 2609 622016203 622013595 0 4819
1 TraesCS7D01G526900 chr7D 98.315 2611 38 5 1 2609 52435754 52433148 0 4573
2 TraesCS7D01G526900 chr7D 98.086 2612 41 7 1 2609 534738283 534735678 0 4538
3 TraesCS7D01G526900 chr5D 98.430 2611 35 5 1 2609 346023486 346026092 0 4590
4 TraesCS7D01G526900 chr3D 98.391 2611 35 6 1 2609 84530780 84533385 0 4582
5 TraesCS7D01G526900 chr3D 98.315 2611 37 5 1 2609 54664375 54661770 0 4571
6 TraesCS7D01G526900 chr3D 98.199 2610 40 5 1 2607 546357507 546354902 0 4553
7 TraesCS7D01G526900 chr2D 98.277 2611 38 6 1 2609 559267720 559270325 0 4566
8 TraesCS7D01G526900 chrUn 98.238 2611 38 7 1 2609 27645312 27642708 0 4560
9 TraesCS7D01G526900 chr6D 98.124 2612 42 6 1 2609 395490744 395493351 0 4545


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G526900 chr7D 622013595 622016203 2608 True 4819 4819 100.000 1 2609 1 chr7D.!!$R3 2608
1 TraesCS7D01G526900 chr7D 52433148 52435754 2606 True 4573 4573 98.315 1 2609 1 chr7D.!!$R1 2608
2 TraesCS7D01G526900 chr7D 534735678 534738283 2605 True 4538 4538 98.086 1 2609 1 chr7D.!!$R2 2608
3 TraesCS7D01G526900 chr5D 346023486 346026092 2606 False 4590 4590 98.430 1 2609 1 chr5D.!!$F1 2608
4 TraesCS7D01G526900 chr3D 84530780 84533385 2605 False 4582 4582 98.391 1 2609 1 chr3D.!!$F1 2608
5 TraesCS7D01G526900 chr3D 54661770 54664375 2605 True 4571 4571 98.315 1 2609 1 chr3D.!!$R1 2608
6 TraesCS7D01G526900 chr3D 546354902 546357507 2605 True 4553 4553 98.199 1 2607 1 chr3D.!!$R2 2606
7 TraesCS7D01G526900 chr2D 559267720 559270325 2605 False 4566 4566 98.277 1 2609 1 chr2D.!!$F1 2608
8 TraesCS7D01G526900 chrUn 27642708 27645312 2604 True 4560 4560 98.238 1 2609 1 chrUn.!!$R1 2608
9 TraesCS7D01G526900 chr6D 395490744 395493351 2607 False 4545 4545 98.124 1 2609 1 chr6D.!!$F1 2608

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
630 632 2.672703 AACCACCCCCATCTACCTTA 57.327 50.0 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1673 1676 0.400213 TGTTGGGGTGGAGTGATGTC 59.6 55.0 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 195 3.564133 CCCATGGTTTCCATTCTTCTCCA 60.564 47.826 11.73 0.00 42.23 3.86
210 211 6.303054 TCTTCTCCAATATGGTTGTCAAACA 58.697 36.000 5.61 5.61 39.03 2.83
569 571 6.549433 ACTAATTAACCCTACATTCACGGA 57.451 37.500 0.00 0.00 0.00 4.69
570 572 7.133133 ACTAATTAACCCTACATTCACGGAT 57.867 36.000 0.00 0.00 0.00 4.18
630 632 2.672703 AACCACCCCCATCTACCTTA 57.327 50.000 0.00 0.00 0.00 2.69
870 872 5.224888 TGTCATGCAAGAGCTTTTTGATTC 58.775 37.500 14.08 0.41 42.74 2.52
1292 1294 1.079127 CGTTGCAGAAGGACCGGAT 60.079 57.895 9.46 0.00 0.00 4.18
1560 1563 8.574737 GGACCTACGTATTCTATGATACAAACT 58.425 37.037 0.00 0.00 33.12 2.66
1563 1566 9.114965 CCTACGTATTCTATGATACAAACTTCG 57.885 37.037 0.00 0.00 33.12 3.79
1565 1568 8.336498 ACGTATTCTATGATACAAACTTCGTG 57.664 34.615 0.00 0.00 33.12 4.35
1566 1569 7.043590 ACGTATTCTATGATACAAACTTCGTGC 60.044 37.037 0.00 0.00 33.12 5.34
1673 1676 0.670546 AGAGTCACCCGTTCAATGCG 60.671 55.000 0.00 0.00 0.00 4.73
1913 1916 1.200760 TCCCCAGTCACTCCACATGG 61.201 60.000 0.00 0.00 0.00 3.66
1992 1997 5.914898 AATATGTTTGCCCCTTTACTCAC 57.085 39.130 0.00 0.00 0.00 3.51
2070 2076 3.571828 AGTAGGGATGATGAGATGTCACG 59.428 47.826 0.00 0.00 34.75 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 195 6.239008 CCACTGAAGTGTTTGACAACCATATT 60.239 38.462 9.49 0.0 44.21 1.28
210 211 3.121030 GCATCGCGCCACTGAAGT 61.121 61.111 0.00 0.0 32.94 3.01
442 443 1.663695 GGGTCCAACCACATATCACG 58.336 55.000 0.00 0.0 41.02 4.35
562 564 8.618240 AATGGGAAGGTATATATATCCGTGAA 57.382 34.615 0.00 0.0 0.00 3.18
569 571 7.787904 TGCGGTAGAATGGGAAGGTATATATAT 59.212 37.037 0.00 0.0 0.00 0.86
570 572 7.127405 TGCGGTAGAATGGGAAGGTATATATA 58.873 38.462 0.00 0.0 0.00 0.86
630 632 3.805108 GCGATGGCTATGTGAGGAGAAAT 60.805 47.826 0.00 0.0 35.83 2.17
870 872 7.746034 TCGTACGAACAACTACTACAAACTATG 59.254 37.037 17.11 0.0 0.00 2.23
1056 1058 2.754658 AAGTCGATCTCCCGGCGT 60.755 61.111 6.01 0.0 39.43 5.68
1253 1255 4.082787 ACGTTTGATGCATTTCCTTGTAGG 60.083 41.667 0.00 0.0 36.46 3.18
1292 1294 6.071051 TGTCTGTATAATACTGTCCACAAGCA 60.071 38.462 0.00 0.0 0.00 3.91
1673 1676 0.400213 TGTTGGGGTGGAGTGATGTC 59.600 55.000 0.00 0.0 0.00 3.06
1803 1806 4.225942 TCTGCCATCACAGGTTTCTTATCT 59.774 41.667 0.00 0.0 38.26 1.98
1992 1997 9.761504 ATCTCACATCAGAGTTAATACATTCAG 57.238 33.333 0.00 0.0 36.97 3.02
2070 2076 2.094182 TCAAAGTATGCTCTCGGGACAC 60.094 50.000 0.00 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.