Multiple sequence alignment - TraesCS7D01G503900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G503900 chr7D 100.000 2696 0 0 1 2696 610213923 610216618 0.000000e+00 4979.0
1 TraesCS7D01G503900 chr7D 98.036 2698 42 5 1 2696 607615621 607612933 0.000000e+00 4678.0
2 TraesCS7D01G503900 chr7D 83.442 308 46 5 517 822 608513955 608513651 5.680000e-72 281.0
3 TraesCS7D01G503900 chr7D 74.066 455 92 18 1074 1506 609900585 609901035 2.150000e-36 163.0
4 TraesCS7D01G503900 chrUn 87.807 2731 226 54 29 2696 77648986 77646300 0.000000e+00 3099.0
5 TraesCS7D01G503900 chrUn 89.393 1631 134 16 396 1996 83441274 83439653 0.000000e+00 2017.0
6 TraesCS7D01G503900 chrUn 84.563 1328 141 26 1190 2483 317940740 317942037 0.000000e+00 1258.0
7 TraesCS7D01G503900 chrUn 94.502 673 18 5 2024 2696 83439665 83439012 0.000000e+00 1020.0
8 TraesCS7D01G503900 chrUn 92.012 651 39 1 280 930 373622201 373622838 0.000000e+00 902.0
9 TraesCS7D01G503900 chrUn 83.005 965 119 29 1721 2667 317942050 317942987 0.000000e+00 832.0
10 TraesCS7D01G503900 chrUn 84.000 150 15 3 29 170 373621731 373621879 4.680000e-28 135.0
11 TraesCS7D01G503900 chrUn 100.000 30 0 0 1 30 77649034 77649005 3.750000e-04 56.5
12 TraesCS7D01G503900 chr7B 90.748 2313 163 27 409 2696 697256971 697254685 0.000000e+00 3038.0
13 TraesCS7D01G503900 chr7B 93.733 1787 87 13 920 2696 693867576 693865805 0.000000e+00 2656.0
14 TraesCS7D01G503900 chr7B 90.096 1969 123 24 753 2696 696899066 696897145 0.000000e+00 2490.0
15 TraesCS7D01G503900 chr7B 88.588 1954 149 31 781 2696 693248759 693246842 0.000000e+00 2305.0
16 TraesCS7D01G503900 chr7B 88.347 738 46 12 29 743 693249466 693248746 0.000000e+00 850.0
17 TraesCS7D01G503900 chr7B 89.671 668 56 9 266 924 693904975 693904312 0.000000e+00 839.0
18 TraesCS7D01G503900 chr7B 86.825 630 45 15 29 641 696899943 696899335 0.000000e+00 669.0
19 TraesCS7D01G503900 chr7B 86.738 279 18 11 29 291 697257664 697257389 2.630000e-75 292.0
20 TraesCS7D01G503900 chr7B 94.565 92 5 0 270 361 697257376 697257285 2.800000e-30 143.0
21 TraesCS7D01G503900 chr7B 100.000 30 0 0 1 30 693249514 693249485 3.750000e-04 56.5
22 TraesCS7D01G503900 chr7B 100.000 30 0 0 1 30 696899991 696899962 3.750000e-04 56.5
23 TraesCS7D01G503900 chr7A 91.820 1626 90 13 159 1766 699842746 699841146 0.000000e+00 2226.0
24 TraesCS7D01G503900 chr7A 97.327 449 11 1 1796 2243 699841150 699840702 0.000000e+00 761.0
25 TraesCS7D01G503900 chr7A 93.902 246 11 1 2314 2559 699840687 699840446 4.240000e-98 368.0
26 TraesCS7D01G503900 chr7A 98.077 156 3 0 2541 2696 699840329 699840174 3.420000e-69 272.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G503900 chr7D 610213923 610216618 2695 False 4979.000000 4979 100.000000 1 2696 1 chr7D.!!$F2 2695
1 TraesCS7D01G503900 chr7D 607612933 607615621 2688 True 4678.000000 4678 98.036000 1 2696 1 chr7D.!!$R1 2695
2 TraesCS7D01G503900 chrUn 77646300 77649034 2734 True 1577.750000 3099 93.903500 1 2696 2 chrUn.!!$R1 2695
3 TraesCS7D01G503900 chrUn 83439012 83441274 2262 True 1518.500000 2017 91.947500 396 2696 2 chrUn.!!$R2 2300
4 TraesCS7D01G503900 chrUn 317940740 317942987 2247 False 1045.000000 1258 83.784000 1190 2667 2 chrUn.!!$F1 1477
5 TraesCS7D01G503900 chrUn 373621731 373622838 1107 False 518.500000 902 88.006000 29 930 2 chrUn.!!$F2 901
6 TraesCS7D01G503900 chr7B 693865805 693867576 1771 True 2656.000000 2656 93.733000 920 2696 1 chr7B.!!$R1 1776
7 TraesCS7D01G503900 chr7B 697254685 697257664 2979 True 1157.666667 3038 90.683667 29 2696 3 chr7B.!!$R5 2667
8 TraesCS7D01G503900 chr7B 696897145 696899991 2846 True 1071.833333 2490 92.307000 1 2696 3 chr7B.!!$R4 2695
9 TraesCS7D01G503900 chr7B 693246842 693249514 2672 True 1070.500000 2305 92.311667 1 2696 3 chr7B.!!$R3 2695
10 TraesCS7D01G503900 chr7B 693904312 693904975 663 True 839.000000 839 89.671000 266 924 1 chr7B.!!$R2 658
11 TraesCS7D01G503900 chr7A 699840174 699842746 2572 True 906.750000 2226 95.281500 159 2696 4 chr7A.!!$R1 2537

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
612 1179 0.387929 TCACTTTCCGCAGAGTCGTT 59.612 50.0 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2312 3928 2.595124 AAAAGAAAAACTGGGTGCCG 57.405 45.0 0.0 0.0 0.0 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
280 380 2.109774 CTCTTCTCCAGACTCCAGCAT 58.890 52.381 0.00 0.0 0.00 3.79
378 669 1.916777 GGTTCCCGACTCCCCTTCA 60.917 63.158 0.00 0.0 0.00 3.02
510 1077 0.464036 AAATGGCCTCGTCGCTGATA 59.536 50.000 3.32 0.0 0.00 2.15
612 1179 0.387929 TCACTTTCCGCAGAGTCGTT 59.612 50.000 0.00 0.0 0.00 3.85
873 1597 1.293498 GGAGCTCGTGGTGTGTGAT 59.707 57.895 7.83 0.0 0.00 3.06
903 1627 2.456119 GCGACACATCCTGCTTCCG 61.456 63.158 0.00 0.0 0.00 4.30
1090 1814 2.035442 GTGGCTGCCTTCGTCTTCC 61.035 63.158 21.03 0.0 0.00 3.46
2232 3085 6.868864 GTGCTCACAAATAAGAGACTCACTAA 59.131 38.462 5.02 0.0 33.74 2.24
2312 3928 4.256180 CACTGATAGGCGGGGGCC 62.256 72.222 0.00 0.0 0.00 5.80
2338 3955 5.411361 GCACCCAGTTTTTCTTTTTGTTTCT 59.589 36.000 0.00 0.0 0.00 2.52
2568 4327 4.501400 GGCTGCAACACAAATCTACCTTTT 60.501 41.667 0.50 0.0 0.00 2.27
2609 4371 8.385858 GTTTTACCGGACTCATTTACTTATGTC 58.614 37.037 9.46 0.0 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
433 987 1.003928 GTTGGTGGTAGGGGAATTCGT 59.996 52.381 0.00 0.00 0.00 3.85
873 1597 3.555324 TGTCGCTGGTGCAAGGGA 61.555 61.111 1.27 1.27 39.64 4.20
903 1627 1.469423 GCTAGGTCGTGAGGTACTTGC 60.469 57.143 0.00 0.00 41.55 4.01
1090 1814 1.081892 CATTGTCTGGTGCTCGAAGG 58.918 55.000 0.00 0.00 0.00 3.46
2232 3085 7.017945 GCACAAGCTATTCCTGCTATACAGAT 61.018 42.308 0.00 0.00 42.97 2.90
2312 3928 2.595124 AAAAGAAAAACTGGGTGCCG 57.405 45.000 0.00 0.00 0.00 5.69
2313 3929 3.605634 ACAAAAAGAAAAACTGGGTGCC 58.394 40.909 0.00 0.00 0.00 5.01
2314 3930 5.411361 AGAAACAAAAAGAAAAACTGGGTGC 59.589 36.000 0.00 0.00 0.00 5.01
2315 3931 8.716646 ATAGAAACAAAAAGAAAAACTGGGTG 57.283 30.769 0.00 0.00 0.00 4.61
2450 4073 7.502561 ACACTTAAAACTTATGCCTCTGAAACT 59.497 33.333 0.00 0.00 0.00 2.66
2451 4074 7.649057 ACACTTAAAACTTATGCCTCTGAAAC 58.351 34.615 0.00 0.00 0.00 2.78
2568 4327 6.431543 TCCGGTAAAACTTAGATCATGCAAAA 59.568 34.615 0.00 0.00 0.00 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.